ID: 964648309

View in Genome Browser
Species Human (GRCh38)
Location 3:158982797-158982819
Sequence CTCCAAATGACACACATGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964648309_964648314 14 Left 964648309 3:158982797-158982819 CCAGACATGTGTGTCATTTGGAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 964648314 3:158982834-158982856 ACAGTAGCCTCAATGCTAATGGG 0: 1
1: 0
2: 0
3: 4
4: 91
964648309_964648316 30 Left 964648309 3:158982797-158982819 CCAGACATGTGTGTCATTTGGAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 964648316 3:158982850-158982872 TAATGGGAAGCCCAGTCATCTGG 0: 1
1: 0
2: 0
3: 13
4: 118
964648309_964648313 13 Left 964648309 3:158982797-158982819 CCAGACATGTGTGTCATTTGGAG 0: 1
1: 0
2: 0
3: 8
4: 116
Right 964648313 3:158982833-158982855 CACAGTAGCCTCAATGCTAATGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964648309 Original CRISPR CTCCAAATGACACACATGTC TGG (reversed) Intronic
901132725 1:6972289-6972311 CTCCTAGTGACACACCTGGCCGG + Intronic
901477039 1:9496942-9496964 CTCCAAAATTCACACATCTCTGG - Intergenic
902150947 1:14442895-14442917 CTATAAATGACCCACGTGTCGGG - Intergenic
903422225 1:23226195-23226217 CTCCATATCACACACAAGTGTGG - Intergenic
907563569 1:55413410-55413432 CTCCAAATGAAATTCATTTCTGG + Intergenic
911409591 1:97485877-97485899 CTCACAATGACAAACATATCAGG - Intronic
918375541 1:183905586-183905608 CTTCAAATGCCAAACATGTCAGG - Intronic
918510004 1:185301707-185301729 TTCCAAATGACACAAATTACTGG + Intronic
924289252 1:242521501-242521523 CTTCAAATGACACACATATTTGG - Intronic
1062812171 10:475147-475169 CTCCAGATAACACACATGGCTGG + Intronic
1063139586 10:3244406-3244428 CTTCAAATAACACACAGGACAGG + Intergenic
1068030392 10:51698530-51698552 CTCCAAATGACCCACGTGGAGGG - Exonic
1074302501 10:112245327-112245349 CTAGAAAAGAGACACATGTCAGG + Intergenic
1083657599 11:64237215-64237237 GTCCAAAAGACTCACCTGTCTGG - Exonic
1089402946 11:118175179-118175201 CACCAAATCACAAACACGTCAGG + Intronic
1089656371 11:119949878-119949900 CCCCAGCTGCCACACATGTCAGG + Intergenic
1090144690 11:124309055-124309077 CTCCAACTGAAACAAATGTGGGG + Intergenic
1097621863 12:61948624-61948646 AAGCAAATGACACAAATGTCAGG + Intronic
1102037184 12:109777843-109777865 CTGCAAAGGGCACACAGGTCAGG + Intergenic
1104348027 12:128020315-128020337 CTCGAAATAACACATTTGTCAGG - Intergenic
1104439211 12:128781490-128781512 CCCCAAATGCCACACACGGCCGG + Intergenic
1106057114 13:26248632-26248654 CTATAAATGACCTACATGTCTGG + Intergenic
1108474075 13:50796374-50796396 CTCCAAGTGACTCACAGGTGAGG + Intronic
1110001438 13:70207945-70207967 TTTCAAATGACAAACATATCAGG + Intergenic
1117018118 14:51539762-51539784 CTGCAAATGACTCAGATGGCTGG - Intronic
1118906063 14:70024116-70024138 CTGGAAATGACACACATTCCTGG + Intronic
1124139377 15:27063920-27063942 CCTGAAATGACACCCATGTCAGG - Intronic
1124646834 15:31442929-31442951 CTTTAAAAGACACACACGTCAGG - Intergenic
1125902291 15:43359977-43359999 CTCAAAATGACATATTTGTCAGG - Exonic
1127512939 15:59661038-59661060 CTTAAAAGGACACACATGGCCGG + Exonic
1128650353 15:69407566-69407588 CTCCAACTTACACTAATGTCTGG + Exonic
1137710211 16:50561549-50561571 CTCCAAATAAGTGACATGTCTGG + Intronic
1139369406 16:66457425-66457447 CTCCCAATGCCACAAATGTCAGG + Intronic
