ID: 964612923

View in Genome Browser
Species Human (GRCh38)
Location 3:158632946-158632968
Sequence AAATGCTACTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964612921_964612923 10 Left 964612921 3:158632913-158632935 CCATAATCTCATTTTGGTTGCTG 0: 9
1: 11
2: 20
3: 22
4: 193
Right 964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG No data
964612919_964612923 20 Left 964612919 3:158632903-158632925 CCAGTCTACTCCATAATCTCATT No data
Right 964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964612923 Original CRISPR AAATGCTACTTCACAAAGAT AGG Intergenic
No off target data available for this crispr