ID: 964633413

View in Genome Browser
Species Human (GRCh38)
Location 3:158836438-158836460
Sequence ATGTGCTAAGAGAGGTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964633409_964633413 1 Left 964633409 3:158836414-158836436 CCCTCATACTTTGCAGAAGGGGA No data
Right 964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG No data
964633410_964633413 0 Left 964633410 3:158836415-158836437 CCTCATACTTTGCAGAAGGGGAG No data
Right 964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG No data
964633407_964633413 2 Left 964633407 3:158836413-158836435 CCCCTCATACTTTGCAGAAGGGG No data
Right 964633413 3:158836438-158836460 ATGTGCTAAGAGAGGTGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964633413 Original CRISPR ATGTGCTAAGAGAGGTGTGG AGG Intergenic
No off target data available for this crispr