ID: 964623940

View in Genome Browser
Species Human (GRCh38)
Location 3:158741011-158741033
Sequence CTGTATCTTGCATGCTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964623929_964623940 22 Left 964623929 3:158740966-158740988 CCAGAATGCTGGTGGAGAAAAGG 0: 1
1: 0
2: 2
3: 18
4: 246
Right 964623940 3:158741011-158741033 CTGTATCTTGCATGCTCTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 163
964623935_964623940 -8 Left 964623935 3:158740996-158741018 CCTGGTTCCTTGGGGCTGTATCT 0: 1
1: 0
2: 1
3: 14
4: 169
Right 964623940 3:158741011-158741033 CTGTATCTTGCATGCTCTGGGGG 0: 1
1: 0
2: 0
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964623940 Original CRISPR CTGTATCTTGCATGCTCTGG GGG Intronic
900272426 1:1798221-1798243 CAGTATCTTGGCTGCACTGGTGG - Intronic
905538037 1:38739100-38739122 GTGTATGTTGCATCGTCTGGAGG + Intergenic
906051971 1:42881716-42881738 CTGTATCTTGATTGTTGTGGTGG + Intergenic
906935782 1:50212920-50212942 CTGTATCATCTAGGCTCTGGCGG + Intergenic
908428303 1:64030631-64030653 CTATATCGAGAATGCTCTGGGGG + Intronic
909311804 1:74160103-74160125 CTTTATCTTGCAAGATCTTGGGG - Intronic
913971954 1:143422929-143422951 CTGTATCATGAACGCTGTGGTGG - Intergenic
914066333 1:144248542-144248564 CTGTATCATGAACGCTGTGGTGG - Intergenic
914112820 1:144717812-144717834 CTGTATCATGAACGCTGTGGTGG + Intergenic
914248275 1:145901636-145901658 CTGTTTCTTCCATGCTTTTGCGG - Exonic
914877733 1:151524859-151524881 TTGCATCTTGCATGCTCCTGCGG - Exonic
917621677 1:176802397-176802419 CTGAAACTGGCATGCTCTAGGGG + Intronic
917647781 1:177046127-177046149 CTGTATCTCTCATGGTGTGGTGG - Intronic
919724910 1:200875361-200875383 CTTGATGTTGCAAGCTCTGGGGG + Intergenic
920590505 1:207214190-207214212 CTGTATTTTGATTGCTGTGGTGG - Intergenic
922070700 1:222190168-222190190 ATGGCTCTTGAATGCTCTGGAGG + Intergenic
922699724 1:227751626-227751648 CTGTTTCTTGCATGTCCTGGAGG - Intronic
924323602 1:242873457-242873479 CAGTATTTTGCATGCCCTGCAGG + Intergenic
924323879 1:242876118-242876140 CTGTCTCTGGGATGCTGTGGAGG - Intergenic
1064345157 10:14525885-14525907 CTGTATGTTTCATACTCTGGGGG - Intronic
1065102779 10:22347089-22347111 CTGTATCTTGACTGTGCTGGTGG - Intronic
1065108194 10:22412176-22412198 CTTTATCCTGCATGCCTTGGGGG - Intronic
1065338342 10:24678331-24678353 CTGTATCTTGACTGGTATGGTGG - Intronic
1065394322 10:25217848-25217870 CTATATTTTCCATTCTCTGGAGG + Intronic
1065603351 10:27392003-27392025 CTGCATGTTGCATGTACTGGGGG - Intergenic
1067244447 10:44525737-44525759 CTGTATCTTGGTTGTTGTGGTGG - Intergenic
1071154985 10:82677858-82677880 TTGTATGTTGCATGATTTGGTGG + Intronic
1072144582 10:92623145-92623167 CTGTATCTTGATTGCAGTGGTGG - Intronic
1072350704 10:94554395-94554417 CTGTATCTTGATTGTGCTGGTGG - Intronic
