ID: 964623091

View in Genome Browser
Species Human (GRCh38)
Location 3:158734490-158734512
Sequence CTGATGGCATTGTTGAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964623078_964623091 24 Left 964623078 3:158734443-158734465 CCCATTTCAAGAGTGGCAGAGCA 0: 1
1: 0
2: 1
3: 11
4: 150
Right 964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG 0: 1
1: 0
2: 0
3: 11
4: 133
964623079_964623091 23 Left 964623079 3:158734444-158734466 CCATTTCAAGAGTGGCAGAGCAG 0: 1
1: 0
2: 1
3: 17
4: 192
Right 964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG 0: 1
1: 0
2: 0
3: 11
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964623091 Original CRISPR CTGATGGCATTGTTGAACAC AGG Intronic
905560006 1:38918977-38918999 CTGATGGAGATGATGAACACGGG + Exonic
906776924 1:48538186-48538208 CTCATAGCATTGTGGAACATAGG + Intronic
907802461 1:57783633-57783655 CTGATAGAATTGCTCAACACAGG - Intronic
910958305 1:92732027-92732049 GAGATGGCACAGTTGAACACTGG + Intronic
911224527 1:95290728-95290750 CTGATTGCAGTGTTGAAAATGGG - Intergenic
917326792 1:173841510-173841532 CTGATAGCATTGTTTAAAAGGGG - Intronic
917563937 1:176191834-176191856 CTTAAGGCAATGTTAAACACAGG - Intronic
919348051 1:196411484-196411506 CTGATGGAAATAGTGAACACAGG + Intronic
919374182 1:196771435-196771457 CTGATGTCCCTGTTGAACAGAGG - Intergenic
919375458 1:196788018-196788040 CTGAAGGAAATGTTGAACACAGG - Intronic
1062909704 10:1204779-1204801 CTCCTGGCATTGCTGAGCACGGG + Intronic
1063314059 10:4984457-4984479 GTGCTGGCTTTCTTGAACACTGG + Intronic
1067957569 10:50809168-50809190 CTGAAGGCATTGTTGATCCACGG + Intronic
1069768540 10:70882444-70882466 CAGATGGTATTGTTGCACACCGG + Intronic
1076614624 10:131747407-131747429 CTGGGGACAGTGTTGAACACTGG - Intergenic
1080175823 11:29361747-29361769 CAGCTGGCATTGTTGAAAGCAGG + Intergenic
1083551228 11:63591551-63591573 CGGATGTCATTGTTGAAGACTGG - Intronic
1084116516 11:67045827-67045849 ATCATGGCTTCGTTGAACACCGG - Exonic
1089714715 11:120347506-120347528 CAAATGGCATGGGTGAACACAGG - Intronic
1090870231 11:130738015-130738037 CTGATGGAATTTTTGCACACTGG + Intergenic
1091855197 12:3733642-3733664 TTGATGACATCGTTGACCACTGG + Intronic
1093894960 12:24564151-24564173 CTGATGGTGTTGTTGCACTCTGG - Intergenic
1094318481 12:29158577-29158599 CTGAATGCATTGCTGATCACAGG + Intronic
1094672427 12:32583565-32583587 CTGGTGGGATTGTTGAGAACTGG + Intronic
1095222857 12:39638367-39638389 CTGCTGGCACTGGTGAATACTGG - Intronic
1095792098 12:46178597-46178619 ATGATGTCCTTGTTGAACACCGG - Intergenic
1096550696 12:52369944-52369966 CTGATGGCAGTGCTGAGCCCAGG + Intergenic
1097367106 12:58728866-58728888 AAGATGGCATTGGTGAATACAGG - Intronic
1103125127 12:118415371-118415393 CTGATGCCATTATTGCACATTGG + Exonic
