ID: 964629549

View in Genome Browser
Species Human (GRCh38)
Location 3:158795328-158795350
Sequence GTGTCTGGGTAGAGGTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964629549 Original CRISPR GTGTCTGGGTAGAGGTATGT GGG (reversed) Intronic
900490275 1:2945316-2945338 GTGTCTGTGTATACGCATGTTGG + Intergenic
900664374 1:3804544-3804566 GGGTCTGGGGAGGGGTGTGTGGG + Intergenic
902625781 1:17675485-17675507 GTGTGTGTGTATAGGTGTGTGGG + Intronic
903197296 1:21700510-21700532 GTGACAGGGCAGAGGTATCTGGG - Intronic
903421630 1:23221710-23221732 GTGTCTGGGGACAGGTGTCTGGG + Intergenic
904732368 1:32604361-32604383 GTGTCTGGGGAAAGGTTTGTGGG - Exonic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
908602859 1:65759653-65759675 GTGTCTGCTGATAGGTATGTGGG + Intergenic
910235235 1:85028824-85028846 TGGTCTGGGAAGATGTATGTAGG + Intronic
911186272 1:94908168-94908190 GTATCTGGCTAGAGGGATGTTGG - Intronic
911839685 1:102664861-102664883 GTGTCTGGTTAGAGGTTCATTGG + Intergenic
912263754 1:108133672-108133694 GTGTCTGGGTATAGGATTCTGGG + Intergenic
915480518 1:156181493-156181515 GTGTCTGTGTAGAAATAAGTAGG + Intergenic
915537318 1:156544705-156544727 GTGTGTGGGTGTGGGTATGTGGG - Intronic
916249636 1:162724466-162724488 GTTTCTGGGTGGGGGTAAGTTGG - Intronic
916389805 1:164319567-164319589 GTATTTGGGTAAATGTATGTAGG - Intergenic
918135099 1:181665144-181665166 GTGTGTGTGTATAGGTATATAGG - Intronic
919893278 1:201991766-201991788 GTGTCCTGGTGGAGGTATCTTGG + Intronic
920261120 1:204688746-204688768 GTGTCTTGGGAGAGGGATGCAGG + Intergenic
924165428 1:241276960-241276982 GTCTCTGGGCAGAGGTACGAAGG - Intronic
1062806572 10:424823-424845 GTTTCTTGGAAGAGGTAGGTGGG - Intronic
1064960185 10:20954842-20954864 GTGGATGGGGAGAGGTATGAAGG + Intronic
1066022270 10:31315994-31316016 GTGTTTTGGAAGAGGTATGTGGG + Intergenic
1066284539 10:33951728-33951750 TTGTTTGGTTTGAGGTATGTAGG + Intergenic
1066512073 10:36111775-36111797 GAGTCTGGGGAAAGATATGTTGG - Intergenic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1074060173 10:109958190-109958212 GTTTCTGAGCAGAGGTATGTAGG + Intergenic
1074627963 10:115214635-115214657 GTGGCTGGTTAGAGGAATGATGG + Intronic
1075034943 10:119057245-119057267 GAGTCTGGGTAGATGTAGGTTGG - Intronic
1076528508 10:131127876-131127898 TGGTCTTGGTAGTGGTATGTGGG - Intronic
1076632523 10:131859498-131859520 GAGTCTGGGGAGAGGTATGCAGG + Intergenic
1077759229 11:5072927-5072949 GTGTTTGTGTAGAGGTATAGAGG - Intergenic
1077761501 11:5104548-5104570 GTGTCAGAGTAGAGGTATAGTGG - Intergenic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1084879249 11:72158576-72158598 GTGCCTGGGTAAGAGTATGTAGG + Intergenic
1090532873 11:127609474-127609496 CTGTCTGGGTAGATGGGTGTGGG + Intergenic
1091196925 11:133739142-133739164 GTGTGTGGGTATATGTGTGTGGG + Intergenic
1091361454 11:134981348-134981370 GTGTCTGGAAAGAGGGATCTGGG - Intergenic
1094430580 12:30365483-30365505 GTGGCTGGGTAGTGTTTTGTTGG - Intergenic
1096145622 12:49276784-49276806 ATGTCTGGGCAGAGGTGTTTTGG + Intergenic
1096602022 12:52736133-52736155 GTGTCTGGCTAGAGCCATGGTGG - Intergenic
1097757106 12:63418709-63418731 GTGCCTGTGTAGAGCTATGAAGG + Intergenic
1098633688 12:72755668-72755690 GTGTCTTGGTATAGGTCTGTGGG + Intergenic
