ID: 964623004

View in Genome Browser
Species Human (GRCh38)
Location 3:158734019-158734041
Sequence TTGCCTAGAAGGTGTGCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964623004_964623014 8 Left 964623004 3:158734019-158734041 CCTGGAGCACACCTTCTAGGCAA 0: 1
1: 0
2: 0
3: 12
4: 91
Right 964623014 3:158734050-158734072 CGGACACTCAGTGAGGCCAAGGG 0: 1
1: 0
2: 1
3: 25
4: 269
964623004_964623013 7 Left 964623004 3:158734019-158734041 CCTGGAGCACACCTTCTAGGCAA 0: 1
1: 0
2: 0
3: 12
4: 91
Right 964623013 3:158734049-158734071 CCGGACACTCAGTGAGGCCAAGG 0: 1
1: 0
2: 1
3: 34
4: 871
964623004_964623010 1 Left 964623004 3:158734019-158734041 CCTGGAGCACACCTTCTAGGCAA 0: 1
1: 0
2: 0
3: 12
4: 91
Right 964623010 3:158734043-158734065 TGGGGCCCGGACACTCAGTGAGG 0: 1
1: 0
2: 2
3: 12
4: 132
964623004_964623016 25 Left 964623004 3:158734019-158734041 CCTGGAGCACACCTTCTAGGCAA 0: 1
1: 0
2: 0
3: 12
4: 91
Right 964623016 3:158734067-158734089 CAAGGGAATGTGTGCTATATTGG 0: 1
1: 0
2: 0
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964623004 Original CRISPR TTGCCTAGAAGGTGTGCTCC AGG (reversed) Intronic
900652000 1:3734362-3734384 CTGCCCTGAAGCTGTGCTCCGGG - Exonic
901164475 1:7208076-7208098 TTGCCTGGAGGGTGTGCTGTTGG - Intronic
901954586 1:12775133-12775155 TTGCCCAGAAGGTTCGCCCCAGG + Exonic
904261616 1:29290945-29290967 TGGCCTAGAGGGTGGTCTCCAGG - Intronic
904292823 1:29498627-29498649 TGGCCTAGAGGGCGTTCTCCAGG + Intergenic
907276374 1:53319163-53319185 GTGCCTCACAGGTGTGCTCCTGG - Intronic
917665782 1:177223954-177223976 TTGCCTTGACGATGTGCTCCTGG - Intronic
922139021 1:222862877-222862899 TTACCTGGAATGTGTGATCCTGG - Intergenic
923272102 1:232365303-232365325 TTGCCTAGAACCTGTGAGCCTGG + Intergenic
1063944834 10:11165949-11165971 CTGCCTAGAAAGTGACCTCCCGG - Intronic
1069055051 10:63836165-63836187 TTCCCTAGAAGATTTGCTCCTGG - Intergenic
1073419502 10:103413044-103413066 ATGCCTGGAAGGTCTGCTCTAGG + Intronic
1080641162 11:34159226-34159248 CTGCCCACAAGGTGGGCTCCTGG + Intronic
1083014269 11:59436645-59436667 GTGCATAGAAGGTGTGCTTTGGG - Intergenic
1085273595 11:75284265-75284287 TTCCCCAGATGGTGTGGTCCTGG - Exonic
1086914107 11:92508168-92508190 TTACCTAGAATGTGTTTTCCAGG + Intronic
1087261959 11:96021888-96021910 TTGCCTTGAAGCTGGGCTCCAGG + Intronic
1089048556 11:115525968-115525990 GTGGGGAGAAGGTGTGCTCCAGG - Intergenic
1089368745 11:117938320-117938342 TTGCCTCGAAGAAGTGCTACAGG - Intergenic
1092088075 12:5781488-5781510 TTGCCTAAAAGATTTACTCCAGG - Intronic
1099113175 12:78587439-78587461 GTGCATAGAAGGTCTGCTACTGG + Intergenic
1108731990 13:53244998-53245020 CCGCCTAGAATGTGAGCTCCAGG + Intergenic
1109701815 13:66035635-66035657 TTCCATAGAATATGTGCTCCTGG + Intergenic
1110235552 13:73214250-73214272 TTGCCTAGAACATGAGTTCCTGG - Intergenic