1104411470 12:128561824-128561846 CTGATGGCATTGCAGAGCAGAGG - Intronic
1108339386 13:49482770-49482792 CTTATGGTATTGATGAAAACGGG + Exonic
1110017919 13:70432414-70432436 GTGATGTCAGTGTTGAAAACAGG + Intergenic
1111605791 13:90537506-90537528 CTGATGGCATTGATATATACTGG - Intergenic
1111723772 13:91978773-91978795 CTGATGGCTTTGTGGAAAATGGG + Intronic
1112265532 13:97920071-97920093 CTGCTGGCCTTGGTGTACACAGG + Intergenic
1112710277 13:102119956-102119978 GTGAGGGCAATGTTCAACACTGG - Intronic
1117960448 14:61156628-61156650 TTCATGGGATTGTTCAACACTGG + Intergenic
1122838042 14:104440880-104440902 CTGATTGACTTGTTCAACACAGG + Intergenic
1126428259 15:48552569-48552591 CTGATGACATTTTTGAGCAGTGG + Intronic
1126527847 15:49677506-49677528 GAGATGGCATTGTTGTACAAAGG + Intergenic
1128046529 15:64622878-64622900 GAGATGTCATTGTTGACCACTGG - Exonic
1130108780 15:80948545-80948567 GTGATGGCTTTGTTGTAGACAGG - Intronic
1130854216 15:87826643-87826665 CTGATGGCACAGTTGAGCATGGG + Intergenic
1135267528 16:21040279-21040301 CTGATGTCCATGTTGAACACTGG - Intronic
1142828071 17:2526834-2526856 GTGATGGAATTGCTGAACAGTGG - Intergenic
1145131080 17:20349948-20349970 CTGATGGCAATGTTGGTCAAGGG - Intergenic
1148801747 17:50231560-50231582 CTGATCGCATTGAAGATCACTGG - Intergenic
1148904424 17:50902985-50903007 CTGATGGCAAGGTGGAACAATGG + Intergenic
1150430506 17:65111980-65112002 CTGATTGAATCTTTGAACACTGG + Intergenic
1150440951 17:65191036-65191058 CAGATGGCATTTTTGCAAACTGG - Intronic
1150835249 17:68557959-68557981 TTGATGGCATTGTTGAATTTAGG + Intronic
1154506884 18:15049788-15049810 CTGATGCCTCTGTTGAGCACTGG - Intergenic
1155325069 18:24656942-24656964 CAGATGGCACTGTGGACCACAGG - Intergenic
1155893736 18:31297374-31297396 GTGATGGCTTTCTTGAACATTGG - Intergenic
1155956962 18:31962439-31962461 CTGATACCATTGTTGGACATTGG + Intergenic
1156663775 18:39380852-39380874 ATCATGGCATTGTTTATCACGGG - Intergenic
1162357224 19:10193895-10193917 CTGATGGCGTTCATGAACAAGGG + Intronic
1164871227 19:31645484-31645506 CTGGTCCCATTGTTGAAAACAGG - Intergenic
1165479928 19:36056726-36056748 CTGATGGTATGGTTGGACCCAGG + Intronic
1165654770 19:37523662-37523684 CTGAGGGAATTGTTGAACAGAGG + Intronic
1165915327 19:39255118-39255140 CGGATGGTCTTGGTGAACACCGG + Intergenic
925270434 2:2602751-2602773 CTGATGGCTTTGATGTAAACAGG - Intergenic
925872945 2:8286340-8286362 CTGATGGGATTCTTGAGAACAGG - Intergenic
928170260 2:28998841-28998863 CTGATGACTTTGTTGGACCCTGG + Intronic
929030511 2:37646265-37646287 GAGATGGCATTTTTGAGCACCGG + Exonic
929556258 2:42927405-42927427 CTGGGCTCATTGTTGAACACTGG - Intergenic
932370996 2:71187756-71187778 CTGATGGTGGTGGTGAACACAGG + Exonic
