ID: 964638780

View in Genome Browser
Species Human (GRCh38)
Location 3:158886070-158886092
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964638772_964638780 17 Left 964638772 3:158886030-158886052 CCCAAGGCCCTGGGAGCTGGCCC No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data
964638778_964638780 -4 Left 964638778 3:158886051-158886073 CCCTTGCACTGGTGTGCTCAGAA No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data
964638779_964638780 -5 Left 964638779 3:158886052-158886074 CCTTGCACTGGTGTGCTCAGAAT No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data
964638777_964638780 -3 Left 964638777 3:158886050-158886072 CCCCTTGCACTGGTGTGCTCAGA No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data
964638773_964638780 16 Left 964638773 3:158886031-158886053 CCAAGGCCCTGGGAGCTGGCCCC No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data
964638774_964638780 10 Left 964638774 3:158886037-158886059 CCCTGGGAGCTGGCCCCTTGCAC No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data
964638775_964638780 9 Left 964638775 3:158886038-158886060 CCTGGGAGCTGGCCCCTTGCACT No data
Right 964638780 3:158886070-158886092 AGAATGCAGCATATGAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr