ID: 964621577

View in Genome Browser
Species Human (GRCh38)
Location 3:158724478-158724500
Sequence CTGTTTGCTTTGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 4, 3: 54, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964621574_964621577 21 Left 964621574 3:158724434-158724456 CCTATGAGAAGCAGACAGTAGTG 0: 1
1: 0
2: 0
3: 12
4: 263
Right 964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG 0: 1
1: 0
2: 4
3: 54
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964621577 Original CRISPR CTGTTTGCTTTGATGGAGGA TGG Intronic
901348735 1:8572341-8572363 CTGTGTGCTAAAATGGAGGAAGG - Intronic
902821395 1:18945459-18945481 CTGTTTGCTGTCTTGGGGGAGGG - Intronic
903971353 1:27120979-27121001 CTGTTTTCTTTGAAGCAGCATGG - Intronic
904321841 1:29702933-29702955 ATGTTTGATCTGATGGAGAAAGG + Intergenic
904894203 1:33801900-33801922 CTGTGTGCTTTGCTGGAAGAAGG + Intronic
905091281 1:35433282-35433304 CTGCTGGCTTTAAGGGAGGAGGG - Intergenic
905238750 1:36568359-36568381 CTATCTGCCTTGAGGGAGGAGGG - Intergenic
905572007 1:39013542-39013564 CTGGTTCCTTTAATGGAGGAGGG + Intergenic
907812730 1:57888143-57888165 ATGTTTTCTTTGAGGGGGGATGG + Intronic
908425963 1:64007610-64007632 ATGTTTGCTTTGATTCATGATGG + Intronic
908674280 1:66584944-66584966 CTTTTTGTTTTGAGGGAGAAGGG - Intronic
908755576 1:67466284-67466306 TTGTCTGCTTTCATGGAGGTGGG + Intergenic
911090023 1:94010857-94010879 CTGTTTGCCATGGTGGTGGAAGG - Exonic
911258174 1:95656448-95656470 CTTTTTTCTTTGATGAAGCAAGG + Intergenic
912654549 1:111474120-111474142 TTGTTTTCTTTGATGCAGGAAGG + Intronic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
919322943 1:196065848-196065870 CTGTTTCCTTACATGGTGGAAGG - Intergenic
920933732 1:210412069-210412091 CTGTGTGCTTTTGTGGTGGAAGG + Intronic
921732295 1:218591838-218591860 CTGCTGGCTTTGATGAGGGAAGG + Intergenic
923625900 1:235613562-235613584 CTGCTGGCTTTGAAGGTGGAAGG + Intronic
923626106 1:235615273-235615295 CTGCTGGCTTTGAAGGTGGAAGG + Intronic
923711535 1:236391266-236391288 CTAATTGCTTGGATTGAGGATGG + Intronic
1065286167 10:24189685-24189707 ATGTTTGGTTTGATGAAGAATGG + Intronic
1068936141 10:62637460-62637482 CTGGTTGATTTGATGGAGAGTGG - Intronic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1070930911 10:80259965-80259987 CTGGTTACCTTGATGAAGGAAGG - Intergenic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071213503 10:83371704-83371726 GTGTGTGTTTTCATGGAGGAAGG - Intergenic
1072551517 10:96481124-96481146 CTGTTTTTTTTGTTGGGGGATGG + Intronic
1076897221 10:133318624-133318646 GTGTTTCCTGTGAAGGAGGACGG - Intronic
1077933534 11:6758658-6758680 TTGTTGGCTTTGAAGGTGGAAGG - Intergenic
1079083153 11:17428017-17428039 CTTTTGGCTTTCATGGAGGAGGG - Intronic
1081593688 11:44444615-44444637 CTTTCTGCTTCCATGGAGGAAGG + Intergenic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1083529454 11:63406055-63406077 TGGTTTGCTTTTGTGGAGGAAGG + Intronic
1084495477 11:69500841-69500863 CTGTTTGCTCTGCTGGAGATGGG + Intergenic
1086099974 11:83089113-83089135 GTGTTTGATTAGATAGAGGATGG + Intergenic
1086102453 11:83115554-83115576 CTGTTTTCTTTGATGGTGTTTGG + Intergenic
1087452340 11:98341051-98341073 GTGTTTGCTACAATGGAGGAAGG + Intergenic
1088946757 11:114521535-114521557 CTCTTTTCTTTTATTGAGGAAGG + Intergenic
