ID: 964649315

View in Genome Browser
Species Human (GRCh38)
Location 3:158993045-158993067
Sequence ATATAGAGACTTCACTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964649309_964649315 16 Left 964649309 3:158993006-158993028 CCTTGCTATAGAGCCATGTGGGA 0: 1
1: 0
2: 0
3: 9
4: 112
Right 964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 205
964649311_964649315 3 Left 964649311 3:158993019-158993041 CCATGTGGGAAGGCATGAAGATT 0: 1
1: 0
2: 1
3: 18
4: 173
Right 964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 205
964649306_964649315 22 Left 964649306 3:158993000-158993022 CCAGAGCCTTGCTATAGAGCCAT 0: 1
1: 0
2: 0
3: 8
4: 117
Right 964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG 0: 1
1: 0
2: 0
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964649315 Original CRISPR ATATAGAGACTTCACTGGAG GGG Intronic
900843703 1:5078998-5079020 AGACAGAGACTCCACAGGAGGGG - Intergenic
902839155 1:19064564-19064586 ATATACAGACTTGACTGGCCAGG - Intergenic
903922776 1:26812785-26812807 ATGGGGAGAATTCACTGGAGAGG + Intergenic
904369552 1:30039965-30039987 ATGTACAGACTTGACGGGAGAGG + Intergenic
905276954 1:36824621-36824643 AAAGAGAGACTTCTCTGGAGAGG - Intronic
909011667 1:70341853-70341875 ATATAGAGAATGGATTGGAGGGG + Intronic
909991378 1:82226705-82226727 ATTTTGAGAGTTCACTGGAGGGG - Intergenic
910693422 1:89987804-89987826 ATCTGGACACTTTACTGGAGAGG - Intergenic
911086694 1:93984500-93984522 AAATAGACACTTCACAGAAGGGG - Intergenic
913287856 1:117243358-117243380 ATATAGTGACTTCCCGGGAATGG - Intergenic
915258834 1:154659915-154659937 AGATAGAAACTAGACTGGAGTGG - Intergenic
915714337 1:157930426-157930448 CCATAGAGCCTTGACTGGAGTGG + Intergenic
916555595 1:165891816-165891838 AAATTGAGGCTTCACTGGAAAGG - Intronic
917747096 1:178020919-178020941 ATGCAGAGACCTCACTGGAAAGG + Intergenic
919422481 1:197387491-197387513 ATTTAGAGAATTCTATGGAGCGG - Intronic
923652008 1:235882936-235882958 ATACAGATACTTTTCTGGAGTGG - Intronic
1063771916 10:9213766-9213788 AGATCCAGACCTCACTGGAGAGG + Intergenic
1065468001 10:26045872-26045894 TTATGGAGACTTCACTGGATAGG - Intronic
1066211444 10:33243151-33243173 ACATAGAAACTTCACTCGCGGGG - Intronic
1066455850 10:35571145-35571167 AATAAGATACTTCACTGGAGAGG - Exonic
1068191052 10:53653436-53653458 ATGTAGTGAATTCACTAGAGTGG + Intergenic
1068967965 10:62932832-62932854 ATATAGAAACTACAATAGAGAGG - Intergenic
1074445932 10:113520855-113520877 AGCCAGAGACATCACTGGAGCGG - Intergenic
1079138463 11:17790903-17790925 ATATAGACAATTCACAGAAGAGG - Intronic
1079815439 11:25050833-25050855 ATACAGAGACATCATTGTAGAGG + Intronic
1083324172 11:61865193-61865215 ACATAGAGACTTCACCAGCGGGG - Exonic
1085486564 11:76868791-76868813 TTATGGAGACTTCACTGGATAGG - Intronic
1086606217 11:88699640-88699662 AAATAGAGACAACTCTGGAGGGG + Intronic
