ID: 964635437

View in Genome Browser
Species Human (GRCh38)
Location 3:158853200-158853222
Sequence CCTCATATACTGCAGGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964635437_964635441 -8 Left 964635437 3:158853200-158853222 CCGGCTGCCTGCAGTATATGAGG No data
Right 964635441 3:158853215-158853237 ATATGAGGTGAGGTATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964635437 Original CRISPR CCTCATATACTGCAGGCAGC CGG (reversed) Intergenic
No off target data available for this crispr