1089699197 11:120234294-120234316 CTGCTTTCTGTGATGTAGGAGGG - Intergenic
1089861312 11:121592230-121592252 CTGTTTGCACTGATGGATGGTGG - Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091242794 11:134065329-134065351 CTGTTTCCTTAGAGGGAGGTGGG + Intergenic
1091287893 11:134418555-134418577 GTGTTTGCTTTGCTGAATGAAGG - Intergenic
1091607470 12:1967154-1967176 CTGATTGCGTTGAAAGAGGAGGG - Intronic
1094280434 12:28731725-28731747 CTCTTTGATTTGATGGAGGAAGG - Intergenic
1096475909 12:51908573-51908595 CTGTTTCCTTTTCTGTAGGAAGG - Intronic
1096682697 12:53267460-53267482 CTGAATTCTTTGGTGGAGGAAGG + Intergenic
1096708999 12:53441884-53441906 CTTTTTTCTTTTTTGGAGGAAGG + Intronic
1097910988 12:64969000-64969022 GTGTCTGCTTTGGGGGAGGATGG + Intergenic
1098673704 12:73263503-73263525 CTTTCTGCTTTTATGGAGCATGG - Intergenic
1098980400 12:76949920-76949942 CTATTTCCTTTGAGGGAAGAGGG + Intergenic
1100705887 12:97199557-97199579 ATATTTGCTTTGTTGGGGGAAGG + Intergenic
1101721282 12:107352728-107352750 CTGCTGGGTTTGTTGGAGGAAGG + Intronic
1102991606 12:117320197-117320219 ATGTTTCCTTAGATGGAGAAAGG + Intronic
1103027724 12:117587392-117587414 CTGCTGGTTTTGAAGGAGGAGGG + Intronic
1103193814 12:119025039-119025061 ATGGGTGCTTTGATGGAGGTTGG + Intronic
1103419608 12:120769906-120769928 TTGTTGGCTTTGGTGGAGGGGGG - Intronic
1103889919 12:124230919-124230941 CTGGTTGCTTGGTTGGAGAATGG + Intronic
1103903780 12:124317003-124317025 CTGCCTGCTTTGATGGAGGATGG + Intergenic
1104072891 12:125361803-125361825 CTGTGAGCTCTGATGGAGGCTGG + Intronic
1106168416 13:27269326-27269348 CTGTTGGCTGTGATGAGGGAGGG - Intergenic
1106305687 13:28507123-28507145 ATGTATGCTTTGTTGTAGGAAGG - Intergenic
1107029888 13:35839810-35839832 CTGTTTGCTTTCATGGATCTTGG - Intronic
1107538235 13:41357569-41357591 CTGTTTGTTTTGATGTAGTGTGG + Intronic
1107857152 13:44627804-44627826 AAGTTTGCTGTGATGGAGAAGGG - Intergenic
1107895906 13:44963072-44963094 TTGTTTTTTTTGGTGGAGGAGGG - Intronic
1108500464 13:51065612-51065634 CCGTTTGCTGTGTTGGAGGATGG + Intergenic
1110528074 13:76562989-76563011 ATCTTTTTTTTGATGGAGGAAGG - Intergenic
1111898262 13:94168594-94168616 CTTTTTTCTTTCATGGAGGAAGG - Intronic
1111985486 13:95062038-95062060 GTGTTTGCTCTGATGGTGGAGGG - Intronic
1112361769 13:98725145-98725167 CTGCTTCCATTCATGGAGGAAGG - Intronic
1112367973 13:98772029-98772051 CTGTTTGCTTTGAGAGAGGGTGG + Intergenic
1112884949 13:104158822-104158844 CTGTTTCCTTAGATGGTAGAAGG + Intergenic
1113032680 13:106012097-106012119 TTCTTTGCTTTTTTGGAGGAAGG - Intergenic
1113101345 13:106722818-106722840 CTCTTTGCTTTTATAGAGGAGGG + Intergenic
1113842657 13:113369252-113369274 CTGCTTGCTTTCAGGCAGGAGGG - Intergenic
1114377385 14:22162466-22162488 TGGTTTACTATGATGGAGGAAGG - Intergenic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1115036264 14:28860443-28860465 CTGGTTGCTTTGTAGGAGGAAGG + Intergenic
1117351840 14:54888968-54888990 CTGTTTACTGTGGTGGAGGAGGG + Intronic
1117373737 14:55102201-55102223 TTGTTTGCTTTGTTGGAGGAGGG - Intergenic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1120006226 14:79361042-79361064 CTGTTAGCTATGATGAAGGCAGG + Intronic
1121020219 14:90575435-90575457 CTGTGCCCTTCGATGGAGGAAGG - Intronic