1101830935 12:108255960-108255982 GAGTTTGGGAAGAGATATGTTGG - Intergenic
1103927970 12:124434154-124434176 CTCTCTGGGAAGAGGTATGGGGG + Intronic
1104242767 12:127006828-127006850 GTGTCTGTGTATATGTTTGTAGG - Intergenic
1107022112 13:35762825-35762847 GTGTATGTGTATAGGTGTGTAGG - Intergenic
1108832818 13:54500296-54500318 GGGTATGGGTATGGGTATGTGGG - Intergenic
1108950626 13:56087935-56087957 GAGTCTAGGTAGAAGTCTGTTGG + Intergenic
1111058297 13:82979217-82979239 GTGTGTGGGTACACGTGTGTTGG + Intergenic
1111319005 13:86599678-86599700 GTATCTGGGAAGATGTGTGTTGG - Intergenic
1112210917 13:97376062-97376084 GTGAATGGGTAGAGGTGTGCAGG + Intronic
1112683874 13:101800023-101800045 GTGTCTGTGGAGAAGTAGGTAGG - Intronic
1113327217 13:109293840-109293862 GTGTGTGTGTAGGGGTGTGTGGG - Intergenic
1113327252 13:109294055-109294077 GTGTGTGTGTAGGGGTGTGTGGG - Intergenic
1113468710 13:110530122-110530144 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113468727 13:110530169-110530191 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113468745 13:110530217-110530239 GTGTCTGCGTAGAGGTGGGGCGG - Intronic
1113468763 13:110530265-110530287 GTGTCTGCGTAGAGGTGGGGCGG - Intronic
1113468781 13:110530313-110530335 GTGTCTGCGTAGAGGTGGGGCGG - Intronic
1113468799 13:110530361-110530383 GTGTCTGCGTAGAGGTGGGGCGG - Intronic
1113468817 13:110530409-110530431 GTGTCTGCGTAGAGGTGGGGCGG - Intronic
1113468832 13:110530457-110530479 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468847 13:110530505-110530527 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468862 13:110530553-110530575 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468892 13:110530647-110530669 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468907 13:110530695-110530717 GTGTCTGCGTAGAGGTGGGGCGG - Intronic
1113468935 13:110530791-110530813 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1114526821 14:23371763-23371785 ATGTCTGTGTATGGGTATGTTGG + Intergenic
1116139251 14:40968567-40968589 CTGTCTGAGGAGGGGTATGTAGG + Intergenic
1116736329 14:48697096-48697118 GTGTCAGGGCAGGGGTATATGGG + Intergenic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1121453514 14:94024284-94024306 GTGTCTGGGTGGAGGGATCGGGG - Intergenic
1123055767 14:105568928-105568950 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123055855 14:105569661-105569683 GCGTGTGTGTATAGGTATGTGGG - Intergenic
1123080124 14:105688447-105688469 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123080172 14:105688701-105688723 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1130116680 15:81011363-81011385 GTGACTGGGGAGTAGTATGTAGG + Intronic
1135395819 16:22131011-22131033 GTGTCTTGGCTGAAGTATGTTGG + Intronic
1135871431 16:26155020-26155042 GGGTCTGGGGAGAGGGTTGTGGG - Intergenic
1138914058 16:61441077-61441099 TTGTCTGAGTAGGGGTATTTAGG + Intergenic
1139024987 16:62805420-62805442 GTGGCTGGGTAGAGGTAGGCTGG + Intergenic
1139047625 16:63081817-63081839 GTGTGTGGGTAGGGGTGGGTGGG + Intergenic
1139276436 16:65732064-65732086 GAGACTGGGTGGAGGTGTGTTGG + Intergenic
1140896095 16:79325574-79325596 GTGTCTGGGTATCTGTGTGTGGG - Intergenic