1076144792 10:128108920-128108942 CTGTATCAGGCAAGCTCTTGAGG + Exonic
1077307901 11:1876107-1876129 CTGTATCATGAACGCTGTGGTGG + Intronic
1077602218 11:3581551-3581573 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1080074848 11:28136719-28136741 CTCTCTCTTGGATGCTCTAGGGG + Intronic
1081634247 11:44710294-44710316 CTGCTTCTTGCAGGTTCTGGGGG + Intergenic
1083658726 11:64242269-64242291 CTGTATCTTCCTTGCCCCGGGGG - Intronic
1083670453 11:64297162-64297184 CTGCATCTTTTATGCGCTGGTGG + Exonic
1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1084814631 11:71639113-71639135 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1085251820 11:75148993-75149015 CTGTATATACCATGCCCTGGGGG + Intronic
1088718443 11:112571153-112571175 CTGGAGCTTGCAGGCTGTGGAGG - Intergenic
1089314381 11:117581386-117581408 CTGTATCTTGATTGCGGTGGTGG - Intronic
1089637097 11:119821966-119821988 CTGGATCTTGCATGAACTTGTGG + Intergenic
1092237730 12:6820532-6820554 CTGTGTCCTGAATGGTCTGGAGG - Exonic
1092428360 12:8390903-8390925 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1092429442 12:8397054-8397076 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1092784915 12:12018079-12018101 CTCTTACTTGCATTCTCTGGGGG - Intergenic
1096532259 12:52249407-52249429 CTGCATCTTGAATTCTGTGGAGG + Intronic
1096935762 12:55273012-55273034 ATGTATATTGAATTCTCTGGGGG + Intergenic
1097577451 12:61412815-61412837 CTCTATCTTGTGTTCTCTGGAGG + Intergenic
1097579312 12:61434180-61434202 CTCTGTGTTGCTTGCTCTGGGGG - Intergenic
1100247616 12:92778443-92778465 ATGTGTCTTTCCTGCTCTGGTGG - Intronic
1100705686 12:97197843-97197865 CTGTGCCTTGCATTTTCTGGTGG + Intergenic
1103109613 12:118264110-118264132 CTGTATCTTTCATACACTGCTGG + Intronic
1104422031 12:128644126-128644148 CTGGAACCTGCATGCGCTGGTGG + Intronic
1105060563 12:133146537-133146559 CTGTATCTTGAATGAAGTGGGGG - Intronic
1105753728 13:23445731-23445753 CTCTGACTTGCTTGCTCTGGGGG - Intergenic
1106436297 13:29725951-29725973 CAGTAACTTGCATGAGCTGGAGG - Intergenic
1107232516 13:38127449-38127471 TTGTCTCTTACATGTTCTGGTGG - Intergenic
1107266127 13:38557194-38557216 CTGTAACTTCCAATCTCTGGTGG + Intergenic
1109576331 13:64263871-64263893 CTGTATGGTGCAAGCTATGGTGG - Intergenic
1114198541 14:20501279-20501301 CTGTATCTTGATTGCAGTGGTGG - Intergenic
1114689901 14:24571583-24571605 CTATTACTGGCATGCTCTGGGGG - Intergenic
1120185611 14:81390887-81390909 TTGTATCTTGCAGCTTCTGGTGG + Intronic
1121984747 14:98493896-98493918 TTGTAGCCTGTATGCTCTGGGGG + Intergenic
1122605989 14:102948051-102948073 CTGTAACTGGCATAGTCTGGAGG - Intronic
1125020379 15:34979420-34979442 CATTATCTTGCTTGCACTGGAGG + Exonic
1125075826 15:35617037-35617059 CTGTATCTTGACTGTTGTGGTGG + Intergenic
1126652177 15:50935567-50935589 TTGAATTTTGCATGCTCTGGAGG + Intronic