1121397470 14:93638950-93638972 CTGTCTGCTTTTATAGATGACGG + Intronic
1121794879 14:96726479-96726501 CTGCTGGCTTTGAAGGTGGAGGG + Intergenic
1121872176 14:97418575-97418597 CAGTTTGCCTAAATGGAGGAGGG - Intergenic
1122182039 14:99962369-99962391 CTGCTTGCATTCATGGTGGAAGG - Intergenic
1124577560 15:30923232-30923254 CTATTTCCTCTCATGGAGGAGGG + Intronic
1124601955 15:31140640-31140662 CTGCTTCCATTCATGGAGGAAGG - Intronic
1125364183 15:38896312-38896334 CAGATTGCTGTGATGGAGCAGGG - Intergenic
1129072105 15:72960237-72960259 CTGTTTTCCTTACTGGAGGAGGG + Intergenic
1129762026 15:78134748-78134770 GTGTTTGCTGGGAGGGAGGATGG + Intronic
1129958245 15:79659004-79659026 CTGCTTCCTCTCATGGAGGAAGG + Intergenic
1130805593 15:87318177-87318199 GGGTTTGCTTTGATTGAAGATGG - Intergenic
1130840019 15:87689777-87689799 CTCATTGCTTTTATGAAGGAGGG - Intergenic
1131498544 15:92936838-92936860 TTTTTTTTTTTGATGGAGGAGGG + Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1132662336 16:1067117-1067139 TTGTTTGTTTTGGTGGAGGCGGG + Intergenic
1132699113 16:1214794-1214816 CTGTATGCTGGGCTGGAGGAGGG + Intronic
1133485653 16:6215786-6215808 CTGTTTTCTTACATGGAGAAAGG + Intronic
1135700817 16:24630925-24630947 CTGTTTGCTGGGGTGGAGGTGGG + Intergenic
1135831195 16:25775171-25775193 CTGTTTGATGTGTCGGAGGATGG + Intronic
1136241049 16:28944234-28944256 TTGTTTGTTTTGATGGAGTCTGG + Intergenic
1136383023 16:29905700-29905722 CTGTTTGCTTTTATGGTGTTTGG + Intronic
1136457527 16:30389713-30389735 TTGTTTGCTTTGACAAAGGAAGG + Intronic
1136543551 16:30942546-30942568 CTGTTTGCTTTTCTGGAGAATGG + Intronic
1138155965 16:54702985-54703007 CGGCTTGCTTGGAGGGAGGAAGG + Intergenic
1140154652 16:72411172-72411194 CTGTTTGCATTGTTGGAACATGG - Intergenic
1140510990 16:75508457-75508479 CTTTTTTCATTGGTGGAGGAAGG - Intergenic
1140811670 16:78584921-78584943 CTGTGTGCTTTGACCGAGGCGGG - Intronic
1140816735 16:78628133-78628155 CTGCTTCCTTTGTTGGAGGTGGG + Intronic
1142216009 16:88830293-88830315 CTGCTGGCTTTGACGGTGGAGGG + Intronic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1144130669 17:12243571-12243593 CTGCTTGCATGGAAGGAGGAAGG - Intergenic
1145826331 17:27879844-27879866 CAGTATGTTTTGGTGGAGGAAGG - Intronic
1146749572 17:35366095-35366117 CTTTTTAATTTGAAGGAGGATGG - Intronic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147322580 17:39655086-39655108 GTGTTTGCTTTGATGTTGGATGG - Intronic
1147782501 17:42953774-42953796 CTGTGTCCTTTGTTGTAGGAAGG - Exonic
1149343926 17:55715513-55715535 CTTTTTGTTGTAATGGAGGAAGG + Intergenic
1149405558 17:56346667-56346689 CTCTTTGCTGTTATGGAGAAAGG + Intronic
1150913764 17:69414958-69414980 CCCTTTCCTTTGATGGGGGAGGG - Exonic
1151834527 17:76574179-76574201 CTGGGTGCTTGGACGGAGGAGGG + Intronic
1151972102 17:77463302-77463324 CTGTGTGCTCTGATGGGGGTGGG - Intronic
1151973059 17:77468947-77468969 CTGTTCACTTAGATGGGGGATGG + Intronic
1152943014 17:83182259-83182281 CTGTTTGCTGGGATGGGTGAGGG + Intergenic
1153752376 18:8246005-8246027 CTGTTGGCTTTATTGAAGGAAGG - Intronic
1155729605 18:29137130-29137152 GTGTTTGTTTTGAAAGAGGAGGG + Intergenic
1157312190 18:46560638-46560660 CTGTTTGCTAAGCTGCAGGATGG + Intronic
1158767204 18:60466719-60466741 CTGATTGCTTAGATGGGGGTTGG + Intergenic
1159758286 18:72392727-72392749 CGGTTTGGTTAGATGGATGAGGG + Intergenic