1141833484 16:86523024-86523046 GTATCTGGGGTGAGGTATGTCGG + Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1142759815 17:2035727-2035749 GAGCCTGGGTAGAGGAATGAGGG + Intronic
1146041734 17:29461483-29461505 GTGTCAGGGCTGAGGTTTGTTGG - Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146888979 17:36492698-36492720 GTGTCTGGGGTAAGGGATGTGGG - Intronic
1148198422 17:45731440-45731462 GGGTCTGGTGAGAGGTATTTGGG - Intergenic
1149185126 17:53988929-53988951 GTGGGTGGGTAGAGGTCTGAAGG - Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1150968349 17:69997786-69997808 GAGTCCTGGTAGAGGTAAGTAGG - Intergenic
1152652709 17:81503049-81503071 TGGTCTGGGTAGAGGGATGCCGG + Intergenic
1154485854 18:14871004-14871026 GTGTGTGGGTAGGGGTGTGTGGG - Intergenic
1154485869 18:14871044-14871066 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1154485899 18:14871134-14871156 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1154493852 18:14941574-14941596 GTGTCTGGAAAGAGGGATCTGGG + Intergenic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156215346 18:34992520-34992542 GTGGATGGGTAAAGTTATGTAGG - Intronic
1156498298 18:37540513-37540535 GTGGCTGGGTCGGGATATGTGGG + Intronic
1156600837 18:38604174-38604196 GTGTCTGTGTAAAGGGATGAGGG + Intergenic
1157181880 18:45505546-45505568 GTTTCTGGGGTGAGGTATGTGGG - Intronic
1157622461 18:49024302-49024324 GTGTATGGGTGGGTGTATGTTGG + Intergenic
1157899836 18:51504322-51504344 GGGGCAGGGTAGAGGGATGTAGG + Intergenic
1158397870 18:57093818-57093840 GTGTTTGTGTATAGGCATGTAGG - Intergenic
1158969832 18:62656185-62656207 GGGTCTGGGGGGAGGTGTGTGGG - Intergenic
1162085439 19:8246158-8246180 TTGACTGGGAAGAGGTATGAGGG + Intronic
1164882638 19:31747246-31747268 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882647 19:31747558-31747580 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164937946 19:32229533-32229555 TTGTGTGGATAGAGGTATCTGGG + Intergenic
1165230803 19:34385428-34385450 GTGGCCAGGTACAGGTATGTAGG + Intronic
1167368334 19:49066035-49066057 GTCTCAGGGTAGAGGTGTGGTGG - Intergenic
1168167008 19:54555526-54555548 GTGTCTGGAAAGATGTTTGTGGG - Intergenic
925043090 2:748876-748898 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
925043098 2:748951-748973 GTGTCTGCATAGAGGCCTGTGGG + Intergenic
927231324 2:20826720-20826742 GTGTCTGGGTTGTGGGTTGTGGG + Intergenic
928024024 2:27725109-27725131 GTGCCTGGGGAGAGGAATGTGGG + Intergenic
928260230 2:29760190-29760212 GTGTGTGTGTAGGGGTGTGTAGG - Intronic
930054539 2:47241823-47241845 GTGACTGGGAAGAGGAAGGTTGG + Intergenic
930073257 2:47385737-47385759 GTGTCTTTGTAGTTGTATGTGGG + Intronic
930271285 2:49260549-49260571 GTTTCTGTGGAGAGGTAGGTAGG + Intergenic
931582556 2:63792764-63792786 GTGGCTGGGCAAAGGAATGTAGG + Intronic
935200659 2:100853793-100853815 TTGGCTGGGTGGAGGTATGAGGG + Intronic
935222446 2:101027212-101027234 GTTTCTGGGTAGAAGCAGGTAGG + Intronic
935683141 2:105655775-105655797 GTGTTATGGTATAGGTATGTAGG + Intergenic
936285611 2:111178926-111178948 GTGTCTGGGAAGAGGCCTCTGGG + Intergenic
936935283 2:117833957-117833979 TTGCCAGGGCAGAGGTATGTAGG + Intergenic
936959713 2:118060344-118060366 GTGTGTGGTTAAAGGTTTGTAGG + Intergenic
938676934 2:133646084-133646106 GTGTATGTGTATAGGTATATAGG + Intergenic