1129895884 15:79105476-79105498 CTGTTTCTAGCCTGCCCTGGAGG - Intergenic
1130434696 15:83886103-83886125 CAGCATCTTTCATGCTCCGGTGG + Intronic
1130774266 15:86961675-86961697 CTGTATCTCCCATGTTCTGTGGG + Intronic
1132495184 16:259811-259833 CTGTATCTTGCAGGCTCCCGGGG - Intronic
1133369855 16:5239450-5239472 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1139970017 16:70768497-70768519 ATGTATTTCCCATGCTCTGGAGG + Intronic
1142011558 16:87717941-87717963 CTCTGGCTTGCATGGTCTGGAGG - Intronic
1143353556 17:6307549-6307571 CTTTGTCCTGCCTGCTCTGGGGG - Intergenic
1145728615 17:27155895-27155917 CTGTAGCTTGCCTTCTCTGGGGG - Intergenic
1148841554 17:50501914-50501936 ATTTATCTTGCAGCCTCTGGAGG + Intergenic
1149374483 17:56030549-56030571 CTGGATCCTGCAGGGTCTGGAGG + Intergenic
1149935285 17:60799350-60799372 CTGTATCTTGATTGTGCTGGTGG - Intronic
1151620132 17:75240229-75240251 CTGCAGCTGGCACGCTCTGGAGG + Intronic
1151792273 17:76314809-76314831 CAGAATCTTCCATGCTCTGCTGG - Intronic
1152501300 17:80711301-80711323 CTGTTCCTTCCATCCTCTGGAGG - Intronic
1152566170 17:81101347-81101369 CTGGGCCTTGCCTGCTCTGGGGG - Intronic
1160485084 18:79283653-79283675 CTTTATGTTTCATGCACTGGTGG - Intronic
1161564343 19:4991699-4991721 CTGTATCTTGATTGCAATGGTGG - Intronic
1161802426 19:6423894-6423916 CTGGCTCTTGGATGCTTTGGTGG - Intronic
1166031697 19:40135995-40136017 CTGTATCTTGGAGGGTCTGAAGG + Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
928408133 2:31030913-31030935 GTGTATTTTGCATTCACTGGGGG + Intronic
928792122 2:34970440-34970462 CTGTATCTAGCATGTACTTGTGG - Intergenic
932549584 2:72754265-72754287 CTTAAGCTTGCATACTCTGGAGG + Intronic
934176646 2:89583861-89583883 CTGTATCATGAACGCTGTGGTGG - Intergenic
934286955 2:91658222-91658244 CTGTATCATGAATGCTGTGGTGG - Intergenic
934854376 2:97719800-97719822 CTGTATCTTGATTGATGTGGTGG - Intronic
935992410 2:108732629-108732651 CTGTATCTTGACTGCAGTGGTGG - Intronic
937851793 2:126642687-126642709 CTGTGTCTGACGTGCTCTGGAGG - Intergenic
940302035 2:152185354-152185376 TTGTATCTTACATTCTCTGATGG + Intergenic
941549615 2:166898694-166898716 CTGTGTCTTGATTGCTGTGGTGG - Intronic
944334701 2:198518363-198518385 CTGTATTTTTCAGGCTCTGCTGG + Intronic
945451043 2:209995598-209995620 CTGTATCTTGTAAGCTCTGCAGG + Exonic
945657977 2:212648852-212648874 CTCTTTGTTGCATTCTCTGGAGG + Intergenic
947837035 2:233183316-233183338 CTGTGTCCTTCATGCCCTGGGGG + Intronic
1174110690 20:48195810-48195832 CTTTATCATGCTTACTCTGGTGG - Intergenic
1175795336 20:61767184-61767206 CTGTCTCCTGCATGCTCATGTGG - Intronic
1175816074 20:61883859-61883881 CTGTCTCTCGCATTCTCTGCTGG - Intronic
1177350015 21:19926290-19926312 TTGTCTCAAGCATGCTCTGGAGG - Intergenic
1177863603 21:26485391-26485413 TTGTATCTTGCTTGCTGTAGTGG - Intronic
