ID: 964644655

View in Genome Browser
Species Human (GRCh38)
Location 3:158946244-158946266
Sequence TGGAGTAAATCCAGCATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964644655_964644658 15 Left 964644655 3:158946244-158946266 CCCTCTATGCTGGATTTACTCCA No data
Right 964644658 3:158946282-158946304 TCAAGTAGTATGTACATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964644655 Original CRISPR TGGAGTAAATCCAGCATAGA GGG (reversed) Intergenic
No off target data available for this crispr