ID: 964612923 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:158632946-158632968 |
Sequence | AAATGCTACTTCACAAAGAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
964612921_964612923 | 10 | Left | 964612921 | 3:158632913-158632935 | CCATAATCTCATTTTGGTTGCTG | No data | ||
Right | 964612923 | 3:158632946-158632968 | AAATGCTACTTCACAAAGATAGG | No data | ||||
964612919_964612923 | 20 | Left | 964612919 | 3:158632903-158632925 | CCAGTCTACTCCATAATCTCATT | No data | ||
Right | 964612923 | 3:158632946-158632968 | AAATGCTACTTCACAAAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
964612923 | Original CRISPR | AAATGCTACTTCACAAAGAT AGG | Intergenic | ||