ID: 964613990

View in Genome Browser
Species Human (GRCh38)
Location 3:158643021-158643043
Sequence CAAATAATCAGACTGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964613990_964613995 -2 Left 964613990 3:158643021-158643043 CCTGCTACCAGTCTGATTATTTG 0: 1
1: 0
2: 2
3: 39
4: 305
Right 964613995 3:158643042-158643064 TGCCAGAGGGGACCAGTCAGAGG 0: 1
1: 1
2: 18
3: 63
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964613990 Original CRISPR CAAATAATCAGACTGGTAGC AGG (reversed) Intergenic
900682067 1:3922320-3922342 CAACCAATCAGACTGGTTGCAGG - Intergenic
900682086 1:3922481-3922503 CAACCAATCAGACTGGTCACGGG - Intergenic
902541206 1:17156332-17156354 CAACCAATCAGACTGATTGCTGG + Intergenic
904734313 1:32618899-32618921 CAACCAATCAGACTGGTCGTGGG + Intronic
906454857 1:45985640-45985662 CAGATTATCAGACAGGCAGCTGG + Intronic
907183262 1:52589361-52589383 CAATCAATCAGACTGATTGCTGG + Intergenic
907371695 1:54007788-54007810 GGTATAATCACACTGGTAGCTGG + Intronic
907378431 1:54064512-54064534 CAACCAATCATACTGGTTGCAGG - Intronic
908561085 1:65307837-65307859 CAAACAATCTGAATGGTGGCAGG - Intronic
909400477 1:75223231-75223253 CAAAAAAGCAGAAAGGTAGCTGG - Intronic
909801357 1:79812657-79812679 CAAAAAAACAGACTGGAGGCAGG + Intergenic
910734951 1:90443462-90443484 CAACCGATCAGACTGGTGGCGGG - Intergenic
911809943 1:102263211-102263233 CAACCAATCAGACTGGTTGAAGG + Intergenic
915862817 1:159465217-159465239 CAACAAATCAGACTGATTGCAGG + Intergenic
916918000 1:169430881-169430903 CAACCAATCAGACTGATTGCGGG - Intronic
916981794 1:170145740-170145762 CAAATATTCAGGGTGTTAGCAGG + Intergenic
919415353 1:197301460-197301482 TAAATAATGAGACTTGAAGCCGG - Intronic
920899229 1:210089990-210090012 CAACCAATCAGACTGGTCACAGG - Intronic
921410133 1:214826921-214826943 CAACCAATCAGATTGGTAACGGG - Intergenic
922968969 1:229718080-229718102 CAACCTATCAGACTGGTTGCAGG - Intergenic
923172782 1:231432221-231432243 CAACCAATCAGACTGATTGCGGG - Intergenic
924251048 1:242133274-242133296 CAACCAATCAGACTGGTTGTGGG + Intronic
924712206 1:246538838-246538860 CAAATCTTCAGACTGATTGCAGG + Intergenic
1063080223 10:2760836-2760858 CAACCAATCAGACTGGTCTCTGG + Intergenic
1063799432 10:9556128-9556150 CAAATAAACTGAATGTTAGCTGG + Intergenic
1065021560 10:21506176-21506198 CAAATATGCAGACCAGTAGCTGG - Intergenic
1065781634 10:29174438-29174460 CAACCAATCAGACTGGTTGTGGG - Intergenic
1067246305 10:44549369-44549391 CAACCAATCAGACTGATTGCCGG + Intergenic
1068026316 10:51649837-51649859 CAACCAATCAGACTGATTGCGGG - Intronic
1068938936 10:62662133-62662155 CAACAAATCAGACTGGTTGCAGG - Intronic
1071976969 10:90964904-90964926 GATATAAGCAGACTGGAAGCTGG - Intergenic
1072036674 10:91569261-91569283 CAACTAATCAGACTGATGGCGGG - Intergenic
1072523171 10:96247809-96247831 CAACCAATCAGACTGGTCGTGGG + Intronic
1073500972 10:103936844-103936866 CAAAAAATAAGATTGGTAGATGG - Intergenic
1073877008 10:107936527-107936549 CAATCAATCAGACTGATTGCAGG + Intergenic
1074938877 10:118215507-118215529 AAAATATTCTGACTGGTGGCTGG + Intergenic
1075155505 10:119973369-119973391 CAACCAATCAAACTGGTTGCAGG - Intergenic
