ID: 964635441

View in Genome Browser
Species Human (GRCh38)
Location 3:158853215-158853237
Sequence ATATGAGGTGAGGTATGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964635436_964635441 -3 Left 964635436 3:158853195-158853217 CCACACCGGCTGCCTGCAGTATA No data
Right 964635441 3:158853215-158853237 ATATGAGGTGAGGTATGATTTGG No data
964635437_964635441 -8 Left 964635437 3:158853200-158853222 CCGGCTGCCTGCAGTATATGAGG No data
Right 964635441 3:158853215-158853237 ATATGAGGTGAGGTATGATTTGG No data
964635435_964635441 -2 Left 964635435 3:158853194-158853216 CCCACACCGGCTGCCTGCAGTAT No data
Right 964635441 3:158853215-158853237 ATATGAGGTGAGGTATGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964635441 Original CRISPR ATATGAGGTGAGGTATGATT TGG Intergenic
No off target data available for this crispr