ID: 964612924

View in Genome Browser
Species Human (GRCh38)
Location 3:158632966-158632988
Sequence AGGATGTTAGAAATGAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964612922_964612924 4 Left 964612922 3:158632939-158632961 CCACAGAAAATGCTACTTCACAA No data
Right 964612924 3:158632966-158632988 AGGATGTTAGAAATGAAAGCAGG No data
964612921_964612924 30 Left 964612921 3:158632913-158632935 CCATAATCTCATTTTGGTTGCTG No data
Right 964612924 3:158632966-158632988 AGGATGTTAGAAATGAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964612924 Original CRISPR AGGATGTTAGAAATGAAAGC AGG Intergenic