ID: 964641015

View in Genome Browser
Species Human (GRCh38)
Location 3:158910686-158910708
Sequence ATGTTACAGCTCCAGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964641013_964641015 18 Left 964641013 3:158910645-158910667 CCAGTGGTAGGGTAGAAGAAAAC No data
Right 964641015 3:158910686-158910708 ATGTTACAGCTCCAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964641015 Original CRISPR ATGTTACAGCTCCAGCAGTG TGG Intergenic
No off target data available for this crispr