1161612639 19:5251603-5251625 CTGTTTCCTCTGTTGGGGGAGGG - Intronic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1164668936 19:30062304-30062326 CTGGTTGCTTTGGTTGATGAGGG - Intergenic
1165251959 19:34546097-34546119 CTGTGTGCTTTTATGGTGGATGG - Intergenic
1165274694 19:34738277-34738299 CTGTGTCCTTTTATGGTGGAAGG + Intronic
1165325310 19:35111278-35111300 CTGCCTGGTTTGATGGAGGGAGG - Intergenic
1166102306 19:40577868-40577890 CTGTTTGCTTTTTTAGAGAAGGG - Intronic
1166533991 19:43560493-43560515 GTGCTGGCTTTGATGAAGGAAGG + Intronic
1167277132 19:48545410-48545432 CTCCTGGGTTTGATGGAGGAGGG - Intergenic
1167314727 19:48756707-48756729 CTCTTGGGTTTGAAGGAGGAAGG + Intronic
1167498745 19:49834047-49834069 CTGTGTGCTTTCATGAAGGAGGG + Intronic
1168277344 19:55285086-55285108 CTTTTGGGTTTGAGGGAGGAGGG + Intronic
1168447230 19:56430466-56430488 CTGATTGATTGGATGGTGGAAGG + Intronic
925798392 2:7571395-7571417 CTGTTTATTTTGGTGGAGGAAGG + Intergenic
926586706 2:14694108-14694130 CTGTTTGCTCTTATGTATGATGG + Intergenic
927348466 2:22076351-22076373 GTGTTTGCTTAGATGTGGGAGGG - Intergenic
928976877 2:37096882-37096904 CTTCTTGCTTTGAAGGAGCAAGG + Exonic
929406103 2:41643242-41643264 ATGTGTACTTTGATGAAGGATGG + Intergenic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931012829 2:57937365-57937387 CTGTTTGTTTTTCTGAAGGAAGG - Intronic
932264514 2:70355840-70355862 TTGTTTTCTATGATGGGGGAAGG - Intergenic
935059030 2:99592347-99592369 CTGTTAGCATTGATCAAGGAGGG - Intronic
935134267 2:100285682-100285704 TTGCTGGCTCTGATGGAGGAAGG + Intronic
939449883 2:142360420-142360442 TCATTTGCTGTGATGGAGGATGG - Intergenic
939824441 2:146998103-146998125 CTGTTTCCTTTTATAGATGAAGG - Intergenic
939872571 2:147541502-147541524 CTGTTTCCGTTCATGGTGGAAGG - Intergenic
941472624 2:165907754-165907776 CTGTCAGCTCTCATGGAGGATGG - Exonic
942467738 2:176226166-176226188 GTGTTTGCTTTGATGAAAAAAGG + Intergenic
942902442 2:181137836-181137858 CTGTTTTCTTGTATGGAGGATGG - Intergenic
943435344 2:187858907-187858929 CTTTTTGGTTTCATGGAAGAAGG + Intergenic
946145199 2:217725374-217725396 CTGTTTGCTGAGCTGGAAGAGGG - Intronic
947008117 2:225535754-225535776 GTGGTTGCTTAGATGGAGGTAGG + Intronic
947039073 2:225894583-225894605 CTGTATCCTTTGAAGCAGGATGG - Intergenic
948015451 2:234686598-234686620 CTGCTGGCTTTGAAGGTGGAGGG + Intergenic
948125300 2:235560615-235560637 CTGTTGGCTTTGATGATGGAGGG + Intronic
1169623708 20:7539112-7539134 CTGTTTTCTTTGAAAGTGGAAGG + Intergenic
1170102088 20:12713119-12713141 GTCTAAGCTTTGATGGAGGATGG - Intergenic
1173123728 20:40317587-40317609 CAGTCTGCTTTGCTGGAGGCTGG - Intergenic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1174283975 20:49459285-49459307 CTGTTTGATTTGCTGCAGAACGG - Intronic
1174528573 20:51193003-51193025 CTGCTTACTTTGATGGGGGCAGG - Intergenic
1174661089 20:52213826-52213848 CTGTTGGCTTTGAAGATGGAAGG - Intergenic