943659734 2:190546370-190546392 GTGTATGGGAAGATGAATGTAGG + Intergenic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
945606182 2:211935331-211935353 GAGTCTGAGTAGAGTTAAGTAGG + Intronic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
946175413 2:217919422-217919444 GTGCCTGTGTACAGGTGTGTGGG - Intronic
947425193 2:229977066-229977088 GTCTCTGGTTAGAGGTTAGTTGG + Intronic
947737924 2:232467313-232467335 GGGTCTGGGCAGAGGTTTCTTGG - Intergenic
948109166 2:235440579-235440601 GTGTCTGGGAGGAGGGATGGAGG - Intergenic
948836062 2:240626541-240626563 GTGTCTGGGTAGCAGCTTGTTGG + Intronic
1173328459 20:42054577-42054599 GTGCTTGGGTAGAGGTATGAGGG + Intergenic
1174482015 20:50837957-50837979 GTGTGTGTGTAGAGGTGGGTGGG - Intronic
1174769728 20:53287675-53287697 GTGCCAGGGTAGTGGTATTTTGG + Intronic
1175172573 20:57090856-57090878 GTGTGTGGGTGGAGGTGTGTGGG - Intergenic
1175172597 20:57090950-57090972 GTGTGTGGGCGGAGGTGTGTGGG - Intergenic
1175485134 20:59340359-59340381 GTGTCAGGGTTCAGCTATGTGGG + Intergenic
1175875666 20:62228153-62228175 GTGTCTGGGGAGGGGCATGGAGG - Intergenic
1176795429 21:13368314-13368336 GTGTGTGGGTAGGGGTGTGTGGG + Intergenic
1176795470 21:13368446-13368468 GTGTGTGGGTGGGGGTGTGTGGG + Intergenic
1176795481 21:13368480-13368502 GTGTGTGGGTAGGGGTGTGTGGG + Intergenic
1176795488 21:13368494-13368516 GTGTGTGGGTAGGGGTGGGTGGG + Intergenic
1177539689 21:22476532-22476554 GTGTCTGTGTAGAGTAATTTAGG - Intergenic
1178823153 21:35993185-35993207 GTGTGTGAGTTGGGGTATGTGGG - Intronic
1179554313 21:42162751-42162773 GTGGCTGGGTAGGGGTGAGTGGG + Intergenic
1181105661 22:20573540-20573562 CTCTCTGGGTAGATGTGTGTTGG + Intronic
1181260203 22:21591899-21591921 GTGTCAGAGTGGAGGAATGTTGG + Intronic
1183876484 22:40786511-40786533 GTGTATGGGAGGATGTATGTAGG - Intronic
1184016655 22:41790977-41790999 GTGTCTAGGCAGAGGTATAGAGG + Intronic
1184239835 22:43206251-43206273 GTGTGTATGTAGGGGTATGTAGG - Intronic
1184491709 22:44813561-44813583 GTGTGTGTGTAGTTGTATGTAGG - Intronic
1185070127 22:48651529-48651551 GGTTCTGGGCAGAGGTATGGTGG + Intronic
949499878 3:4669545-4669567 ATGTCTTGGTAAAGGTATGTTGG + Intronic
950529249 3:13543616-13543638 GTGTCTGGGGAGAGGAGTGGGGG - Intergenic
952393155 3:32898179-32898201 CTGTCTGAGTAGAGGTACCTGGG + Intergenic
952520552 3:34152676-34152698 GGGACTGGGCAGAGGTATGGCGG + Intergenic
953010523 3:39021266-39021288 GTCTCTAGGTAGAGGTTAGTTGG + Intergenic
953457836 3:43056693-43056715 GTGTGTGTGTAGAGGTGTGTAGG + Exonic
953544837 3:43856829-43856851 GTGTCTGTGTTGAGGGTTGTGGG - Intergenic
954431083 3:50471145-50471167 GTGGCTGGGTAGAGGGGTGGAGG + Intronic
962785963 3:138768587-138768609 GTTTCTGGGTGGAAGTAGGTTGG - Intronic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
965586486 3:170323230-170323252 ATGTCTGGGTGGAGGTGGGTGGG + Intergenic
966830779 3:184006595-184006617 GTCTCTGGGTAGAGGAATTAAGG + Intronic
967286037 3:187871504-187871526 GTGTCTGAGTAGGGAAATGTAGG - Intergenic
967860634 3:194148777-194148799 GTGTCTGGGTAGAGATGCGGGGG - Intergenic
968610437 4:1554489-1554511 GTTTCTGGGCAGTGGTAGGTGGG - Intergenic
969628881 4:8323794-8323816 GTGTCTGGGAAGGGGCATTTTGG - Intergenic