1086833232 11:91592308-91592330 ATACAGAGACTTCACTGCTTTGG - Intergenic
1087649884 11:100852793-100852815 ACATAGGAACATCACTGGAGTGG + Intronic
1089450061 11:118588128-118588150 TTATGGAGACTTCATTGGATAGG + Intronic
1090914406 11:131150551-131150573 AGAGAGAGACTTGACTGGAAAGG + Intergenic
1091845817 12:3655698-3655720 ATATAGACACTGCCCTGCAGAGG + Intronic
1092028315 12:5261796-5261818 ACAAAGAGAGATCACTGGAGAGG + Intergenic
1092202368 12:6593819-6593841 ATATAAAGACTTAATGGGAGAGG - Intronic
1092450849 12:8600673-8600695 TTATGGAGACTTCATTGGATAGG + Intergenic
1093338297 12:17937255-17937277 ATATAAAGATGTTACTGGAGAGG + Intergenic
1093816337 12:23553018-23553040 AAAAAGAGACTTCAGTGGAGTGG - Intronic
1095490553 12:42729097-42729119 ATATAGAGAAATAACTGTAGAGG + Intergenic
1095618290 12:44218731-44218753 ATAAGGAGACTTCACTACAGAGG - Intronic
1096276911 12:50217322-50217344 ATCAAGTGACTTCACTGCAGTGG + Intronic
1096905759 12:54933948-54933970 AGATCAAGGCTTCACTGGAGAGG + Intergenic
1097744594 12:63287240-63287262 ATTTAGGGATTTCAGTGGAGGGG - Intergenic
1099918426 12:88925890-88925912 AAATAGAGAGATCACTGGAGAGG - Intergenic
1100002601 12:89855425-89855447 AGAAAAAGACTTCACAGGAGAGG - Intergenic
1100055148 12:90500329-90500351 ATGTAGAGAATTCAGTAGAGTGG - Intergenic
1101336409 12:103800976-103800998 ATAGAGAGGCTTCACTAGTGTGG + Intronic
1101532882 12:105590458-105590480 ATAAAGAAACTTCACTTAAGAGG - Intergenic
1102237251 12:111301476-111301498 ATGTAGACACATCTCTGGAGGGG + Intronic
1102426623 12:112848919-112848941 ATACAGAGAGGCCACTGGAGTGG + Intronic
1102573888 12:113843974-113843996 CTAGAGAGGCTTCACTGCAGAGG - Intronic
1102974618 12:117197568-117197590 TTGTGGAGATTTCACTGGAGAGG - Intergenic
1103140145 12:118541104-118541126 AGATAGAGACGCCACTGGAAGGG - Intergenic
1105531184 13:21221999-21222021 GTATGGAGACTTCATTGGATAGG - Intergenic
1107165172 13:37275474-37275496 ATATAGAGACTGGATTGGAGGGG - Intergenic
1108520202 13:51240057-51240079 AGATAGAAACTGTACTGGAGTGG - Intronic
1108609748 13:52072707-52072729 ACATAAAGACTTCATTAGAGTGG - Intronic
1109851321 13:68068223-68068245 ATATAGTGACTTCAGTGCTGAGG - Intergenic
1110621438 13:77600127-77600149 AGAAAGAGACTTCAGTGGTGAGG - Intronic
1111690622 13:91558809-91558831 AGATCCAGACCTCACTGGAGAGG - Intronic
1114588576 14:23837838-23837860 ATATAGAGAGAGCTCTGGAGGGG + Intergenic
1115266569 14:31506837-31506859 GTATAGAGAATTAATTGGAGAGG + Intronic
1115928117 14:38460339-38460361 ATACAGAGAATCAACTGGAGGGG - Intergenic
1117280925 14:54240156-54240178 AAAGGGAGACTTCCCTGGAGGGG - Intergenic
1117394342 14:55293887-55293909 ATATAGAAACTTAACAGCAGTGG + Intronic
1120246859 14:82017174-82017196 ATATAAAGATTTCACTGGCCAGG + Intergenic
1122196511 14:100091457-100091479 TTATGGAGACTTTACTGGATGGG - Intronic