1175834692 20:61986015-61986037 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834698 20:61986037-61986059 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834704 20:61986059-61986081 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834709 20:61986081-61986103 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834721 20:61986125-61986147 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834726 20:61986147-61986169 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834732 20:61986169-61986191 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834738 20:61986191-61986213 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834744 20:61986213-61986235 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834761 20:61986279-61986301 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834767 20:61986301-61986323 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834773 20:61986323-61986345 GTGTTTCCTTTGATGGGGGATGG - Intronic
1175834779 20:61986345-61986367 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834784 20:61986367-61986389 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834789 20:61986389-61986411 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834800 20:61986433-61986455 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834805 20:61986455-61986477 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834810 20:61986477-61986499 GTGTTTCCTTTGATTGGGGATGG - Intronic
1175834820 20:61986521-61986543 GTGTTTCCTTTGATGGGGGATGG - Intronic
1178606397 21:34039972-34039994 CTTGTTGCTTTTATGGAGGAGGG - Intergenic
1180682522 22:17638499-17638521 CTGGTCGCTGTGTTGGAGGAAGG - Intronic
1182108713 22:27707460-27707482 ATCTTTGCCTTGATGGAGCACGG - Intergenic
1182579421 22:31296166-31296188 CTGATTGCCTTGAGGAAGGAAGG - Intergenic
1182930159 22:34165989-34166011 TTGGTTGGTTTGATGGAGGGAGG + Intergenic
1185104864 22:48861926-48861948 CTGTTTGCTCTGATGCAGGCTGG - Intergenic
949661115 3:6279876-6279898 CTGTTTCCTTACATGGTGGATGG - Intergenic
950010029 3:9716390-9716412 CTGTTTGGTTTGGTGGAGGCAGG + Intronic
950612334 3:14134400-14134422 CTGTGTGCTTTGTTGCTGGATGG + Intronic
952800136 3:37282807-37282829 CTGTTTGGTCTAAGGGAGGAAGG + Intronic
953465007 3:43112031-43112053 CTGGTTGCTTGGCTGGGGGAAGG - Intergenic
953838733 3:46370870-46370892 CTGTTTCTTTTGAAGGAGGGTGG - Exonic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
958484771 3:94690793-94690815 CTGTGTCCTTTCATGGTGGAAGG + Intergenic
960954921 3:123025539-123025561 CTGTTGGCTTTGGAGGAGGAAGG + Intronic
960991097 3:123311847-123311869 CTGTTTCCTTGGGTGGGGGAGGG - Intronic
961616084 3:128182118-128182140 TTGTTTTCTTTGATGGGGCAAGG + Intronic
962074813 3:132070454-132070476 GTGTTGGCTGTGATGGATGAGGG + Intronic
962241589 3:133755150-133755172 CTGTTTCCTCTGATGGATGGTGG + Intronic
963648056 3:147942659-147942681 TTGTTTTGTTTGAGGGAGGATGG + Intergenic
963820154 3:149882264-149882286 CTGTGTGCTTTCGTGGAGGGTGG + Intronic
964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG + Intronic
964970332 3:162552449-162552471 CTGTGTTCTTTGATGGAGAGAGG - Intergenic
968132462 3:196199472-196199494 CTGGTTCCTTTGGTGGAGAATGG - Intronic
970565012 4:17323468-17323490 CATTTTGCTGTGATGGAGCAGGG - Intergenic
970584757 4:17504404-17504426 TTCTTTGCGTTGCTGGAGGATGG - Exonic
971214535 4:24650961-24650983 CTGGATACTTTGATGGGGGAAGG + Intergenic
973862522 4:55079366-55079388 GTGTTTGCTCTGGTGGAGGTGGG - Exonic
974382598 4:61160635-61160657 CTATTTCCATTGATGGAGGAGGG + Intergenic
974835684 4:67247482-67247504 CTGTGTCCTTTCATGGTGGAAGG - Intergenic