1178010165 21:28275756-28275778 GTGTACCTTGCTTGGTCTGGAGG - Intergenic
1182045229 22:27268942-27268964 CTTTATCGAGCATGTTCTGGAGG - Intergenic
1183030330 22:35099049-35099071 CTGAAGCTTGCATGCTATAGGGG - Intergenic
1183356929 22:37364587-37364609 CTGTGTCCTGCTGGCTCTGGTGG - Intergenic
1185269191 22:49920857-49920879 CTGTCCCTGGCATGCACTGGAGG + Intronic
1185307853 22:50131907-50131929 ATGTATTTCTCATGCTCTGGAGG + Intronic
951636470 3:24783992-24784014 CTTGATGTTGCATCCTCTGGAGG + Intergenic
956367509 3:68520691-68520713 CTGCATCTGGCATGCTATGAGGG + Intronic
956498219 3:69851715-69851737 CTGTATCTTGATTGTGCTGGTGG + Intronic
957073065 3:75580614-75580636 CTGTGTCTTGCATGGTTTGGAGG + Intergenic
959215655 3:103447578-103447600 CTGTATCTTGCAGCCACTGTTGG - Intergenic
959284072 3:104384515-104384537 CTGTATCATGAATGCAGTGGTGG + Intergenic
961230498 3:125303281-125303303 CTGAATCTTGATTGCTTTGGTGG + Intronic
961505319 3:127367125-127367147 CTGTACCTTGCTTGCGGTGGGGG + Intergenic
961873372 3:130003422-130003444 CTGTGTCTTCCATGATTTGGAGG + Intergenic
964623940 3:158741011-158741033 CTGTATCTTGCATGCTCTGGGGG + Intronic
967194091 3:187011759-187011781 CTGTATCTTCCATGCCCTGCTGG + Intronic
967456360 3:189690959-189690981 CTATATCGTGCTTGTTCTGGTGG - Intronic
967596857 3:191335872-191335894 CTGTATCTTGATTGTTGTGGTGG - Intronic
968039234 3:195574433-195574455 CTGTATCATGCTTTCTCTAGGGG + Intronic
969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG + Intergenic
969737291 4:9000404-9000426 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969796494 4:9531992-9532014 CTGTGTCTTGCATGATTTGGAGG - Intergenic
970717183 4:18940117-18940139 CTGTATCTTGGAACCTCTTGTGG + Intergenic
971293290 4:25365224-25365246 CTGAATGTTGCATGCTTTTGTGG - Intronic
974511071 4:62841636-62841658 CAGTGTCTTCCATGCTTTGGTGG - Intergenic
975815102 4:78209311-78209333 CTGGAGGTTGCATGCACTGGTGG + Intronic
976929806 4:90551975-90551997 CTTGATGTTGCATCCTCTGGAGG + Intronic
978371471 4:108033666-108033688 GTGTATCTTGCTTGCAATGGAGG - Intronic
981632720 4:146839614-146839636 CTGTATCTTGATTGCAGTGGTGG - Intronic
985094173 4:186396283-186396305 CTGTATCTTGCAAGCTGTCCAGG - Intergenic
986852643 5:11830945-11830967 CTATATATTTCATGCTTTGGTGG - Intronic
989174206 5:38505344-38505366 CTGTATCTTGCATGTGGTGGTGG + Intronic
989581165 5:43034400-43034422 CTGCAGATTGCATGCTCTTGGGG + Intergenic
990303481 5:54472506-54472528 CTTAATCCTTCATGCTCTGGGGG + Intergenic
990573646 5:57104172-57104194 ATGTTTCTTGCATGCCCTGGGGG - Intergenic
991072676 5:62502139-62502161 CTGTTTCTCTCATGCTTTGGGGG + Intronic
992884586 5:81145382-81145404 CTTTCTCTTGCATGGTCTGGTGG + Intronic
996480957 5:123974162-123974184 GTGTCTCTGACATGCTCTGGAGG + Intergenic