936382985 2:112004086-112004108 CAGAAGGCAATGTGGAACACTGG + Intronic
937980620 2:127612516-127612538 CTGATGGCCTTGGTGCAGACCGG + Exonic
938557649 2:132440209-132440231 CTGATAGAAATGTTGAACAAAGG + Intronic
940072226 2:149701594-149701616 CTGTTAGCAGTGTTGAAAACAGG + Intergenic
941834656 2:170003453-170003475 CTGAAGGAATAGTTGAATACAGG - Intronic
942525175 2:176845443-176845465 CTGATTGCCTTGTTAGACACTGG - Intergenic
943053652 2:182947408-182947430 CTGGTGGCCTTGTGGAACAAGGG - Intronic
943966958 2:194348485-194348507 CTGCTGGCATTATTTAACATTGG - Intergenic
944532103 2:200677362-200677384 CTGATGGCTTGGATGAATACAGG - Intergenic
946059100 2:216926546-216926568 GTCCTGGCATTTTTGAACACGGG + Intergenic
1172887803 20:38243035-38243057 ATGGTGTCACTGTTGAACACTGG - Intronic
1172908287 20:38385989-38386011 CTGATGGCACTGTTTAATCCAGG + Intergenic
1173236253 20:41248413-41248435 ATGTTTGCATTGCTGAACACAGG + Intronic
1176790988 21:13319312-13319334 CTGATGCCACTATTGAGCACTGG + Intergenic
1177911156 21:27034010-27034032 CTGATTGCATTGTTAACCAAAGG - Intergenic
1182403036 22:30097797-30097819 CTGATGGCAATATGGAAGACAGG + Intronic
952712716 3:36447580-36447602 CTTATGGCTTTGTTGAGCAATGG - Intronic
953479456 3:43237836-43237858 ATGATGTCAATGTTGAACACTGG + Intergenic
955740516 3:62086302-62086324 CTGATGGCAGTGTGAAACAAGGG + Intronic
956683379 3:71802673-71802695 CTGATGGCATCGTGGAGCATGGG - Intergenic
962790085 3:138803454-138803476 ATGATAGCATTACTGAACACAGG + Intronic
964164948 3:153692056-153692078 CTGATGTTATTGTTGAGAACTGG - Intergenic
964623091 3:158734490-158734512 CTGATGGCATTGTTGAACACAGG + Intronic
975742628 4:77444284-77444306 CTGATGGTATTGGTTAGCACTGG + Intergenic
976469129 4:85406942-85406964 CTGATGGAATTGTTACAAACTGG - Intergenic
981397910 4:144275714-144275736 CTGTTGGCGATGTTGTACACAGG + Intergenic
983996723 4:174191022-174191044 CTGATGGCATTGCTGATTAGAGG - Intergenic
986419337 5:7562683-7562705 CAGACGACATTGATGAACACAGG + Intronic
986716286 5:10526264-10526286 CTGATGGCATTGTCCAGCAACGG + Intergenic
986909122 5:12532625-12532647 CTGCTGGCATATGTGAACACAGG + Intergenic
991393708 5:66179923-66179945 CTAATGTCATTCTTGAAAACAGG - Exonic
991726713 5:69542789-69542811 GTCATGGCATTGTTGATCATGGG - Intronic
991868244 5:71085085-71085107 GTCATGGCATTGTTGATCATGGG + Intergenic
994625907 5:102218648-102218670 CTGATAGAGTTGTTCAACACAGG - Intergenic
996378161 5:122837366-122837388 CTGATGGCATTACTAAATACAGG - Intergenic
1003255295 6:4470124-4470146 CAGAAGGCGTTGCTGAACACTGG + Intergenic
1008422240 6:51315211-51315233 CTGATTGTATTGTTGGGCACGGG - Intergenic
1008895369 6:56547802-56547824 GTGAAGGCATTGTTTAACCCAGG - Intronic
1010637847 6:78282896-78282918 GTGTTGGCTTTCTTGAACACTGG + Intergenic