975640506 4:76495416-76495438 TTGTCTGCTTTGATGCAAGAAGG - Intronic
975985442 4:80197770-80197792 CTATTTGCATTGATGTGGGAGGG + Intronic
976303077 4:83534025-83534047 ATCTTTGCAGTGATGGAGGAGGG - Intergenic
977359831 4:95988070-95988092 GTGTATGCATTTATGGAGGATGG + Intergenic
979421089 4:120506198-120506220 CTGTCTTCTTTGTTGGAGGAGGG - Intergenic
979619579 4:122783743-122783765 CCGTTTGCTAGGATAGAGGAAGG - Intergenic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
979984740 4:127299820-127299842 CTTTTTGGTTTGATCTAGGAAGG - Intergenic
981384610 4:144114600-144114622 CTTTCTGATTTGAGGGAGGAGGG - Intronic
981945204 4:150334612-150334634 CTATTTTCTCTGATGGAGGAAGG + Intronic
983263789 4:165486266-165486288 CAGATTGCTTTTATGGAGGCAGG - Intronic
983860390 4:172698658-172698680 TTGTGTGCTTTGATGGAGATGGG + Intronic
986189485 5:5481403-5481425 CTCTTTGCGTTTATAGAGGAGGG + Intronic
986382765 5:7203341-7203363 CCCTTTGCTATCATGGAGGATGG - Intergenic
986454228 5:7899552-7899574 CTGTGTGCTTTGAGAGTGGAGGG + Intronic
986771654 5:10979271-10979293 CTGTTTGCCTTTATGGAGGCAGG + Intronic
987648690 5:20711262-20711284 TTGTTGGCTTTGATGCAGGATGG - Intergenic
988686625 5:33531351-33531373 TTTTCTGCTTTCATGGAGGAAGG - Intronic
988747641 5:34157665-34157687 TTGTTGGCTTTGATGCAGGATGG + Intergenic
990267913 5:54098414-54098436 TTGTGTGCTTTGACGGAGGATGG - Intronic
990552416 5:56897008-56897030 CTGATTCCTTTGATAGAGAATGG + Intergenic
990995754 5:61730687-61730709 GTGTTTGCTTTTATCGAAGAGGG + Intronic
991291610 5:65038230-65038252 CTGTTTCCATTACTGGAGGAAGG + Intergenic
991347536 5:65685686-65685708 CTGTTTGCTTTGCTATAGAAAGG + Intronic
991491516 5:67188236-67188258 CTGTGTGATTCCATGGAGGAAGG - Intronic
991599902 5:68341872-68341894 CTGTGTCCTTTGAAGGATGAGGG + Intergenic
991932484 5:71767087-71767109 CTGTTAGCTTTCAAGGAGTATGG + Intergenic
992128883 5:73671206-73671228 CTTTTTACTTTGATGAGGGAGGG - Intronic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
992755477 5:79901659-79901681 CTATTTTCATTGATGGAGTAAGG + Intergenic
992940909 5:81760159-81760181 TTGTTTGATTTGATGGATGTTGG - Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993632065 5:90298549-90298571 CACTTTGGTTTGATGTAGGATGG + Intergenic
994327179 5:98462062-98462084 CTGGTTGCTTTGATGGGGTAAGG + Intergenic
994707413 5:103223345-103223367 CTGTGAGCTTTAATTGAGGAAGG + Intergenic
995209796 5:109524684-109524706 CTGTTTTCTCTGCAGGAGGATGG - Intergenic
995311890 5:110722555-110722577 CTGTGTGCTCTCATGGAGGCTGG + Intronic
995604987 5:113844545-113844567 GAGTTTACTTTGGTGGAGGAAGG + Intergenic
997634923 5:135398373-135398395 TTGTTTGCTTTGTGGTAGGAAGG - Intronic
999209214 5:149873183-149873205 TTATTTACTTTTATGGAGGAAGG + Intronic
1001515117 5:172350232-172350254 CTGTTTTCTTATCTGGAGGATGG + Intronic
1001897371 5:175393149-175393171 ATGTGTGCTGTGATGGAGGTGGG - Intergenic
1001975194 5:175993135-175993157 CTGTTGGAATTGTTGGAGGATGG - Intronic
1002059449 5:176617807-176617829 CTCTGTCCTTAGATGGAGGAGGG - Intergenic
1002242237 5:177850635-177850657 CTGTTGGAATTGTTGGAGGATGG + Intergenic
1002556139 5:180042423-180042445 CCGTTTAATTTGATTGAGGAAGG - Intronic
1003127564 6:3367788-3367810 CTGGGTGCATTGATGGAGGCTGG - Intronic
1003669520 6:8143512-8143534 CTATTTGCTTTTATGTAGGAAGG - Intergenic
