ID: 964649919

View in Genome Browser
Species Human (GRCh38)
Location 3:158999217-158999239
Sequence CTTGGGCCTGTCCCTCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964649915_964649919 19 Left 964649915 3:158999175-158999197 CCTTTTTTAGCTTAATGAATCTG 0: 1
1: 0
2: 0
3: 20
4: 306
Right 964649919 3:158999217-158999239 CTTGGGCCTGTCCCTCAAAGTGG 0: 1
1: 0
2: 0
3: 16
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964649919 Original CRISPR CTTGGGCCTGTCCCTCAAAG TGG Intronic
900497576 1:2982971-2982993 CTTGGGGCTGCCCCTCACCGGGG - Intergenic
902789580 1:18758341-18758363 TTTGGGTCTGTCCCTCCCAGAGG + Intergenic
904280111 1:29413113-29413135 CTGGGCCCTATTCCTCAAAGGGG + Intergenic
904894170 1:33801729-33801751 GTTTGGACTGTCTCTCAAAGGGG + Intronic
905644025 1:39611961-39611983 TGTGGGCCTGTGCTTCAAAGGGG + Intergenic
909072338 1:71011223-71011245 CTTCTGCCTGCTCCTCAAAGTGG - Intronic
910247211 1:85152065-85152087 GTAGTGCCTGTCCCTCAAAGTGG + Intergenic
910598755 1:89007840-89007862 CTCGGGCCTGTTCCTAAAAAGGG + Exonic
912549580 1:110476316-110476338 CTGGGGACTGACCCACAAAGTGG + Intergenic
913076580 1:115345231-115345253 CTTTGGCCTGCACCTCAAGGTGG - Intergenic
915848107 1:159290229-159290251 ATTGTCCCTCTCCCTCAAAGGGG - Intronic
920784830 1:209031073-209031095 CTTGGGCAAGTCCCTGAAATAGG + Intergenic
922756848 1:228101749-228101771 CCTGGGCCTGACCCTAAGAGTGG - Intronic
923473186 1:234310256-234310278 CATGGGACTGCCCCTCAAACCGG - Intronic
923485499 1:234426106-234426128 CATGAGCCTATCCCTGAAAGAGG + Intronic
923944190 1:238864498-238864520 CTGTTGCATGTCCCTCAAAGGGG - Intergenic
924151482 1:241134828-241134850 CTTGGGACTGGGCCTGAAAGGGG - Intronic
1063374905 10:5548492-5548514 CATGGTCCTTTCCCTCAGAGGGG - Intergenic
1067691914 10:48507623-48507645 CTGGGTCCTCTCCCACAAAGTGG + Intronic
1069948967 10:72006550-72006572 CAGGGGCATGTCCCTCAAATAGG + Intronic
1070793431 10:79203171-79203193 CTGGGTCCTGGCCCTCAAGGAGG - Intronic
1071238572 10:83678414-83678436 CTTGGGCCTGTTTCCCACAGTGG - Intergenic
1072841394 10:98778071-98778093 TTTGGGGCTCTCCCTGAAAGTGG - Intronic
1074201773 10:111243862-111243884 CTTGCGCCTGAGCCTCAAGGAGG - Intergenic
1078168277 11:8909874-8909896 ACTGAGCGTGTCCCTCAAAGTGG + Intronic
1078987762 11:16611647-16611669 CTTGGGACTCTGCCTCAAAGAGG + Intronic
1081565583 11:44259004-44259026 CTGGGACCTGTGCCTCCAAGTGG - Intergenic
1083139672 11:60711590-60711612 CTTGTGCCTGTCTCTCGCAGTGG - Intronic
1083572500 11:63768211-63768233 CTCGGGCCTGGCCCCCAAGGCGG + Intronic
1085689377 11:78652968-78652990 CTTCAGCCTGTCCCTGAACGAGG + Exonic
1086215757 11:84378521-84378543 CTTGGGTCTGACACTCAATGGGG + Intronic
1089803718 11:121063240-121063262 CTTGGGACTTTCACTCAAATAGG + Intronic
1092119663 12:6035026-6035048 CTAGTGGCTGTCCCTAAAAGGGG + Intronic
1095819651 12:46463541-46463563 CATGTGCTTTTCCCTCAAAGAGG - Intergenic
1101518079 12:105455573-105455595 CTTGGGATTCTCCCTCAAATTGG + Intergenic
1111141493 13:84126072-84126094 CCTGTGCCTTTCCCTCAAAAAGG + Intergenic
1116150147 14:41130139-41130161 CTTGTTCCTGTCCCTCCTAGGGG - Intergenic
1121956499 14:98218223-98218245 CTAGTGCATGTCCTTCAAAGAGG + Intergenic
1124035443 15:26049644-26049666 CGTGGTCCTTGCCCTCAAAGAGG - Intergenic