1140641968 16:76985513-76985535 ATCCCAATGACACATTTGTCTGG + Intergenic
1148121071 17:45211756-45211778 TTGAAAATAACACACATGTCTGG + Intergenic
1150414273 17:64974988-64975010 CTCACAAGGACAGACATGTCTGG + Intergenic
1150431760 17:65123804-65123826 CTTCAAATGTCAAACATTTCTGG - Intergenic
1151181767 17:72334352-72334374 CTCCAAGTGGCCCACAAGTCTGG - Intergenic
1151569798 17:74920642-74920664 CCCCAGATGTCACACTTGTCCGG + Exonic
1155214615 18:23632037-23632059 CTCCACGTGACACACGTGGCTGG - Intronic
1157472236 18:47998869-47998891 CTCCAAATGACGAACATTCCAGG + Intergenic
1160344916 18:78124544-78124566 CTCTCCATGACACAGATGTCAGG + Intergenic
1163228748 19:15983458-15983480 CTCCACATGGAACAAATGTCTGG - Intergenic
1163346873 19:16748974-16748996 CTCGAAAAGACCCACATGGCTGG - Intronic
1168265393 19:55220787-55220809 CTGAAAATGACAAACTTGTCAGG - Intergenic
925587694 2:5479667-5479689 CTCCAAATGACACCCGTAACAGG - Intergenic
926061524 2:9807846-9807868 CTGCACCTGACACACATTTCTGG - Intergenic
928117159 2:28553986-28554008 CTCCAACTAAGACACATGGCTGG + Intronic
929023951 2:37581094-37581116 AACCAAATGAAACAAATGTCAGG - Intergenic
929242561 2:39666713-39666735 CAAGAAAAGACACACATGTCAGG - Intronic
929274071 2:40006317-40006339 TTCCAAAAGACACACATGCAAGG - Intergenic
932175863 2:69601231-69601253 CTTCATATGACACACAGTTCTGG + Intronic
932562030 2:72881577-72881599 CCCCAAATGAATCACATCTCTGG + Intergenic
933823430 2:86136380-86136402 CTCCCAAAGACACACATCTGTGG - Intronic
935682251 2:105648036-105648058 CTGCAAATGGCTCCCATGTCTGG + Intergenic
936741436 2:115515543-115515565 TTGCAAATGACACTCATGGCAGG + Intronic
937812156 2:126211549-126211571 CTTAAAATGACACACATTGCTGG + Intergenic
940436169 2:153657834-153657856 CTCTAAAGGACACACATGGAAGG - Intergenic
943388983 2:187238500-187238522 CTACAAAGCACACACCTGTCTGG - Intergenic
944383042 2:199133820-199133842 TTCCAGATGACACAGATGTGAGG - Intergenic
1168736504 20:143528-143550 ATCCAAATGACACACAATTAAGG - Intronic
1168851735 20:981691-981713 CCCCCAAACACACACATGTCGGG - Intronic
1169762769 20:9114381-9114403 CTCCAAATGATAAACAAATCAGG - Intronic
1172610593 20:36248621-36248643 CACCAAATGACATAAATGTTAGG - Intronic
1173168895 20:40706401-40706423 CTCCAAGTGACACACATTTGGGG - Intergenic
1174098232 20:48106581-48106603 CTCCATATGTCAGTCATGTCAGG - Intergenic
1179978876 21:44886221-44886243 CTCAAAATGACAGCCATGGCCGG - Exonic
1180699062 22:17771955-17771977 CTCCACATGTCACACCTGTTAGG - Intronic
1183940297 22:41290864-41290886 CTCCACATTCCTCACATGTCTGG - Intergenic
1184771114 22:46597091-46597113 CTCCAAAGGACCCAAAGGTCTGG - Intronic
951991815 3:28683725-28683747 CTCTAATTTACACACATTTCAGG + Intergenic
952610723 3:35205930-35205952 CTCCAAATGGCAGACCTGTAAGG + Intergenic
954807950 3:53231184-53231206 CTCAGAATGACAGACATCTCTGG - Intronic
955442943 3:58976759-58976781 ATCCCAAAGACACGCATGTCAGG + Intronic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
958763104 3:98331732-98331754 CTCAAAACGACACAAATATCTGG + Intergenic
958882205 3:99685296-99685318 TTCCAAATGCCATACATTTCAGG + Intronic
963994610 3:151693501-151693523 CTCCAAATGACTCGGATGTGGGG + Intergenic
964211334 3:154231793-154231815 CTCCTCATGAAACCCATGTCAGG + Intronic