1004150626 6:13116521-13116543 GTGTTTACTTTTAGGGAGGATGG + Intronic
1004291006 6:14367288-14367310 TTGTTTTCTTTGAGGGAAGAGGG - Intergenic
1004919881 6:20366623-20366645 CTGTTTGCTCTGATGGAGTGTGG - Intergenic
1005545141 6:26860021-26860043 TTGTTGGCTTTGATGCAGGATGG + Intergenic
1006906610 6:37537313-37537335 CTGTCTGCTTTGGTGGGTGAAGG + Intergenic
1007566310 6:42853494-42853516 CTGCTTGCTGTGAAGAAGGAGGG - Intronic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1008485581 6:52031369-52031391 CTGTTTGCCTTATTGGAGCATGG - Intronic
1008630203 6:53357286-53357308 TTGTGTACTTTGATGAAGGAAGG + Intergenic
1008652706 6:53579345-53579367 CTGTTCGCTTTGCTTGAGGCTGG + Intronic
1008850941 6:56020781-56020803 TTGTATGCTTTGATGAAGCAGGG + Intergenic
1009015932 6:57901643-57901665 TTGTTGGCTTTGATGCAGGATGG + Intergenic
1009321669 6:62298150-62298172 CTGATTGTTTTGAAGGAGAAAGG + Intergenic
1010401827 6:75454886-75454908 ATGTTTGTTTTGAGGGAGCAGGG + Intronic
1010931477 6:81809043-81809065 ATGTCTGCTTTAATGGGGGAAGG + Intergenic
1011837395 6:91450322-91450344 CTGTTTGCTTGAATGAAGAATGG - Intergenic
1012432178 6:99175450-99175472 CTGTCATCATTGATGGAGGATGG + Intergenic
1016472333 6:144387894-144387916 CTGTCTGCTTTGGTGGAGGATGG - Intronic
1019016157 6:168881208-168881230 GTGTTTGCTCTCAGGGAGGAAGG - Intergenic
1022477526 7:30721455-30721477 TTGCTGGCTTTGATGCAGGAAGG + Intronic
1023336771 7:39178808-39178830 TTGTTGGCTCTGATGGAAGAAGG + Intronic
1024628886 7:51231408-51231430 CTGCTTGGTTTGGTAGAGGATGG - Intronic
1024964337 7:55008654-55008676 GTGTTTGCTTTCATGGAAGATGG - Intergenic
1025009191 7:55382222-55382244 TTGTTTTATTTCATGGAGGAGGG - Intronic
1028539999 7:91932415-91932437 CTGGTTTCTTGGATGAAGGATGG + Intergenic
1029178630 7:98683470-98683492 CTGTGTCCTTACATGGAGGAGGG - Intergenic
1031358187 7:120814538-120814560 CTGGTTGTTTTCATGGAGGGAGG - Intronic
1031550923 7:123110475-123110497 CTGTGAGCTTTGATTCAGGAAGG - Intergenic
1032155443 7:129463885-129463907 CTGTTTGCTTTTCTGGATGCTGG + Intronic
1033680750 7:143594015-143594037 ATATTTGCTTTTATGGAGTAGGG - Intergenic
1033704142 7:143867796-143867818 ATATTTGCTTTTATGGAGTAGGG + Intronic
1034313961 7:150112641-150112663 TTTTTTCCCTTGATGGAGGAGGG - Intergenic
1034400521 7:150858664-150858686 CTGTTGGATGTGGTGGAGGATGG + Intronic
1034686804 7:152979078-152979100 CTGTCTGCTTACCTGGAGGAAGG + Intergenic
1035360034 7:158305686-158305708 CTCATTGCTTTTATGAAGGAGGG - Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1037093631 8:14954583-14954605 CTACTGGCTTTGATGGAGCAAGG + Intronic
1037602755 8:20411882-20411904 CTATTTGAATTTATGGAGGAAGG + Intergenic
1037642423 8:20758753-20758775 CTGTATGCTTACATGGTGGAAGG + Intergenic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1038276749 8:26127661-26127683 TTTTTTCCTTTGGTGGAGGAAGG + Intergenic
1038494974 8:27994950-27994972 GTGATTGCCTTGATAGAGGAGGG + Intergenic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1041113758 8:54513377-54513399 CTGTTGGCTTTGAAGAAGAAAGG + Intergenic
1042248056 8:66727688-66727710 CTGTGTCCTTGAATGGAGGAAGG - Intronic
1043103328 8:76075174-76075196 CTGCTAGCTTTGAAGGAGGAGGG + Intergenic
1043474546 8:80593453-80593475 CTGTTTGTTTAGGTGGATGATGG + Intergenic