1112304522 13:98261532-98261554 TTGCCTAGAAAGTTTGCTTTGGG + Intronic
1116587207 14:46722387-46722409 TTGATTTGAAGGTGTGCGCCCGG + Intergenic
1124573431 15:30886154-30886176 TTGCCTAGCTGCTGTCCTCCAGG - Intergenic
1126951211 15:53884010-53884032 TTGCCTTGATGCTGTGATCCTGG + Intergenic
1127938322 15:63666012-63666034 CTGCCTAGAACGGCTGCTCCAGG + Exonic
1135097200 16:19574376-19574398 TTGTCTTGAAGGTGTGATCATGG + Intronic
1137012344 16:35335432-35335454 TGGCATAGAAGGTCTGCACCTGG + Intergenic
1137016709 16:35384299-35384321 TGGCATAGAAGGTCTGCTCCTGG + Intergenic
1137687780 16:50398783-50398805 TTGGCTGGAGGGTCTGCTCCAGG + Intergenic
1140724577 16:77800528-77800550 TTGCCTAGAAGGTGTTGCACAGG + Intronic
1140946832 16:79776556-79776578 ATACCTAGAAAGTGTGCTCTTGG - Intergenic
1141092416 16:81139372-81139394 CTGCCCAGAGGGGGTGCTCCAGG + Intergenic
1141743274 16:85908692-85908714 TTGGCTAAAAGGTGCACTCCAGG + Intronic
1142425425 16:89999942-89999964 TAGCCGAGCAGCTGTGCTCCGGG + Intergenic
1144047985 17:11470563-11470585 TTGCCTGGAAGGCTTGGTCCTGG - Intronic
1144194424 17:12876504-12876526 GTGCCTAGCAGGTGTTCTGCTGG - Intronic
1147896942 17:43757337-43757359 TTGCCTAGAAGGGGAGCTGTGGG + Intronic
1148785991 17:50146462-50146484 GTGCCCACAAGGTCTGCTCCTGG - Intronic
1149581220 17:57751745-57751767 TTGCCCAGAAAATGTGCTGCAGG - Intergenic
1152201803 17:78951773-78951795 CTGCCTAGAAGTTTTGCTGCAGG - Intergenic
1152758186 17:82095861-82095883 TTGCATACCAGATGTGCTCCGGG - Intronic
1153429388 18:4999379-4999401 TTGCCTAGAAATTGCACTCCTGG - Intergenic
1160579791 18:79877030-79877052 TTGCCTAGAATGTGCTCGCCTGG - Intronic
1163128487 19:15257426-15257448 TTGCCTGGGCGGTGTCCTCCAGG - Intronic
1163302060 19:16454058-16454080 ATGGCTACAAGGTCTGCTCCTGG + Intronic
928324559 2:30309275-30309297 TGGCCCAGAAGGTGTCCTCGGGG + Intronic
930091118 2:47532173-47532195 GTTACTAGAATGTGTGCTCCAGG - Intronic
930873272 2:56187732-56187754 TTGCTTAGAATGTGTGGTCCTGG + Intronic
935228910 2:101079056-101079078 TGGCCAAGAAGGAGAGCTCCAGG + Intronic
937448737 2:121982390-121982412 CTTCCAAGAAGATGTGCTCCAGG + Intergenic
942145063 2:173018743-173018765 TTGCCGACAAGCTGGGCTCCGGG + Exonic
948510249 2:238459109-238459131 TGGCAAGGAAGGTGTGCTCCTGG + Intergenic
948578318 2:238968093-238968115 TTGCCTTGAAAGTCTGCTCCAGG - Intergenic
1172127908 20:32636130-32636152 TTGCCTGGATGGTGAGCTGCTGG + Intergenic
1173030690 20:39356896-39356918 TTGCCTAGTATGTGTAATCCAGG + Intergenic
1179681086 21:43021894-43021916 TTGCCCAGCACGTGTGCACCCGG + Intronic
951501672 3:23394732-23394754 TTGCTAAGAAGGAGTGGTCCAGG + Intronic
954139339 3:48596792-48596814 ATCCCTGCAAGGTGTGCTCCAGG + Intergenic
956612723 3:71140966-71140988 TTGCCAAGAAACTGTGATCCAGG + Intronic
959375243 3:105581544-105581566 TTGGCTAGGAGCTCTGCTCCAGG - Intergenic