1075155512 10:119973450-119973472 CAACCAATCAGACTGGTTGTAGG - Intergenic
1076652839 10:132001784-132001806 CAGCCAATCAGACTGGTTGCAGG + Intergenic
1078405728 11:11068358-11068380 CAAATGAACACACTGGTAACTGG + Intergenic
1081013166 11:37841577-37841599 CAACCAATCAGACTGATTGCTGG + Intergenic
1082920709 11:58490351-58490373 TAAATAATCAGAATTATAGCAGG + Intergenic
1083689947 11:64401458-64401480 CAAGTAATCAACCTGCTAGCAGG - Intergenic
1084198428 11:67539680-67539702 CAAACAATCAGACTGATTGTGGG + Intergenic
1085357281 11:75850051-75850073 CAACCAATCAGACTGATTGCAGG - Intronic
1087408629 11:97762578-97762600 TAAATAATAAGACTGGTCTCTGG + Intergenic
1089593021 11:119556893-119556915 CAACCAATCAGACTGGTCACAGG + Intergenic
1089593044 11:119557055-119557077 CAACCAATCAGACTGGTTGCAGG + Intergenic
1090100941 11:123796314-123796336 CAACCAATCAGACTGGTCACAGG - Intergenic
1090343111 11:126043244-126043266 CAAACAATCAGACCGATTGCAGG + Intronic
1090524889 11:127522395-127522417 CATATCTTCAGACTGGGAGCTGG + Intergenic
1092251522 12:6900978-6901000 CAACCAGTCAGACTGATAGCAGG - Intronic
1092655313 12:10677880-10677902 CAACCAATCAGACTGGTTGCAGG - Intergenic
1092864636 12:12749481-12749503 CAACCAATCAGACTGATTGCAGG + Intronic
1094288532 12:28819944-28819966 CAACCAATCAGACTGGTCACTGG - Intergenic
1094757292 12:33486241-33486263 CAAGTAATGAGACTGGTAAAAGG - Intergenic
1096289160 12:50326256-50326278 CAATGAATCAGACTGATTGCAGG + Intronic
1096289210 12:50326660-50326682 CAACCAATCAGACTGATTGCAGG + Intronic
1096434733 12:51579592-51579614 CAACCAATCAGACTGATTGCAGG - Intergenic
1097479186 12:60099797-60099819 CAACCAATCAGACTGGTTGCAGG - Intergenic
1097932162 12:65200119-65200141 CAACTGATCAGACTGGTCACCGG + Intronic
1098048350 12:66425997-66426019 CAAATAATCAGAATAGCATCAGG - Intronic
1098314571 12:69179933-69179955 AAGATAATCAGACTGAGAGCTGG - Intergenic
1098729181 12:74011371-74011393 CAAATGATAATACTGGTACCAGG + Intergenic
1099227808 12:79990839-79990861 CAACCAATCAGACTGATTGCGGG + Intergenic
1100572592 12:95857382-95857404 CAACCAATCAGACTGGTTGTGGG + Intergenic
1100661045 12:96699189-96699211 CAACCAATCAGACTGATTGCAGG - Intronic
1101168497 12:102063364-102063386 CAACCAATCAGACTGATTGCGGG - Intergenic
1102807654 12:115795934-115795956 CATATAATCAAACAGGTCGCTGG - Intergenic
1105571756 13:21610262-21610284 CACACAAGCAGACTGGTGGCCGG + Intergenic
1105600817 13:21885476-21885498 CGAATAATGAGGATGGTAGCAGG - Intergenic
1106857464 13:33868569-33868591 CAACTAATCAGACTGGCTGTGGG + Intronic
1107000724 13:35541510-35541532 CTTATAGTGAGACTGGTAGCTGG + Intronic
1107407661 13:40129598-40129620 CAACCAATCAAACTGGTAGTGGG - Intergenic
1107407675 13:40129758-40129780 CAACCAATCAGGCTGGTCGCAGG - Intergenic
1107576022 13:41723467-41723489 CAAAGAATAAGGCTGGAAGCAGG + Intronic
1109797423 13:67334743-67334765 CAAATAATCAGCATGGTAATAGG + Intergenic
1110251259 13:73383258-73383280 CAACCAATCAGACTGATTGCAGG + Intergenic
1110896584 13:80760429-80760451 CAACAAATCAGACTGATTGCAGG + Intergenic
1110896605 13:80760672-80760694 CAACCAATCAGACTGATTGCAGG + Intergenic
1111055497 13:82944237-82944259 CAACCAATCAGACTGGTTGTTGG - Intergenic