996488416 5:124064204-124064226 CTGTAACTTAAATGCTATGGTGG + Intergenic
998161969 5:139818099-139818121 TAGTATCTAGCAGGCTCTGGTGG + Intronic
1001952430 5:175825665-175825687 CTGTAGCTTGAATGCTCTCCTGG + Intronic
1003808561 6:9754103-9754125 CTGTATCTTTCAAGCACTGGGGG + Intronic
1004861281 6:19806706-19806728 CTGTATCTAGCATCATCTAGTGG - Intergenic
1005216997 6:23541993-23542015 ATGTATATTGCATACTCTAGGGG - Intergenic
1009630094 6:66186471-66186493 AAGTATCTTGCACGCTGTGGTGG + Intergenic
1010472639 6:76247627-76247649 ATGTTTCTTTCATGCTCAGGTGG + Intergenic
1010725722 6:79330299-79330321 CTGTATCTTGATTGCTGTGGGGG - Intergenic
1018861633 6:167714296-167714318 CTGTATCCTCCCTGCTCTGGTGG - Intergenic
1022358987 7:29641597-29641619 CTGTATGCTGTATGTTCTGGTGG + Intergenic
1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1029154766 7:98508333-98508355 CTGTATCTTGATTGCAGTGGTGG + Intergenic
1030621537 7:111796007-111796029 CTGTATCTTGAGTGCCCTAGAGG + Intronic
1031619485 7:123918632-123918654 CTGAAACTTGCTTGGTCTGGGGG + Intergenic
1031802619 7:126267695-126267717 TTGTATCTTGCATTCTCTTAAGG - Intergenic
1031937527 7:127750987-127751009 CTGTATCTTGTCTGTTTTGGTGG + Intronic
1033495236 7:141887374-141887396 CTGTCCCTTTTATGCTCTGGGGG + Intergenic
1036242389 8:7091667-7091689 CTGTTTCTTCCATGATTTGGAGG - Intergenic
1036258401 8:7222345-7222367 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036259461 8:7228489-7228511 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036311503 8:7687059-7687081 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036358007 8:8059022-8059044 CTGTGTCTTCCATGATTTGGAGG - Intergenic
1036359080 8:8065164-8065186 GTGTATCTTCCATGATTTGGAGG - Intergenic
1036830346 8:12015463-12015485 CTGTGTCTTCCATGATTTGGAGG + Exonic
1036892942 8:12607924-12607946 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036899426 8:12659763-12659785 CTGTTTCTTCCATGATTTGGAGG + Intergenic
1036900494 8:12665910-12665932 CTGTTTCTTCCATGATTTGGAGG + Intergenic
1038396102 8:27246733-27246755 TTGTCTCTTGCAGGTTCTGGCGG - Intronic
1045551640 8:103178304-103178326 CTGTATCTTGGTTGCAGTGGTGG + Intronic
1047232389 8:123008620-123008642 ATGTGGCTTGCATGCTCTAGTGG + Intergenic
1049031167 8:140038843-140038865 CTGTGGCTTGCATCCTATGGAGG - Intronic
1052297769 9:26917162-26917184 CTTTATTTTGCATGCACAGGTGG - Exonic
1052939962 9:34125657-34125679 CTGTATCTTCCGTGCTCCAGTGG - Intronic
1189597640 X:42586431-42586453 CTGTATCCTGATTGCTGTGGTGG + Intergenic
1192626261 X:72731950-72731972 CTGAATGGTCCATGCTCTGGTGG - Intergenic
1195238747 X:102929415-102929437 CTGGATCTTTCATCCTTTGGAGG + Intergenic
1199493626 X:148428349-148428371 CTGAATGCTGCATCCTCTGGAGG + Intergenic
1200754771 Y:6980369-6980391 CTGTATACTGGATGCTCTAGAGG - Intronic