960623742 3:119660547-119660569 TTTCCTAGAAGGAATGCTTCCGG + Exonic
961398454 3:126615818-126615840 TTGCCTGGAAGAAGTGCTCCAGG - Intronic
964370049 3:155990938-155990960 TTGCCTAAAAAGTGTGTTTCTGG + Intergenic
964623004 3:158734019-158734041 TTGCCTAGAAGGTGTGCTCCAGG - Intronic
966911752 3:184563749-184563771 TTGCCTTGAGGGTGTGAGCCAGG + Intronic
967728613 3:192885434-192885456 TTGCCTAGAGGGTGTGATAAAGG - Intronic
968356506 3:198111700-198111722 TGGCATAGAAGGTCTGCACCTGG - Intergenic
969046121 4:4338062-4338084 TTGACTTGAGGCTGTGCTCCCGG - Intergenic
972688588 4:41374346-41374368 TTGTATAGAAAGAGTGCTCCAGG + Intronic
975971439 4:80042955-80042977 TTGCCTAGACGGATTCCTCCTGG - Intronic
976657829 4:87508001-87508023 GTTCCTAGAGGGTGTGTTCCGGG - Intronic
983593112 4:169436643-169436665 TTGCCTAGAAGGAATCATCCTGG - Intronic
986146695 5:5084481-5084503 AAGCCTGGAAGGTGAGCTCCTGG + Intergenic
989184764 5:38612814-38612836 TTGCCCACAAGGTGTTCTGCTGG - Intergenic
990754439 5:59052746-59052768 TTCCCTAGAAGGTGGCCTCCAGG + Intronic
993623930 5:90201098-90201120 TGGACTAAAAGGTGTCCTCCCGG + Intergenic
994276257 5:97842094-97842116 TGGCCTAGAAGGCGTTCTGCAGG - Intergenic
1000283472 5:159803757-159803779 TTGCCTCCAAGGTGTCTTCCAGG + Intergenic
1002113009 5:176933150-176933172 TTGCCTCGAAGGTGCTTTCCAGG - Intronic
1013975210 6:116069606-116069628 TTTCCTAGAAGGTCTTATCCAGG + Intergenic
1014726968 6:124982943-124982965 TTGGCTAGCAGGTTTGCTGCTGG + Intronic
1014965118 6:127738666-127738688 CTGGCTAGATGGTGTGCTCTTGG + Intronic
1021539035 7:21736511-21736533 TTGCCTTGAATGTGGGCTCCTGG + Intronic
1028274672 7:88839978-88840000 TTGCAAAGAAGCTGTTCTCCAGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031412891 7:121461380-121461402 CAGGCTAGAAGGTGGGCTCCAGG - Intergenic
1033236168 7:139639488-139639510 TTGGCTAGACGGTGAACTCCTGG - Intronic
1035645210 8:1213848-1213870 TTGCCTAGAAGATGAGCACATGG + Intergenic
1037401290 8:18497535-18497557 TTCCCTAGGAGGTGTGATCCCGG - Intergenic
1038193868 8:25348501-25348523 CTCCCTAGAAGGTGGGCTCCTGG - Intronic
1042673144 8:71286285-71286307 TTACCACGAGGGTGTGCTCCTGG - Intronic
1052002512 9:23303102-23303124 TTGACTAGAGTGTGTACTCCTGG - Intergenic
1054810786 9:69432440-69432462 TTTCCTGGAAGGTCTGCTCAGGG + Intronic
1055372078 9:75611033-75611055 TACCCTAGAATTTGTGCTCCTGG + Intergenic
1058474445 9:105317568-105317590 TTCACTAGAAGATGGGCTCCTGG - Intronic
1058508698 9:105693126-105693148 TTTGCTAGAAAGTGTGCTACAGG + Intergenic
1059146791 9:111906901-111906923 TTGCCTAGAGGATGAGCTCCAGG + Intronic
1185602874 X:1352226-1352248 TTGCCAAGTAGGTGTGCCCGTGG + Exonic
1194083552 X:89498629-89498651 TTCCCTAAAGGGTGAGCTCCAGG - Intergenic
1194739684 X:97557798-97557820 TTGCCTAGTAGGTGTCCTTAAGG + Intronic