1046247521 8:111584143-111584165 CTGTTTGCTTTTATGGGAAAGGG + Intergenic
1046568257 8:115929228-115929250 TTGCTTGCTGTGATGGAAGAAGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048503062 8:134996306-134996328 CTGTTTGCTTTGCTTGGGGCTGG - Intergenic
1048573722 8:135675220-135675242 CTGTTATCTTGGATGGAGCAAGG + Intergenic
1049026042 8:139989598-139989620 CTGTTTGCTTCCAGGGAGAAAGG - Intronic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1051679360 9:19591600-19591622 CTGTATTCTTGGAAGGAGGAAGG - Intronic
1052133822 9:24886218-24886240 TTGTTTTCTTTGATGGAGCAGGG - Intergenic
1052346959 9:27419516-27419538 CTGTTTGCTTTGTTGAAGATCGG - Intronic
1053585884 9:39458311-39458333 CTCGTTGCTTTTATGGAAGAAGG - Intergenic
1053595281 9:39554633-39554655 ATGTTTGCTTGGAGGGAGGCAGG - Intergenic
1053654045 9:40197552-40197574 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053853241 9:42311256-42311278 ATGTTTGCTTGGAGGGAGGCAGG - Intergenic
1053904433 9:42826729-42826751 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054366160 9:64343768-64343790 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054530552 9:66178785-66178807 GTGTTTGGGTAGATGGAGGAGGG - Intergenic
1054570979 9:66810343-66810365 ATGTTTGCTTGGAGGGAGGCAGG + Intergenic
1054580422 9:66906911-66906933 CTCATTGCTTTTATGGAAGAAGG + Intronic
1054673789 9:67833498-67833520 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054820320 9:69515540-69515562 CTGTTTCGTTTTAGGGAGGAAGG - Intronic
1054838643 9:69709430-69709452 TTATTTGCTTTGATGGTGGTAGG - Intergenic
1054855151 9:69891413-69891435 TTGTTTGCTTTAGTGGAGGAAGG - Intronic
1054877817 9:70114832-70114854 CTTTCTTTTTTGATGGAGGAAGG - Intronic
1054980149 9:71196824-71196846 CTGTTTGCTCTAAAGCAGGATGG + Intronic
1055781605 9:79827406-79827428 ATTTTTATTTTGATGGAGGAAGG + Intergenic
1056898500 9:90575330-90575352 CTGTTTTCTTTTATTGAGAATGG - Intergenic
1057366534 9:94427276-94427298 CTGTTTCCTTTTTTGGGGGAGGG + Intronic
1057379594 9:94555783-94555805 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1057656801 9:96960788-96960810 CTGTTTCCTTTTTTGGGGGAGGG - Intronic
1057796968 9:98164769-98164791 CTTTTTGCTTTGAAGGAGGGAGG - Intronic
1058830968 9:108816061-108816083 CTGTTTGTTTTGCTGCAGAATGG + Intergenic
1058974134 9:110110354-110110376 TTCTTAGCTTTGATGGGGGAAGG + Intronic
1059343574 9:113613221-113613243 CTGTTTCCTTTGATACAGTAGGG + Intergenic
1186295738 X:8145677-8145699 CTGCTTACTTTGATAGAGGAAGG - Intergenic
1187282265 X:17866801-17866823 CTGCTGCCTCTGATGGAGGAGGG + Intergenic
1187536217 X:20143745-20143767 TTGTTTGCTTGTATGGGGGAGGG - Intergenic
1187565260 X:20443323-20443345 CCATTTGCTGAGATGGAGGAGGG + Intergenic
1187956387 X:24523169-24523191 CTGTTTCCTTCCATGGGGGAAGG + Intronic
1188691236 X:33131579-33131601 CTGATTGATTTGAAGGAGCATGG - Intronic
1189774069 X:44454598-44454620 TTATTTGTTTTGGTGGAGGAAGG - Intergenic
1190705729 X:53026583-53026605 CAGTTTGCCTTCATGTAGGAAGG + Intergenic
1195777883 X:108427698-108427720 CTCTTTGCTTTCAGAGAGGATGG + Intronic
1196942154 X:120787720-120787742 ATGTTTACTTTTCTGGAGGAGGG + Intergenic
1197424374 X:126277131-126277153 CTGTGTTCATTGATGGATGAAGG + Intergenic
1199283104 X:146024960-146024982 ATATTTGCTTTGATGAAGAAAGG - Intergenic