1122237465 14:100340039-100340061 AGATAGAGACATCACTACAGAGG - Intronic
1125291154 15:38148677-38148699 TTCTAGACACTTCACTGGAATGG + Intergenic
1126457083 15:48874996-48875018 AAAAACAAACTTCACTGGAGAGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127055943 15:55131617-55131639 TTATGGAGACTTCATTGGATAGG - Intergenic
1129315543 15:74741125-74741147 CTTCAGAGACTTCACTTGAGTGG + Intergenic
1129784318 15:78299168-78299190 AGATACAGACATCACTGGACGGG - Intronic
1130242843 15:82212843-82212865 ATATACAGAAGTCACTAGAGAGG + Intronic
1130457589 15:84128433-84128455 ATATACAGAAGTCACTAGAGAGG - Intergenic
1130940965 15:88508704-88508726 AGACAGAGACTTCTTTGGAGTGG + Intergenic
1132921623 16:2398635-2398657 CTATGGAGACTTCATTGGATAGG + Intergenic
1133387412 16:5381081-5381103 AAATAGATACGCCACTGGAGAGG + Intergenic
1133723505 16:8516715-8516737 ATATAGATACTTCAATGAATGGG - Intergenic
1135533619 16:23275678-23275700 ATATGGAGAATAGACTGGAGGGG + Intergenic
1137281264 16:46978782-46978804 TTATGGAGACTTTACTGGACAGG - Intergenic
1137841859 16:51648389-51648411 ATATAGAGCCTTTATTGTAGAGG + Intergenic
1144425164 17:15134534-15134556 CTAGACAGACTTCAATGGAGAGG + Intergenic
1146004457 17:29152079-29152101 TCACAGAGACTTCACTGGAGAGG + Intronic
1147983626 17:44291002-44291024 ATATAGTGACCTCCCAGGAGTGG - Intergenic
1149925264 17:60696443-60696465 ATATGGTGACTTCCCAGGAGTGG + Intronic
1151421379 17:74000309-74000331 CTATGGAGACTTCATTGGATAGG + Intergenic
1152993956 18:388969-388991 ATGTAGACACTCCACAGGAGAGG - Intronic
1153022776 18:646556-646578 ATTTAGAGAGTGCACAGGAGTGG + Intronic
1157699214 18:49749862-49749884 AAAGAGACATTTCACTGGAGAGG - Intergenic
1158508812 18:58071420-58071442 AAATGAAGAATTCACTGGAGGGG + Intronic
1158881130 18:61780616-61780638 TTATGGAGATTTCACTGGATAGG - Intergenic
1159688193 18:71449873-71449895 ATAAAGAGACTACAATGGGGGGG - Intergenic
1160105578 18:75971567-75971589 ATATAGAGAGTTCAAAGGATAGG + Intergenic
1161365552 19:3877305-3877327 ATCTAGAGACATCTTTGGAGTGG - Intergenic
1164493721 19:28738120-28738142 AAATAGACATTTCACTGAAGAGG + Intergenic
1164818350 19:31224497-31224519 GTATGGAGACATCATTGGAGTGG - Intergenic
1164847083 19:31441646-31441668 TTATGGAGACTTCACTGAATAGG - Intergenic
1165180381 19:33962401-33962423 AGAGAGAGAGATCACTGGAGGGG + Intergenic
1167572545 19:50298092-50298114 TTATGGAGACGTCACTGGATAGG + Intronic
1168014243 19:53558448-53558470 TTATGGAGACTTCATTGGATAGG + Intronic
926209888 2:10862052-10862074 ATGTAAAGACTGCACTGGGGAGG - Intergenic
928619291 2:33072348-33072370 TTATGGAGACTTCATTGGATAGG + Intronic
931371550 2:61667799-61667821 TGAAAGAGACTTCCCTGGAGAGG + Intergenic
933904464 2:86876566-86876588 ATATATAGGATTGACTGGAGAGG + Intergenic
936367775 2:111875585-111875607 ATATATAGGATTGACTGGAGAGG - Intronic