1111055510 13:82944388-82944410 CAACCAATCAGACTGGTCGTGGG - Intergenic
1111764331 13:92508687-92508709 CAGATAATCAGCATGTTAGCTGG + Intronic
1111936158 13:94558855-94558877 CAACCAATCAGGCTGGTCGCAGG + Intergenic
1111991739 13:95123673-95123695 CTTATGATCACACTGGTAGCAGG + Intronic
1112780580 13:102896585-102896607 CAGATAATCAGACATATAGCTGG + Intergenic
1112921224 13:104615112-104615134 CAACCAATCAGATTGGTTGCAGG + Intergenic
1113059492 13:106307030-106307052 CAATCAATCAGACTGGTCTCAGG - Intergenic
1114491033 14:23102131-23102153 CAAAGACTCAGGCTGGTACCAGG - Intergenic
1115531549 14:34332759-34332781 CAACAAATCAGACTGATTGCAGG + Intronic
1115650525 14:35399596-35399618 CAGAGAATAAGACTGGTAGAGGG + Intergenic
1116985314 14:51213228-51213250 CAAAGATTAAGAGTGGTAGCAGG + Intergenic
1118450944 14:65901648-65901670 CAACCAATCAGACTGGTCGTGGG + Intergenic
1120286927 14:82514961-82514983 CAACCAATCAGACTGATTGCAGG + Intergenic
1120820516 14:88907634-88907656 CAACCAATCAGACTGGTCGAGGG + Intergenic
1122430546 14:101637608-101637630 TTAAGAATCAGACTGGTGGCTGG - Intergenic
1124724746 15:32146222-32146244 TAAATGATCATTCTGGTAGCTGG + Intronic
1126242714 15:46464126-46464148 CAACCAATCAGACTGATTGCCGG + Intergenic
1126857425 15:52852661-52852683 CAAATAAAGAGACTGGTTCCAGG - Intergenic
1129063076 15:72876508-72876530 CAACCAATCAGACTGGTCTCAGG + Intergenic
1129063081 15:72876589-72876611 CAACCAATCAGACTGGTTGCAGG + Intergenic
1129386451 15:75198795-75198817 CAACCAATCAGACTGGTTGCGGG - Intronic
1129944759 15:79529339-79529361 CAAATAACAATAATGGTAGCAGG - Intergenic
1130957602 15:88638626-88638648 CTGAGTATCAGACTGGTAGCAGG + Intronic
1131070506 15:89462729-89462751 CAACCAATCAGACTGGTTGTAGG + Intergenic
1131071535 15:89469547-89469569 CAACCAATCAGACTGGTTGCGGG + Intergenic
1131294146 15:91132429-91132451 CAACCAATCAGACTGATTGCAGG - Intronic
1131976959 15:97956631-97956653 CAAATAATCAAAATGAAAGCAGG + Intergenic
1133099052 16:3468042-3468064 CAACCAATCAGACTGATCGCAGG - Intronic
1133177608 16:4027072-4027094 CAACCAATCAGACTGGTCACAGG + Intronic
1133679653 16:8109036-8109058 CAACCAATCAGACTGGTGGCTGG - Intergenic
1135123355 16:19785580-19785602 CAACCAATCAGACTGATTGCGGG + Intronic
1135123361 16:19785681-19785703 CAACCAATCAGACTGATTGCTGG + Intronic
1137393704 16:48102168-48102190 CAACCAATCAGGCTGGTGGCAGG + Intronic
1138851309 16:60633054-60633076 CAACCAATCAGACTGGTTGCAGG - Intergenic
1140565543 16:76037115-76037137 CAACCAATCAGACTGGTCACGGG - Intergenic
1140642060 16:76986666-76986688 CAAACAGTCAGACTGGTTGTAGG - Intergenic
1140954949 16:79854444-79854466 AAAATAGTCAGAATGTTAGCAGG - Intergenic
1141282604 16:82642660-82642682 CAAAGCATCTGACTGGTAGTGGG - Intronic
1141544355 16:84754636-84754658 AAAATAAGCAAACTGGAAGCTGG + Intronic
1142660202 17:1423792-1423814 CAAGTAATCAGTCTGGTGGCTGG - Intronic
1143436991 17:6936548-6936570 CAACCAATCAGACTGGTCGGGGG - Intronic
1143437561 17:6940461-6940483 CAACCAATCAGACTGGTCGGGGG - Intronic
1145220186 17:21082167-21082189 CAGACAATCAGACTGGTCGTGGG + Intergenic
1146038591 17:29430343-29430365 CAACCAATCAGACTGATTGCAGG - Intronic