970004592 4:11398447-11398469 GTGACTGGCTAGAGGTCTCTTGG - Exonic
970150135 4:13081024-13081046 GTGGTTGGGTACAGGTAGGTGGG - Intergenic
971884515 4:32425966-32425988 GTGTCAGGGTAGAGATCTGGTGG + Intergenic
972580110 4:40387598-40387620 GTGTATGGGGAGGGGTATGTGGG + Intergenic
972723931 4:41729188-41729210 GTGTCTGGGTGTGGGTAAGTGGG - Intergenic
974645156 4:64680406-64680428 GAATCTGGGTAGAGTTAGGTAGG - Intergenic
979449750 4:120856634-120856656 GTCTCTGGGAAGAGGAATGATGG - Intronic
983583998 4:169336845-169336867 GTATCTGGGTAGGGTTATCTGGG - Intergenic
986270062 5:6222262-6222284 GTCTCTGGTTAGAGGTTAGTTGG - Intergenic
986291363 5:6401765-6401787 TTGTCTGGGTAGAGAAATCTTGG + Intergenic
986702299 5:10422568-10422590 TTGTCTGGGTAGAGGAAGCTTGG - Intronic
987039519 5:14048699-14048721 GTGCCTGGGTTGAGGTAGGAAGG - Intergenic
987141207 5:14948396-14948418 GTGTCTGGGTACACGCATTTTGG + Intergenic
988630164 5:32920804-32920826 TTGTCTGGGGATAGGTATTTGGG - Intergenic
988839124 5:35065918-35065940 GTGTCAGGATCCAGGTATGTGGG + Exonic
989631513 5:43487332-43487354 GTGTTTGGGTGGAGGTTTGGTGG + Intronic
992383069 5:76257621-76257643 GTGTGTGGGTGTGGGTATGTAGG + Intronic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
995172458 5:109132699-109132721 ATCTCTGGGTAGAGGTTTGGAGG + Intronic
995450426 5:112294058-112294080 TTGTCTGGTTAGAGGTATAGTGG - Intronic
995506279 5:112863550-112863572 GTGTGTGGGTAGGGGTAGGGAGG + Intronic
996659352 5:125982135-125982157 GTTTCTGTGTATAGGTAAGTAGG + Intergenic
997758193 5:136420194-136420216 GTCTATGGGTAGAGGGATGAGGG + Intergenic
998906018 5:146906113-146906135 TTGTCTGAGTTGAGATATGTTGG + Intronic
999485031 5:151986520-151986542 TTGTCTGGGTAGAGGTTTTATGG - Intergenic
1000852588 5:166358621-166358643 GTGTGAGGGCAGAAGTATGTAGG - Intergenic
1002237649 5:177813031-177813053 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1002275974 5:178104655-178104677 GTGTGTGGGTGGGGGTGTGTGGG + Intergenic
1002724635 5:181286475-181286497 GTGTGTGGGTGGGGGTGTGTGGG - Intergenic
1004189026 6:13448053-13448075 GTGCCTGGGTGGAGGGATGGAGG + Intronic
1004747148 6:18522462-18522484 GTGTTTGGAAAGAGGTATTTTGG + Intergenic
1005414704 6:25587394-25587416 GTGTCTGGACAGAGGCTTGTGGG + Intronic
1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG + Intronic
1007581679 6:42963721-42963743 GTGCCTGGGCAGAGGCTTGTGGG - Exonic
1007906940 6:45471413-45471435 ATGTCTGGGGCGAGGGATGTAGG - Intronic
1008378815 6:50820421-50820443 GTGTATGTGTGGAGGTATGTAGG + Intronic
1010516780 6:76782823-76782845 GTGTCTTGGTAGAAGCATGATGG - Intergenic
1011502191 6:88002908-88002930 GGGTGTGGGTAGAGGCATGTGGG + Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1013895363 6:115081588-115081610 GTGTGTGGGTGTATGTATGTAGG + Intergenic
1017752034 6:157496968-157496990 GTGTGTGGGTAGAGGTAGGGTGG + Intronic
1018440802 6:163811090-163811112 GTGTGTGTGTATAGATATGTGGG - Intergenic
1019553779 7:1618437-1618459 GTGTCTGTGTAGGTGTATATAGG + Intergenic
1019643839 7:2118670-2118692 GTGTGTGGGCAGCAGTATGTGGG - Intronic
1020358922 7:7306188-7306210 GAGTGTGGGTAGATGTTTGTTGG + Intergenic
1021194695 7:17662399-17662421 GTGTGTGTGTAGGTGTATGTGGG - Intergenic
1022942795 7:35255825-35255847 GTGTCTGGGGAGAGACAGGTTGG - Intergenic
