ID: 964612921

View in Genome Browser
Species Human (GRCh38)
Location 3:158632913-158632935
Sequence CAGCAACCAAAATGAGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964612921_964612924 30 Left 964612921 3:158632913-158632935 CCATAATCTCATTTTGGTTGCTG No data
Right 964612924 3:158632966-158632988 AGGATGTTAGAAATGAAAGCAGG No data
964612921_964612923 10 Left 964612921 3:158632913-158632935 CCATAATCTCATTTTGGTTGCTG No data
Right 964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964612921 Original CRISPR CAGCAACCAAAATGAGATTA TGG (reversed) Intergenic