1014531662 6:122566245-122566267 CTCATGACAGTGATGAACACTGG - Intronic
1016091056 6:139979884-139979906 CTGAGGGGAATGTTGATCACGGG - Intergenic
1018703358 6:166445493-166445515 CTCCTGGCATTGGTGAATACGGG - Intronic
1020842148 7:13231951-13231973 TTGATGGCATTTTTTGACACAGG - Intergenic
1021796448 7:24259357-24259379 CTGAGGGCATTCTTTAACCCTGG + Intergenic
1024179065 7:46870613-46870635 CTGATTGCATTGTAGAAGAAAGG + Intergenic
1024455245 7:49598652-49598674 CTGAAGGAAATGTTGAAAACTGG - Intergenic
1026947517 7:74325890-74325912 CTGATGGGACTGATGAGCACAGG + Intronic
1027759553 7:82260755-82260777 TTGATGTCATTGTTAAAAACAGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030428517 7:109411632-109411654 CTGATGGCATTGTTTTACTCAGG + Intergenic
1030521495 7:110603543-110603565 TTTCTGGCATAGTTGAACACAGG - Intergenic
1034935640 7:155198762-155198784 CTGGTGGCTGTGGTGAACACTGG - Intergenic
1037218565 8:16488205-16488227 CTGATAGAATTGCTCAACACAGG + Intronic
1039692060 8:39874579-39874601 CTCATGGCAATGGTGATCACCGG - Intergenic
1041461625 8:58118056-58118078 CTAATGACATTTGTGAACACAGG - Intronic
1042947716 8:74171566-74171588 ATGGTGTCACTGTTGAACACTGG - Intergenic
1043549467 8:81353650-81353672 TTGCTGGCATTGATCAACACAGG + Intergenic
1044072415 8:87778584-87778606 CTGATGGCATGCTTGGGCACTGG - Intergenic
1045599362 8:103694825-103694847 CTGAGGGCATTGTAGAAGTCTGG + Intronic
1046817053 8:118596607-118596629 CTTTAGGCATTGTTGATCACTGG + Intronic
1048346848 8:133582400-133582422 CTGAAGGCATTCTTGAGCATTGG + Intergenic
1049843552 8:144788979-144789001 CTGCTGGGATTGCTGAACAAAGG - Intergenic
1050058508 9:1680350-1680372 CAGATAGAACTGTTGAACACAGG - Intergenic
1051016497 9:12482185-12482207 CTGATGACAATCATGAACACTGG + Intergenic
1052037007 9:23694133-23694155 CTCTTGGCTTTGTTGCACACTGG - Intronic
1056679100 9:88701682-88701704 CTGGTGGCATTGGTAAATACTGG + Intergenic
1058093403 9:100830825-100830847 TTGCTGACATTGTTGAAAACTGG + Intergenic
1058477026 9:105346245-105346267 CTGATGGTATTCTAGGACACAGG - Intronic
1059053249 9:110952245-110952267 CTGGTGGGATTGTGGACCACTGG - Intronic
1059705358 9:116817923-116817945 CTGATGTCATTGCTGACCTCTGG - Intronic
1186399798 X:9246908-9246930 CTCATGGCATTGTTGAATTATGG + Intergenic
1188448199 X:30279726-30279748 CTGATAGCCTTGCTCAACACAGG - Intergenic
1188870464 X:35365094-35365116 GTTTTGGCGTTGTTGAACACTGG - Intergenic
1191964983 X:66747938-66747960 CTGATAACCTTGATGAACACAGG - Intergenic
1196613173 X:117736854-117736876 CTGATGGCATTGCAGGACTCAGG - Intergenic
1197174684 X:123473074-123473096 CTGCTGGCATTACTGAACTCTGG - Intronic
1200159625 X:153999578-153999600 CTCCCGGCATTGTTGAACACAGG - Intergenic
1202596790 Y:26548575-26548597 CTGATGGCTTTGGAGAATACAGG + Intergenic