1148012770 17:44497641-44497663 CAAAAAAACAGACTGTCAGCTGG + Intronic
1150037643 17:61821113-61821135 CAACCAATCAGACTGGTCACAGG - Intronic
1153378242 18:4406199-4406221 CAACCAATCAGACTGGTGGTGGG - Intronic
1153800648 18:8665380-8665402 CAACTAATCAGACTGATTGCAGG - Intergenic
1155450545 18:25958767-25958789 CAACCAATCAGACTGATTGCTGG - Intergenic
1155521870 18:26676478-26676500 CTAAAAATCAGACTGTCAGCAGG + Intergenic
1155886382 18:31213995-31214017 GAAATGATAAGTCTGGTAGCAGG + Intergenic
1156188880 18:34696006-34696028 AGAATAAGCAGACTGATAGCAGG + Intronic
1156238405 18:35227472-35227494 CAACCAATCAGGCTGGTAGTGGG - Intergenic
1156849329 18:41707973-41707995 CAACCAATCAGACTGATTGCAGG - Intergenic
1157824696 18:50802294-50802316 CAACCAATCAGACTGGAAGCAGG - Intronic
1158266558 18:55665750-55665772 CAACTAATCAGACTGACAACAGG + Intergenic
1158619586 18:59021113-59021135 TAAATAATCAGATTGGGAGTGGG - Intergenic
1158654896 18:59321760-59321782 CAACCAATCAGACTGATTGCAGG + Intergenic
1160552179 18:79701191-79701213 TAAATAATAAGACTTGAAGCTGG - Intronic
1162238027 19:9323574-9323596 CAACAAATCAGACTGATGGCCGG + Intergenic
1162700487 19:12511449-12511471 CCAATACTTAGACTGGTACCTGG - Intronic
1164461522 19:28453000-28453022 CAACAAATCAGACTGATTGCGGG + Intergenic
1165111082 19:33502660-33502682 CAACCAATCAGACTGATGGCAGG + Intronic
1165533575 19:36424077-36424099 CAACCAATCAGACTGGTTGTGGG - Intergenic
1166952965 19:46442478-46442500 CAACCAATCAGACTGATTGCAGG + Intergenic
1167012615 19:46818852-46818874 CAACCAATCAGACTGGTCACAGG - Intergenic
1167012622 19:46818906-46818928 CAACCAATCAGACTGGTTACAGG - Intergenic
1167012630 19:46818960-46818982 CAACCAATCAGACTGGCTGCGGG - Intergenic
926838316 2:17049405-17049427 CAAATATTCGGAGTGGTAACTGG - Intergenic
927241293 2:20921720-20921742 CAATTAATCAGACAAGTGGCAGG + Intergenic
929711510 2:44271489-44271511 CAACCAATCAGACTGATTGCGGG - Intergenic
929711520 2:44271574-44271596 CAACCAATCAGACTGATTGCGGG - Intergenic
930672166 2:54162824-54162846 CAAAAAATCAGAAAGTTAGCCGG + Intronic
931985417 2:67736913-67736935 CAAATACTCAGAATGCTAACAGG + Intergenic
932692482 2:73925165-73925187 CAACCAATCAGACTGATCGCTGG - Intergenic
933660671 2:84925031-84925053 CAACCAATCAGACTGATAGTGGG + Intergenic
933814377 2:86053810-86053832 CAGATAATCAAACTGGTATAAGG - Intronic
937019613 2:118638540-118638562 CAACGAATCAGACTGATTGCAGG + Intergenic
940376268 2:152962597-152962619 CAACCAATCAGACTGGTCACAGG - Intergenic
940804466 2:158170682-158170704 CCAACAGTCAGACTAGTAGCTGG - Intergenic
943241388 2:185388961-185388983 AAAATAATCAGACTAGAATCAGG - Intergenic
943805314 2:192117722-192117744 CAACCAATCAGACTGGTCCCAGG + Intronic
944328814 2:198440861-198440883 CCACCAATCAGACTGGTTGCAGG - Intronic
944883499 2:204039685-204039707 CCAGAAATCAGAGTGGTAGCAGG + Intergenic
945975995 2:216271200-216271222 CAAATAGTCAGGCTGGGAGGTGG - Intronic
947472764 2:230413572-230413594 CAACCAATCAGACTGATTGCAGG - Intergenic
947472777 2:230413735-230413757 CAACCAATCAGACTGATTGCAGG - Intergenic
947719498 2:232361731-232361753 CAACCAATCAGACTGATTGCTGG + Intergenic
