ID: 964645127

View in Genome Browser
Species Human (GRCh38)
Location 3:158950870-158950892
Sequence ATGAGGGAGCAGGGCGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964645127_964645138 18 Left 964645127 3:158950870-158950892 CCTTGAACGCCCTGCTCCCTCAT No data
Right 964645138 3:158950911-158950933 CCGCTGCTTCTGTCTTTAATGGG No data
964645127_964645136 17 Left 964645127 3:158950870-158950892 CCTTGAACGCCCTGCTCCCTCAT No data
Right 964645136 3:158950910-158950932 GCCGCTGCTTCTGTCTTTAATGG No data
964645127_964645134 -5 Left 964645127 3:158950870-158950892 CCTTGAACGCCCTGCTCCCTCAT No data
Right 964645134 3:158950888-158950910 CTCATCTTGGGCCTTTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964645127 Original CRISPR ATGAGGGAGCAGGGCGTTCA AGG (reversed) Intergenic
No off target data available for this crispr