964648309 3:158982797-158982819 CTCCAAATGACACACATGTCTGG - Intronic
965082900 3:164057816-164057838 CTCCAAATGAAACACATAGATGG - Intergenic
966854069 3:184182128-184182150 CTAGAAGTGACACACCTGTCAGG - Intronic
967087191 3:186106745-186106767 CCCCAAATGAAACTCATTTCAGG + Intronic
971134395 4:23852217-23852239 CACCAAATGAAACGTATGTCTGG - Intronic
971354456 4:25882563-25882585 CACCAAATGACAGACATCTTTGG + Intronic
975746075 4:77475695-77475717 CTCAAAATGACACAAATATATGG + Intergenic
982360781 4:154516519-154516541 CTCCAAACGAGAAAAATGTCTGG - Intergenic
983344349 4:166507317-166507339 CTCCATAAGCCCCACATGTCAGG - Intergenic
983468634 4:168127699-168127721 CTGCAATTGACACACAAGTAAGG + Intronic
984249808 4:177318332-177318354 CACCATATGACATACATTTCAGG - Intronic
986118400 5:4803977-4803999 CACCAAATGACACCCTTGTGTGG + Intergenic
987081572 5:14430053-14430075 GACCAAATGATACACATGTGAGG - Intronic
993897138 5:93549581-93549603 CTCATAATGACACACAGTTCAGG + Intergenic
994950516 5:106455361-106455383 CTCCAAATGAGACCTATGTTAGG - Intergenic
995281601 5:110341662-110341684 ATCCCAATGAGACACATGTTGGG + Intronic
997646348 5:135484591-135484613 CTCCAAAAGACTCCCATGTAAGG - Intergenic
1011183960 6:84653626-84653648 CTCCATGTGAGACACATATCAGG - Intergenic
1011311093 6:85980755-85980777 CCCCAAATGACAGGCATGCCAGG + Intergenic
1012163809 6:95923416-95923438 CACAAAATGACACAGATGTTGGG - Intergenic
1014700127 6:124676238-124676260 CTCCAAATGAATCACATGTTAGG - Intronic
1015648677 6:135427627-135427649 CTCCAAATGACAGAGAACTCTGG + Intronic
1015958391 6:138621904-138621926 CTCCAAGTCACATACATGGCAGG - Intronic
1016454753 6:144218727-144218749 TTCCAAATGTAACACTTGTCAGG - Intergenic
1023734453 7:43222686-43222708 CTACAAATCTCACACATGTCAGG - Intronic
1028721585 7:94038958-94038980 CTCAGAATGAGACACAAGTCAGG + Intergenic
1029946153 7:104535283-104535305 CTCCAAATGATACTTCTGTCAGG + Intronic
1031498061 7:122476563-122476585 TTCCAAATGACACACATGAATGG + Intronic
1041290152 8:56301040-56301062 CTCCAGAGGACACACAGCTCTGG - Intronic
1043117538 8:76277540-76277562 CTCCAAATGACTTACTTTTCTGG - Intergenic
1044662195 8:94602445-94602467 TTTAAAATGACACACATGGCTGG + Intergenic
1048764721 8:137831633-137831655 CTCCAAATGATTCACATATAAGG + Intergenic
1050762076 9:9084565-9084587 TTCCCACTGACACACATTTCTGG + Intronic
1050966212 9:11806411-11806433 CTCCTAATGGCACTTATGTCTGG - Intergenic
1054743054 9:68827959-68827981 CTCCAAAACAAACAGATGTCAGG + Intronic
1054769827 9:69073187-69073209 CTCCAAATGAGACACATTAAAGG + Exonic
1055199590 9:73643925-73643947 CTGCAAATGATTCACATGCCAGG - Intergenic
1055229442 9:74044158-74044180 CTCTAAAAGACACACATATTTGG + Intergenic
1058090679 9:100802265-100802287 GTCAAAATGACCCACATATCCGG - Intergenic
1060458847 9:123828408-123828430 CTCCCAATGACATACAAGTTAGG - Intronic
1187078716 X:15963501-15963523 TTCCAAATGATACGTATGTCTGG - Intergenic
1189232027 X:39460110-39460132 CTACAAAAGACACAGATGCCTGG + Intergenic
1190520715 X:51276964-51276986 CTCCACATGTCACATATGACTGG + Intergenic
1192573318 X:72223702-72223724 TTCAAAAAGACAAACATGTCTGG + Intronic
1195953260 X:110301187-110301209 CTTCAATGGACACACATGACAGG - Intronic
1196826447 X:119743997-119744019 CAGCAAATGACAGACATGTGAGG + Intergenic