1024370336 7:48576091-48576113 GTATTTGGGAAGATGTATGTAGG + Intronic
1024636873 7:51298355-51298377 GTGACTGGGTTGAAGTCTGTAGG - Intronic
1025908703 7:65810232-65810254 GTGCCTGGTGAGAGGTGTGTGGG - Intergenic
1026807163 7:73435769-73435791 CTGTGTGGCTAGAGGTGTGTGGG - Exonic
1028735535 7:94207821-94207843 GTGTGTGTGTAGAGGTGTTTAGG - Intergenic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1031231147 7:119108304-119108326 GTGGGTGGGTAGGGGTAGGTGGG - Intergenic
1034549146 7:151809277-151809299 GTCTCGGGGTAGGGGTGTGTGGG - Intronic
1034933821 7:155185349-155185371 GTGTTTGGGAAGAGGTGTGAAGG - Intergenic
1034937194 7:155207923-155207945 GTGTGTGGGAATGGGTATGTGGG + Intergenic
1035890114 8:3334115-3334137 GTGTTTGGGTAGAGATAGGTGGG + Intronic
1037589621 8:20302304-20302326 GTCTGTGGGTAGAAGTCTGTGGG - Intronic
1039103006 8:33960491-33960513 GTGTCTGTGTATACATATGTGGG - Intergenic
1039317070 8:36385532-36385554 GTGTCTGGGGAGAAGGATGGAGG - Intergenic
1040447161 8:47507130-47507152 GTGGCTGGGAAGAGGCATATGGG - Intronic
1041605391 8:59777199-59777221 GTCTCTGGTTAGAGGTTAGTTGG - Intergenic
1043151670 8:76724989-76725011 GTGTGTGTGTACAGGTATATGGG + Intronic
1044447937 8:92300251-92300273 GTGTGTGGGTAGGGGTGTGTGGG - Intergenic
1044580729 8:93823419-93823441 GTGGGTGGGTAGGGGTGTGTGGG + Intergenic
1045838844 8:106555890-106555912 GTGTCTGTGTATATGTGTGTAGG + Intronic
1046062786 8:109158850-109158872 GTGTGTGGGGAGGGGTGTGTGGG - Intergenic
1046219374 8:111193232-111193254 GTGTGTAGGGAGAGGTATGGGGG + Intergenic
1047551250 8:125874633-125874655 GTGTCTGGGTAGAACCATGAGGG - Intergenic
1051800485 9:20927663-20927685 GTGTCTTTGTAGAAGTATTTTGG + Intronic
1052729645 9:32270183-32270205 GTGTGTGGGAAGAGTCATGTGGG + Intergenic
1053017965 9:34674793-34674815 GTGTGTGGGTAGAGACACGTAGG + Intergenic
1056258686 9:84825935-84825957 GTTTCTGAGTAAAGCTATGTGGG + Intronic
1056678426 9:88696515-88696537 GGAGCTGGGTAGAGCTATGTGGG + Intergenic
1056753901 9:89370825-89370847 GTGTCTGGGGTGCGGTGTGTCGG + Intronic
1056754276 9:89372372-89372394 GTGTCTGGGGTGTGGTGTGTCGG + Intronic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1057230178 9:93317188-93317210 GTGGCTGAGTAGAGGCATGTGGG + Intronic
1060028093 9:120190147-120190169 TGGTCTGGGTAGAGCTAAGTTGG - Intergenic
1062101090 9:134728887-134728909 GTGTCAGGGTAGAGGGTTGGGGG + Intronic
1062261003 9:135663420-135663442 GTGTCTGCGTTGGGGTCTGTGGG + Intronic
1185480166 X:440034-440056 GTGTCTGTGTATATGTCTGTGGG - Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1186060117 X:5695797-5695819 ATGTCTGGGTAGGGGGAGGTGGG + Intergenic
1186606841 X:11101092-11101114 GTCTTTGTGTGGAGGTATGTTGG + Intergenic
1187661906 X:21556820-21556842 GTAGCTGGGTAGAGGTTTGTGGG + Intronic
1188955537 X:36431596-36431618 GTGTGTGGGTAGAGGGAGGGAGG + Intergenic
1189279619 X:39812025-39812047 GTGTGTGGGTAGGGGGAGGTGGG - Intergenic
1193806256 X:85998382-85998404 GTCTCTTGGGAGTGGTATGTGGG + Intronic
1195037639 X:100984555-100984577 GTTTCTTGGAAGAGATATGTGGG + Intronic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1198695354 X:139331216-139331238 GTGTCTGGGAAGGGGGTTGTGGG + Intergenic
1201707800 Y:16956030-16956052 GGGTCTGGGGAGGGGTGTGTAGG - Intergenic