947882611 2:233532156-233532178 CAACAAATCAGACTGATTGCTGG + Intronic
947882631 2:233532400-233532422 CAACCAATCAGACTGATGGCGGG + Intronic
948075461 2:235162272-235162294 CAACCAATCAGACTGGTTGTGGG - Intergenic
948289070 2:236811182-236811204 CAACCAATCAGACTGATTGCGGG + Intergenic
1168803228 20:657289-657311 CAAATAATCACACTGGTTAATGG + Intronic
1169685626 20:8267900-8267922 CAACCAATCAGACTGGTTGTGGG - Intronic
1169698966 20:8425251-8425273 CAATAAATCAGACTGATTGCAGG - Intronic
1170018768 20:11812845-11812867 CAACCAATCAGACTGATGGCCGG - Intergenic
1170281123 20:14650023-14650045 CACATATTCAGAATGGGAGCAGG + Intronic
1172732144 20:37096900-37096922 CAACCAATCAGACTGATGGCGGG + Intergenic
1172841911 20:37907055-37907077 CAAATAACCATTCTGGCAGCGGG - Intronic
1174361950 20:50034536-50034558 CACAAAATCAGCCTGGGAGCAGG - Intergenic
1177354819 21:19994952-19994974 CAAATAATCACCCTGGAATCTGG - Intergenic
1177505158 21:22010689-22010711 CAAAAAACCATACTGGTGGCTGG - Intergenic
1177742820 21:25174491-25174513 CAAATAACCAGAATGATAGGAGG + Intergenic
1179497159 21:41779444-41779466 CAACGAATCAGACTGATTGCGGG + Intergenic
1179969959 21:44830471-44830493 CAACCAATCAGACTGATTGCAGG - Intergenic
1180619183 22:17148613-17148635 GAAATAATGAGACAGGTGGCAGG + Intronic
1184359407 22:44005737-44005759 CAACCAATCAGACTGGTCGCAGG + Intronic
1184819334 22:46897336-46897358 CAACCAATCAGACTGATAGCGGG - Intronic
1185107784 22:48884092-48884114 CAACCAATCAGACTAGTTGCAGG + Intergenic
949570923 3:5292262-5292284 AAAATAAACAGACTTGTAGCTGG + Intergenic
951188418 3:19741160-19741182 CAACCAATCAGACTGATTGCAGG + Intergenic
952321315 3:32280383-32280405 CAACCAATCAGACTGGTCGTGGG + Intronic
952775160 3:37038781-37038803 TAAAATATAAGACTGGTAGCTGG - Intronic
954206191 3:49060624-49060646 CAAAAAATCAGGCTGGGGGCTGG - Intronic
955904763 3:63795059-63795081 CAACCAATCAGACTGATTGCGGG + Intergenic
957579085 3:82047497-82047519 CAAAAAATTAGCCAGGTAGCCGG - Intergenic
958039545 3:88209586-88209608 CCAATAAAAAAACTGGTAGCTGG - Intergenic
958434827 3:94083468-94083490 CAACCAATCAGACTGATTGCGGG - Intronic
959194253 3:103158351-103158373 TAACTAATCAGACCGGTTGCAGG - Intergenic
959464979 3:106674700-106674722 CAACCAATCAGACTGATTGCAGG + Intergenic
963770983 3:149385888-149385910 CAAGCAATCAGACTGATTGCGGG - Intergenic
964613990 3:158643021-158643043 CAAATAATCAGACTGGTAGCAGG - Intergenic
969655574 4:8495862-8495884 CAAACAATCAGACTGGTTGTGGG + Intergenic
969655582 4:8495912-8495934 CAACCAATCAGACTGGTCGTGGG + Intergenic
970228450 4:13883954-13883976 CAACGAATCAGACTGATTGCAGG - Intergenic
971894906 4:32579824-32579846 CAAAATATCAAAGTGGTAGCTGG + Intergenic
972769076 4:42179496-42179518 CAACCAATCAGACTGATTGCAGG - Intergenic
972906177 4:43750361-43750383 CAAATAATCAGGCTGGACACAGG + Intergenic
973262923 4:48182856-48182878 CAAATAACCAGGCTGGTCTCAGG + Intronic
973597926 4:52511736-52511758 CAAAAAATCAGAAAGTTAGCCGG + Intergenic
974532213 4:63123603-63123625 CAACCAATCAGACTGATTGCCGG + Intergenic
975443870 4:74440553-74440575 CAACCAATCAGACTGGTCACAGG - Intergenic
975639927 4:76490318-76490340 CAACAAATCAGACTGATTGCCGG - Intronic