936459796 2:112705098-112705120 CTATAGAGACTACAGAGGAGTGG - Intergenic
937148832 2:119672034-119672056 AGAAAGTGACTTCACTGGAGAGG - Intergenic
938013310 2:127846491-127846513 ATCAAGTGACTTCACTGCAGTGG + Exonic
938387277 2:130875858-130875880 ATATGGAGACATAACTAGAGTGG - Intronic
938928128 2:136062947-136062969 ATACAGAGAATCCACTGTAGAGG - Intergenic
939505493 2:143041115-143041137 ATATATACACTTCTCAGGAGTGG + Intronic
941024249 2:160440600-160440622 ATCTAGGGACATCACCGGAGAGG - Intronic
941097368 2:161254026-161254048 AAATAGAGAAATCAGTGGAGTGG - Intergenic
943283245 2:185964442-185964464 ATATGGAGATTTCACTGAAAGGG - Intergenic
945419299 2:209615218-209615240 ATACAGAGATTTCACTGAAGAGG - Intronic
946130491 2:217602657-217602679 TTACAGAGACTTCACTCCAGGGG + Intronic
947042893 2:225944010-225944032 ATCTAAAGACTTGACTGGGGAGG - Intergenic
948451774 2:238080069-238080091 ATATGAAGAATTCACTGGAGGGG - Intronic
948524823 2:238565006-238565028 TTATAGTGAGGTCACTGGAGTGG + Intergenic
1170230663 20:14043508-14043530 TTATGGAGACTTCATTGGATAGG + Intronic
1170992349 20:21314964-21314986 AGATAGAGTCTTGACTGCAGGGG + Intronic
1173830045 20:46077230-46077252 ACATACAGACAGCACTGGAGAGG - Intronic
1173936710 20:46872604-46872626 AAATAGAGAATTCACTGATGAGG - Intergenic
1177374652 21:20253821-20253843 TTATGGAAACTTCACTGGATAGG + Intergenic
1178676326 21:34634572-34634594 TTATGGAGACTTCATTGGATAGG + Intergenic
1179635347 21:42705032-42705054 CTGCAGAGACTTCTCTGGAGCGG + Intronic
1182639730 22:31757332-31757354 ATATAGTGACCTCCCAGGAGTGG + Intronic
949919474 3:8989891-8989913 AGGGAGAGACTTCTCTGGAGAGG - Intronic
950937979 3:16862639-16862661 AAATTCAGACTTCACTGAAGTGG - Intronic
951310169 3:21116355-21116377 ATAGAGAGACTTCACTTGTTTGG - Intergenic
952626855 3:35416295-35416317 AAGCAGAGTCTTCACTGGAGTGG + Intergenic
953075117 3:39562161-39562183 AGATAGACACTTCACAAGAGAGG + Intergenic
953508407 3:43509391-43509413 ACATAGACATTTCACTGAAGAGG + Intronic
954493975 3:50935349-50935371 TTCTACAGACTCCACTGGAGAGG - Intronic
955658266 3:61267998-61268020 CTATGGAGGCTTGACTGGAGTGG + Intergenic
955808778 3:62763711-62763733 ATACAGAAACTTCACTTTAGAGG + Intronic
956037873 3:65115080-65115102 ATGTAGAGAATGCACTGAAGAGG - Intergenic
956751337 3:72346213-72346235 ATAGCGAGGCTTCCCTGGAGAGG + Intergenic
960459742 3:117918908-117918930 CTACAGAGACATCACTGAAGTGG + Intergenic
960461503 3:117941499-117941521 ATATGGAGACCTCATTGCAGGGG + Intergenic
964257829 3:154797250-154797272 ATATGGAGACTTCATTGGATAGG + Intergenic
964649315 3:158993045-158993067 ATATAGAGACTTCACTGGAGGGG + Intronic
965215971 3:165865204-165865226 ATATAGAGACTTAGATGGAAGGG + Intergenic
966221310 3:177553873-177553895 CTGTAGAGACTTCTATGGAGGGG + Intergenic