1125103637 15:35945319-35945341 CTTGATCCTTTCCCCCAAAGTGG - Intergenic
1129499670 15:76023956-76023978 CTTTGGGCTGTCCCCCAAACAGG + Intronic
1129683490 15:77671555-77671577 CTGGGGCCTCTCTCCCAAAGGGG - Intronic
1132915179 16:2340300-2340322 CTTGGGCGTGTCCCGCACTGCGG - Intronic
1133743631 16:8670703-8670725 CTAGGGCCTGACCCACAAATGGG + Intergenic
1133897414 16:9942892-9942914 CTTGCTTCTGTCCCTCCAAGGGG - Intronic
1134559898 16:15199559-15199581 CTGGGGCCTGTCAGTCAGAGTGG + Intergenic
1134920438 16:18111169-18111191 CTGGGGCCTGTCAGTCAGAGTGG + Intergenic
1135874251 16:26183042-26183064 CTTGGGCATATACCTGAAAGTGG + Intergenic
1138593966 16:58019434-58019456 CTTGGGCCTGGCACTGAAAATGG + Intronic
1139548983 16:67663137-67663159 CTTGCCACTGTCCCCCAAAGGGG + Exonic
1139687316 16:68614320-68614342 CTTTGGCCTGGGCCTCCAAGAGG - Intergenic
1140428907 16:74884797-74884819 CTGGGGCCTGTCCCTCAGTGTGG + Intronic
1140553246 16:75890918-75890940 CTTGGGCCTGTCAGGCAGAGGGG - Intergenic
1143989019 17:10940960-10940982 GTTGGACCTGTGCCCCAAAGTGG - Intergenic
1144082939 17:11781185-11781207 CTTGGGCCAGTCCCTCTACATGG - Intronic
1145238937 17:21228315-21228337 CTTGGGCCTGTGCATCAGTGAGG + Intergenic
1147647579 17:42043067-42043089 CTTCAGCCTGGCCCTCAAAAGGG + Intronic
1150306892 17:64093297-64093319 CTTGGGTCTGAGTCTCAAAGAGG - Intronic
1155449229 18:25946160-25946182 GTTGGGCCTGTCCCAGAAAGGGG + Intergenic
1156764359 18:40633363-40633385 CATGGGTCTTTCCCTGAAAGAGG - Intergenic
1157417752 18:47520315-47520337 ACTGGGCCTGTCCCTTTAAGTGG + Intergenic
1157479814 18:48046383-48046405 CAGGGTCCTGACCCTCAAAGGGG + Intronic
1159344798 18:67187674-67187696 CTTGGGCAAGTCTCTGAAAGTGG - Intergenic
1160168962 18:76537357-76537379 CTCGCTCTTGTCCCTCAAAGTGG + Intergenic
1160488446 18:79315738-79315760 CTTGGGTCTGTTTCTCAGAGTGG + Intronic
1160955226 19:1688216-1688238 TTTAGGCCTGGTCCTCAAAGAGG - Intergenic
1161582970 19:5090809-5090831 CATCGGCCTGTGCCTCCAAGTGG - Intronic
1161590554 19:5127378-5127400 CTTGGGCATCTCCCTCTAACAGG + Intronic
1161735594 19:5990520-5990542 CTTGGCCCTGCTCCTCAAAATGG - Intergenic
1162387447 19:10368365-10368387 CTTGGGCCTGAGCATCGAAGAGG + Exonic
1165300333 19:34964273-34964295 CTCGGGCCTTCCCCTTAAAGGGG + Intergenic
1165699424 19:37926231-37926253 GTTGGGCCTGTCACTGAAAGAGG - Intronic
1165819476 19:38665483-38665505 CTTGAGTCTCCCCCTCAAAGGGG + Intronic
1167322386 19:48805297-48805319 CTTGGGCCTGTCCCCACATGGGG - Intronic
1168380878 19:55922278-55922300 ATTTGGCCTGTCTCTCAAAGAGG + Intronic
927208406 2:20624276-20624298 CTTGGGCCTGGCCCTCAGTGAGG + Intronic
930788913 2:55303109-55303131 CTTCGGTCTGTTCCTCAAAAAGG + Exonic
934119067 2:88822935-88822957 GTTGAGGCTGGCCCTCAAAGTGG + Intergenic
934515976 2:94986978-94987000 GCTGGGACTGGCCCTCAAAGTGG - Intergenic
936287446 2:111191677-111191699 CTGGGGCCTGTATCTTAAAGAGG - Intergenic
936976869 2:118229470-118229492 CTTGGGCATGTCTCTCTAGGTGG + Intergenic
943561588 2:189469962-189469984 CTTGGGCCAGTTACTCAATGGGG + Intronic
944557334 2:200900431-200900453 CTAGAGCCTGGTCCTCAAAGTGG - Intronic
1168840164 20:904965-904987 CTAGGGCCTCTCCTCCAAAGGGG - Intronic
1173546813 20:43904008-43904030 CCTGGGCCTGGCCCACAAAGTGG - Intergenic