976222762 4:82771254-82771276 CCAATGAGCTGACTGGTAGCTGG + Intronic
976335981 4:83887144-83887166 CAAATCACCAGGCTGATAGCAGG - Intergenic
976814667 4:89133759-89133781 CAACTAATCAGACTGATCACGGG - Intergenic
977024593 4:91801004-91801026 CAAATAATGAGACTGGCATGTGG + Intergenic
978034797 4:103978834-103978856 CAACCAATCAGACTGGTGGCAGG + Intergenic
979424172 4:120544991-120545013 TAACCAATCAGACTGATAGCAGG - Intergenic
980407401 4:132371065-132371087 CAACCAATCAGACTGATTGCGGG + Intergenic
981346393 4:143682407-143682429 CAACCAATCAGACTGATTGCGGG + Intronic
982716262 4:158811758-158811780 CAGATTATCAGAATGTTAGCTGG - Intronic
985690807 5:1311248-1311270 CAACCAATCAGACTGGTCGTGGG - Intergenic
986236897 5:5919500-5919522 CAAATAAGCAGTCTTGAAGCAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
989002472 5:36775440-36775462 CAACCAATCAGACTGGTTGCAGG + Intergenic
990688278 5:58333148-58333170 CAACCAATCAGACTGCTTGCAGG - Intergenic
990688289 5:58333311-58333333 CAACTAATCAGACTGTTTGAGGG - Intergenic
992435969 5:76756521-76756543 CAACAAATCAGACTGATTGCAGG - Intergenic
992682203 5:79164691-79164713 CAAAAAATCAGCCAGGCAGCTGG + Intronic
994188664 5:96843284-96843306 CAACCAATCAGACTGATTGCAGG - Intronic
994355097 5:98785836-98785858 CAAATAATTAGACTGCCACCTGG - Intronic
995506134 5:112862300-112862322 CAACTAATCAGACTGGCCGCGGG - Intronic
995598410 5:113771636-113771658 CAACCAATCAGACTGATTGCAGG - Intergenic
995599192 5:113777237-113777259 CAAACAATCAGACTGATTGCGGG - Intergenic
995599203 5:113777400-113777422 CAACCAATCAGACTGATTGCAGG - Intergenic
995599208 5:113777481-113777503 CAACAAATCAGACTGATTGCAGG - Intergenic
996207232 5:120756016-120756038 CAACCAATCAGACTAGTTGCAGG - Intergenic
996207243 5:120756167-120756189 CAAACAATCAGACTGGTTGCAGG - Intergenic
997202425 5:132019366-132019388 CAAAAAATCAGACTAGAAGAGGG + Intergenic
998351160 5:141502321-141502343 AAAATAAAAAGACTGGGAGCTGG - Intronic
998472845 5:142396808-142396830 CAACCAATCAGACTGGTCCCTGG - Intergenic
998580089 5:143363935-143363957 CAAATAATCAGAGTGACAGAAGG + Intronic
999362556 5:150998205-150998227 CAAACAATCAGACTGATTGGGGG - Intergenic
1000086365 5:157890942-157890964 CAAACAATCAGACTGCTCACAGG - Intergenic
1000086373 5:157891033-157891055 CAGACTATCAGACTGGTTGCAGG - Intergenic
1000959595 5:167584359-167584381 CAACCAATCAGACTGGTTGTTGG - Intronic
1002669373 5:180853750-180853772 CAAATAATTCAACTGTTAGCAGG + Intronic
1003348082 6:5289628-5289650 CAACCAATCAGACTGGTCACAGG - Intronic
1003348092 6:5289719-5289741 CAACAAATCAGACTGGTCACAGG - Intronic
1003500276 6:6697382-6697404 CAAATAAGCAGACTCTTGGCTGG - Intergenic
1004706225 6:18126251-18126273 CAACCAATCAGACTGATTGCGGG - Intergenic
1004731305 6:18361844-18361866 CAAATAATCAAAATATTAGCTGG - Intergenic
1004838611 6:19557012-19557034 CAAAAAATTAGACTGGTGGCGGG + Intergenic
1004887034 6:20061056-20061078 CACACACTCAGAGTGGTAGCTGG + Intergenic
1006654996 6:35583355-35583377 TGAATAATCAGAATGGTAGAAGG + Intronic
1007822269 6:44569366-44569388 CAAAGCATCAGACTGATAGGTGG - Intergenic
1008393148 6:50976346-50976368 AAAATAATCAGAATGGTGCCCGG - Intergenic