966565314 3:181373781-181373803 ATATAGACATTTCACAGAAGAGG + Intergenic
967259257 3:187625932-187625954 TTATGGAGACTTCATTGGATAGG - Intergenic
970514580 4:16815504-16815526 AAATAGAGGATTCACTGGAAAGG - Intronic
971009001 4:22409608-22409630 ATATAAAGACATCAGAGGAGTGG + Intronic
971099548 4:23448593-23448615 AAATAGATACTTCACTGTGGAGG - Intergenic
971472783 4:27044709-27044731 AAATGAAGACTTTACTGGAGGGG + Intergenic
973546640 4:51989264-51989286 ATATAGGGACTTCTCTGCATTGG + Intergenic
974037617 4:56830682-56830704 GAATAGACATTTCACTGGAGAGG + Intergenic
974893756 4:67913510-67913532 ATAGAGATGCTTCACTGGATTGG - Intronic
976488764 4:85641890-85641912 TTATGGAGACTTCATTAGAGAGG + Intronic
976702399 4:87985534-87985556 AGATTCAGACTTCACTGGAAAGG + Intergenic
977394946 4:96458968-96458990 AAATAGATATTTCACTGAAGGGG + Intergenic
977460150 4:97314902-97314924 CTATGGAGACTTCATTGGATTGG + Intronic
977516501 4:98026717-98026739 AGATTGAGATCTCACTGGAGAGG - Intronic
977905478 4:102473172-102473194 AAATGGAAACTTCACTGAAGAGG + Intergenic
981742485 4:148017075-148017097 TTATGGAGACTTCATTGGATGGG + Intronic
982048811 4:151478182-151478204 CTAAAGAGAATTCACTGGTGTGG - Intronic
982512154 4:156296705-156296727 AGATAGAAACTCCAGTGGAGGGG - Intergenic
983387969 4:167090430-167090452 ATTTAGAGACTTCACCAAAGAGG - Intronic
983449732 4:167895160-167895182 ATATGCAGACTTCACAGGTGGGG + Intergenic
987171229 5:15260379-15260401 ATAGGCAGACTTCACTGGAGGGG + Intergenic
989482202 5:41944859-41944881 AAGTAGATACTTCACTGGACAGG + Intergenic
991019214 5:61962552-61962574 ATATCCAGACTTCATTGGTGAGG - Intergenic
992396103 5:76370966-76370988 TTATGGAGACTTCATTGGATAGG + Intergenic
993336808 5:86670180-86670202 TTAGGGAGACTTCACTGGACAGG - Intergenic
993491146 5:88551629-88551651 TTATAGAAACTGCACTGGAAGGG - Intergenic
993503497 5:88686460-88686482 ATCTAGTGGTTTCACTGGAGTGG - Intergenic
994045884 5:95309167-95309189 TTATGGAGACTTCACTGGATGGG - Intergenic
995952226 5:117730062-117730084 GTATAGAAACTTTACTGGAAGGG + Intergenic
996211238 5:120813628-120813650 ATACTGAGACTTTACTGAAGGGG + Intergenic
998345842 5:141462572-141462594 AAATGGAAACTTCACTGGATGGG - Intronic
998403106 5:141858331-141858353 AAATAGAATATTCACTGGAGAGG + Intronic
1001952111 5:175823624-175823646 ATACAGAGACTATAATGGAGTGG + Intronic
1005522840 6:26614917-26614939 ATATTTAGAATTCACTGGGGAGG + Intergenic
1005976639 6:30805099-30805121 TTATGGAGACTTCACTGGACAGG + Intergenic
1006483635 6:34319600-34319622 TTATGGAGACTTCATTGGATAGG + Intronic
1006609179 6:35282990-35283012 CCATGGAGACTGCACTGGAGGGG - Intronic
1013641060 6:112082344-112082366 AAAGAGAGACTTCACTGTATGGG + Intronic
1018444233 6:163840683-163840705 ATATAGTGACTTCTCGGGAGTGG + Intergenic
1020798180 7:12701065-12701087 TTATGGAGGCTTCACTGGATAGG + Intergenic