1175479636 20:59301913-59301935 CTTGGGCCAGGCCCTCAGGGGGG - Intronic
1177376407 21:20275610-20275632 CTTGTGCCTGTGCTTCAAAGAGG - Intergenic
1179541187 21:42084117-42084139 CTGGGGCCTGCCCCGCAGAGGGG + Exonic
1180143673 21:45908167-45908189 CTGGTGCCTGTCTCTCCAAGTGG - Intronic
1182517964 22:30869779-30869801 CATTGGGCTGGCCCTCAAAGGGG + Intronic
1183117979 22:35706497-35706519 CATGGGCCAGTCCCCCAAGGTGG + Intergenic
1185117791 22:48947803-48947825 CATGGCCATCTCCCTCAAAGGGG + Intergenic
1185246171 22:49774550-49774572 CTCGGGCCTGTCCCTGCACGGGG - Intronic
950428207 3:12936007-12936029 CTGGGCCCTGGCCCACAAAGAGG - Exonic
954986234 3:54795721-54795743 CTTGGGCCCAAACCTCAAAGAGG - Intronic
961548942 3:127655986-127656008 CCAGGGCCTGTGCCTCCAAGGGG - Intronic
962946600 3:140176651-140176673 CTGGGGCCTACCCCTCGAAGAGG - Intronic
964649919 3:158999217-158999239 CTTGGGCCTGTCCCTCAAAGTGG + Intronic
969471167 4:7390057-7390079 CGTGGGCCTCCCCCTCACAGTGG - Intronic
971272587 4:25164478-25164500 CTTGTGCCTATCTCTCTAAGTGG + Intronic
971385536 4:26137870-26137892 CTGGGGCCCGTCCCTGAAGGGGG - Intergenic
973276933 4:48319884-48319906 CTTGGTCCTGGCCCACAAAGTGG + Intergenic
983366280 4:166794312-166794334 CTTGTGCCTATCCCTTTAAGGGG - Intronic
983524060 4:168742311-168742333 CTTTTGCTTATCCCTCAAAGGGG + Intronic
992603701 5:78433669-78433691 TTTGTGCCTGCCCCTCAGAGAGG + Intronic
992853043 5:80830639-80830661 CTTGGGACTTTCCCACAAAGTGG + Intronic
994075824 5:95648254-95648276 TTTTGGCCTGTCCCTAAAATTGG - Intronic
997675654 5:135711075-135711097 CTTGGGCATTTCCCTCAAATGGG - Intergenic
1001264426 5:170262595-170262617 CTTGAGCTTGTCACTCACAGTGG - Intronic
1001704068 5:173729160-173729182 CTTGGGCAGGGCCCTCCAAGTGG + Intergenic
1002607876 5:180394005-180394027 CTGGGCCCTGTCCCTCACCGGGG + Intergenic
1007212537 6:40206812-40206834 CCTGGGCCTGTCCCTCAGCTGGG + Intergenic
1010649433 6:78434025-78434047 CCTGGCCCTGTTCTTCAAAGGGG - Intergenic
1011911474 6:92445682-92445704 ATTGGGGCTGTGCCTCAAAAAGG - Intergenic
1012714799 6:102654599-102654621 CTAGGGCCTGTCAGGCAAAGGGG + Intergenic
1015817640 6:137226787-137226809 CTTGGGCCTTTATCTGAAAGAGG + Intergenic
1017671521 6:156773795-156773817 CTTGGTCCTGTCCTTCATAGGGG - Intergenic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1020587385 7:10086004-10086026 CCTGAGCCTGCCCCTCAATGTGG + Intergenic
1026828282 7:73597022-73597044 GTGGGGCCTGTACCTAAAAGGGG - Intronic
1028096005 7:86761789-86761811 CTTTGGCCTGTCCTTCAAATAGG - Intronic
1029122048 7:98274939-98274961 CTTGCGCCTGTCCCCCAGGGAGG + Intronic
1031590250 7:123582193-123582215 GTTGAACCTGTCCCTCAAAGTGG - Intronic
1033285385 7:140036850-140036872 CTTTGGCCAGTTCCTCCAAGTGG - Intronic
1034450035 7:151132381-151132403 CTTGGTACTGTCCCTCACAGAGG + Intronic
1035041349 7:155930187-155930209 CTTGGTTCTGTCTCTGAAAGCGG + Intergenic
1039945772 8:42128093-42128115 CTTGGGCCTATACCTAAGAGTGG + Intergenic
1057486085 9:95485435-95485457 CTTGGCACTGTCCCCAAAAGAGG - Intronic
1060800999 9:126545872-126545894 CTTGGTCCTGGCCCTTAAACTGG + Intergenic
1194095519 X:89634120-89634142 CTTGTGCTTCTCTCTCAAAGTGG + Intergenic
1202050923 Y:20779844-20779866 CTTGCGCCTGCCTCTCAAGGAGG + Intronic