1008630722 6:53360792-53360814 CAACCAATCAGACTGATTGCGGG - Intergenic
1008959190 6:57248623-57248645 CAACCAATCAGACTGGTAGTGGG - Intergenic
1008959199 6:57248677-57248699 CAATGGATCAGACTGGTTGCAGG - Intergenic
1010405916 6:75505673-75505695 CAACTGATCAGACTGGTCGCGGG - Intergenic
1011067387 6:83342110-83342132 CAACCAATCAGACTGATTGCAGG + Intronic
1011412896 6:87084298-87084320 AAGATAATCACACTGGTAACCGG - Intergenic
1011606401 6:89110507-89110529 CAACCAATCAGACTGGTCCCAGG - Intronic
1012711958 6:102617884-102617906 CAACAAATCAGACTGGTTGTGGG + Intergenic
1012712910 6:102631483-102631505 CAAACAATTAGACTGGTCACAGG + Intergenic
1012713466 6:102637928-102637950 CAACCAATCAGACTGGTCACAGG + Intergenic
1014519210 6:122418972-122418994 CAAATAAACTGCCTGGAAGCTGG + Intronic
1015161630 6:130158856-130158878 CAACCAATCAGACTGGTCGTGGG - Intronic
1015161648 6:130159016-130159038 CAACCAGTCAGACTGGTAGCAGG - Intronic
1015518423 6:134107852-134107874 CAACCAATCAGCCTGGTCGCCGG + Intergenic
1015547784 6:134379151-134379173 CAACCAATCAGACTGGTTGTGGG - Intergenic
1017032974 6:150240521-150240543 CAACCAATCAGACTGGTTGCAGG - Intronic
1017032984 6:150240612-150240634 CAAACAATCAGACTGGTCACAGG - Intronic
1017269357 6:152488796-152488818 CAAATAATAAGAGTAATAGCTGG + Intronic
1020290749 7:6720715-6720737 TCAATAATCAGATTGGTAGGAGG - Intergenic
1020409399 7:7874346-7874368 AAAATAATCACCCTGGTTGCTGG - Intronic
1020527702 7:9284076-9284098 CACATAAGCAGACTGATACCAGG + Intergenic
1020602407 7:10292615-10292637 CAACAAATCAGACTGGTTGTGGG - Intergenic
1021173904 7:17427983-17428005 CAACCAATCAGACTGGTTGTTGG + Intergenic
1021226859 7:18037828-18037850 CAACCAATCAGACTGGTCGCAGG + Intergenic
1021236890 7:18153421-18153443 CAACCAATCAGACTGGTCGTGGG - Intronic
1021236897 7:18153506-18153528 CAACCAATCAGGCTGGTAGAGGG - Intronic
1024176009 7:46841867-46841889 CAACGAATCAGACTGGTTGCGGG - Intergenic
1025859307 7:65311546-65311568 GAAGTAATCACACTGGTACCGGG + Intergenic
1026508724 7:71009601-71009623 CAACCAATCAGACTGGTCGTGGG - Intergenic
1027004962 7:74685070-74685092 CAACCAATCAGACTGCTTGCAGG - Intronic
1027775872 7:82463608-82463630 CAACCAATCAGACTGGTTGTGGG - Intergenic
1029852118 7:103473367-103473389 CAAAGAAACAGACTGTTAGCTGG + Intronic
1030115984 7:106062671-106062693 CAACCAATCAGACTGATTGCAGG - Intergenic
1032444974 7:131974486-131974508 GAAATAAACAGAGTGGTAGCTGG - Intergenic
1032457531 7:132084826-132084848 CAACCAATCAGACTGATTGCAGG + Intergenic
1032700972 7:134378757-134378779 CAACCAATCAGACTGATTGCGGG - Intergenic
1032870642 7:135980857-135980879 CAACCAATCAGACTGATTGCGGG - Intergenic
1036732778 8:11280977-11280999 CAACCATTCAGACTGGTTGCAGG - Intergenic
1037577402 8:20220689-20220711 CAAATAACAAGACTGTTATCAGG - Exonic
1038142681 8:24863856-24863878 CAACCAATCAGACTGGTCACAGG - Intergenic
1038866020 8:31439614-31439636 CATATAACCACACTGGCAGCAGG - Intergenic
1042912152 8:73838881-73838903 CAACTAATCAGACTGATTGTGGG + Intronic
1043469861 8:80551438-80551460 CACATCATCAGACTGGAAGCAGG - Intergenic
1043592093 8:81844078-81844100 CAACCAATCAGACTGGTTGAGGG + Intergenic