1022523108 7:31020435-31020457 ATATAGAGGCTTCCATAGAGAGG - Intergenic
1022568221 7:31424797-31424819 TTACAGAGACTTCATTGGACAGG + Intergenic
1024007220 7:45233904-45233926 GTATTGAGACTCCACAGGAGTGG - Intergenic
1024879431 7:54068950-54068972 ATATATATAATTTACTGGAGTGG + Intergenic
1025983368 7:66426391-66426413 ATATTGAGACTTGATAGGAGAGG - Intergenic
1027953943 7:84856108-84856130 ATATCATGCCTTCACTGGAGGGG + Intergenic
1029909488 7:104130313-104130335 ATATAGAGACTACAGTGGAAAGG - Intronic
1032431787 7:131868042-131868064 TTATATAGACTTCATTGGATAGG + Intergenic
1032452952 7:132050257-132050279 ATTTAGAGAATTCACTGGATGGG + Intergenic
1035929003 8:3760779-3760801 TTAAAGAGACTTAACTGCAGAGG - Intronic
1036841532 8:12126559-12126581 ATCTTGAGACTTTACTGCAGTGG + Intergenic
1038469693 8:27804045-27804067 ATACAGAGTCTTCACTTGATAGG + Exonic
1038552140 8:28479345-28479367 ATGTAGAGCATTGACTGGAGAGG - Intronic
1041768824 8:61450663-61450685 ATATAGAGTCTTCAGGGCAGTGG - Intronic
1042878026 8:73457702-73457724 ATAGGGATACTTCAATGGAGAGG - Intronic
1044205986 8:89492428-89492450 ATATGGATAATTCACAGGAGTGG + Intergenic
1044711712 8:95064934-95064956 TTATGGAGACTTCATTGGATAGG - Intronic
1044775143 8:95679109-95679131 ATATGGAGACTTCTCTGTACTGG + Intergenic
1044849404 8:96413192-96413214 TTATTAAGACTTCTCTGGAGAGG + Intergenic
1045864475 8:106849583-106849605 ATATGGTGGCTTCACTGAAGGGG - Intergenic
1050460605 9:5874535-5874557 TTATGGAGACGTCACTGGAAAGG - Intergenic
1051288921 9:15525928-15525950 ATATGGTGACTTCCCAGGAGTGG - Intergenic
1054820327 9:69515587-69515609 AAGGAGAGACTTCACTGGAAAGG - Intronic
1055528721 9:77161493-77161515 ATATAGAGATTTAACAAGAGTGG + Intergenic
1056253460 9:84774190-84774212 ATATTCAGGCTTCAATGGAGGGG + Intronic
1057778708 9:98032665-98032687 ATGAAGAGATTTCACTGAAGAGG + Intergenic
1058031011 9:100197605-100197627 TTATGGAGACTTCATTGGATAGG + Intronic
1059183456 9:112242696-112242718 ATATCGTGACTTCCCAGGAGAGG - Intronic
1062693568 9:137859020-137859042 AAATAAAAACTTCACTGGATAGG - Intronic
1187862073 X:23692254-23692276 TTATGGAGACTTCATTGGATAGG + Intergenic
1188011482 X:25060787-25060809 ATATAGTGACCTCCCAGGAGTGG - Intergenic
1188356169 X:29194757-29194779 ATTTAGAGAATTCTCAGGAGTGG + Intronic
1189463464 X:41260770-41260792 TTATGGAGACTTCATTGGATAGG + Intergenic
1190053426 X:47168848-47168870 ATGTAGAGACTGAACTGGGGAGG + Intronic
1192157481 X:68757336-68757358 CTAGAGAGACTTCATTGGAAAGG + Intergenic
1193658504 X:84226981-84227003 AGATAGAGATTTGAGTGGAGAGG + Intergenic
1194337006 X:92660394-92660416 TTATAGAGACTTCATTGGATAGG - Intergenic
1196723917 X:118878917-118878939 AGCTAGAGACGTCACTGAAGAGG - Intergenic
1198069547 X:133134598-133134620 ATCTAGAAACTTCACTGATGTGG - Intergenic
1200645439 Y:5777130-5777152 TTATAGAGACTTCATTGGATAGG - Intergenic