1043593076 8:81852308-81852330 CAACAAATCAGACTGGTTGTGGG + Intergenic
1043737006 8:83761187-83761209 CAAATAATCAGAAGAGCAGCAGG + Intergenic
1044588168 8:93887240-93887262 CAAGTGCTCAGAATGGTAGCTGG + Intronic
1044855532 8:96471354-96471376 CAACCAATCAGACTGGTCGCTGG + Intergenic
1046304076 8:112339159-112339181 CAACCAATCAGACTGATTGCAGG + Intronic
1046773228 8:118137198-118137220 CAATCAATCAGACTGATTGCCGG - Intergenic
1047539448 8:125750301-125750323 CAACCAATCAGACTGGTTACAGG + Intergenic
1047772748 8:128043444-128043466 AACAAAATCAGACTGGAAGCTGG + Intergenic
1048488332 8:134868996-134869018 CAAGTATTCAGACTGGTACAGGG - Intergenic
1049248119 8:141573544-141573566 CAACCAATCAGACTGATTGCAGG + Intergenic
1052905626 9:33831143-33831165 CACAGAAACAGACTGGTGGCTGG + Intronic
1053114307 9:35488650-35488672 CAACCAATCAGACTGATTGCAGG - Intergenic
1055668510 9:78576052-78576074 CAACCAATCAGACTGATTGCAGG + Intergenic
1055725963 9:79229066-79229088 CAACCAATCAGACTGGTGGCAGG + Intergenic
1055725974 9:79229151-79229173 CAACCAATCAGACTGGTCACAGG + Intergenic
1056514619 9:87338233-87338255 CAAAAAGTCAGATTGGTTGCGGG - Intergenic
1056570362 9:87809456-87809478 CAACCAATCAGACTGGTTGCAGG + Intergenic
1058310546 9:103496402-103496424 CAACCAATCAGACTGGTCGCAGG - Intergenic
1058310555 9:103496442-103496464 CAACCAATCAGACTGGTTGTGGG - Intergenic
1058760115 9:108122429-108122451 CAACCAATCAGACTGATTGCAGG + Intergenic
1058800404 9:108539930-108539952 CAAAGTATCAGACTGGTGGGAGG - Intergenic
1061372131 9:130203399-130203421 CAAATATTCACACTGGAGGCTGG - Intronic
1061566373 9:131443580-131443602 CAAAAAATTAGTCTGGTGGCGGG - Intronic
1062706500 9:137947132-137947154 CAACCAATCAGACTGGTAGCAGG - Intronic
1185790853 X:2927833-2927855 CAACCAATCAGACTGATCGCGGG + Intronic
1186818225 X:13258946-13258968 CAACCAATCAGACTGGTCGCAGG + Intergenic
1188282677 X:28289572-28289594 CAACCAATCAGACTGATTGCGGG - Intergenic
1188680865 X:33002626-33002648 CAACCAATCAGACTGATTGCGGG - Intronic
1188863837 X:35289938-35289960 CACCTAATCAGACTGAAAGCTGG + Intergenic
1189432456 X:40959673-40959695 CAACAAATCAGACTGATTGCAGG + Intergenic
1190766434 X:53479562-53479584 CAACCAATCAGACTGGTTGTGGG - Intergenic
1192119225 X:68439158-68439180 CAACTAATCAGACTGATTGGGGG + Intergenic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1193148537 X:78102244-78102266 CAACCAATCAGGCTGGTGGCAGG + Intronic
1193947512 X:87756187-87756209 CAACCAATCAGACTGGTTACAGG - Intergenic
1194075740 X:89390990-89391012 CAAATAATCAGAATTGCTGCTGG - Intergenic
1194474477 X:94341743-94341765 CAAAAAATCAGACTGATTGCGGG + Intergenic
1197446372 X:126555141-126555163 CAACTAATCAGACTGATTGTGGG + Intergenic
1197716996 X:129716720-129716742 CAACCAATCAGACTGATTGCGGG - Intergenic
1198186760 X:134260654-134260676 TAAATAATCAGACTGCTGCCTGG + Intergenic
1199113724 X:143964740-143964762 CAAACAATTAGACTGGTCGTGGG - Intergenic
1200731341 Y:6745145-6745167 CAAATAATCAGAATTGCTGCTGG - Intergenic
1202301146 Y:23415764-23415786 CAAAGGAACAGCCTGGTAGCTGG - Intergenic
1202569665 Y:26254834-26254856 CAAAGGAACAGCCTGGTAGCTGG + Intergenic