ID: 964651504

View in Genome Browser
Species Human (GRCh38)
Location 3:159016298-159016320
Sequence CCACTGGGTAACCACCTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964651504_964651509 -1 Left 964651504 3:159016298-159016320 CCGAGAAGGTGGTTACCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 964651509 3:159016320-159016342 GTGTTGCTCAGCCACACCATGGG 0: 1
1: 0
2: 0
3: 8
4: 106
964651504_964651514 15 Left 964651504 3:159016298-159016320 CCGAGAAGGTGGTTACCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 964651514 3:159016336-159016358 CCATGGGAGTTTCTTGGTCAGGG 0: 1
1: 0
2: 0
3: 17
4: 162
964651504_964651515 27 Left 964651504 3:159016298-159016320 CCGAGAAGGTGGTTACCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 964651515 3:159016348-159016370 CTTGGTCAGGGAGCTCTGACAGG 0: 1
1: 0
2: 0
3: 17
4: 151
964651504_964651512 14 Left 964651504 3:159016298-159016320 CCGAGAAGGTGGTTACCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 964651512 3:159016335-159016357 ACCATGGGAGTTTCTTGGTCAGG 0: 1
1: 0
2: 0
3: 12
4: 121
964651504_964651510 9 Left 964651504 3:159016298-159016320 CCGAGAAGGTGGTTACCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 964651510 3:159016330-159016352 GCCACACCATGGGAGTTTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 104
964651504_964651508 -2 Left 964651504 3:159016298-159016320 CCGAGAAGGTGGTTACCCAGTGG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 964651508 3:159016319-159016341 GGTGTTGCTCAGCCACACCATGG 0: 1
1: 0
2: 1
3: 17
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964651504 Original CRISPR CCACTGGGTAACCACCTTCT CGG (reversed) Intronic
901461069 1:9392225-9392247 CCTCTGGGAAACCACCTTTCAGG + Intergenic
903186678 1:21633225-21633247 CCACTGGGAGACCACCATCCAGG - Intronic
904892582 1:33790229-33790251 CCACAGGGTACCCAGCTACTTGG + Intronic
907048690 1:51315442-51315464 CTACTGGGGTCCCACCTTCTTGG + Intronic
907811303 1:57872929-57872951 CCAATGAGTAAACACTTTCTGGG + Intronic
909059999 1:70868958-70868980 CTTCTGGGGAACCAGCTTCTGGG - Intronic
920379635 1:205528087-205528109 CCACAGGGTCACCACCTCATTGG - Exonic
920961738 1:210669973-210669995 CCACTGGGTATTCTCCTTCCAGG - Intronic
923783376 1:237044611-237044633 CCACTGTGTCACCTCCTTCAAGG - Intronic
923812335 1:237332967-237332989 CCACAGTGTACCCAGCTTCTAGG + Intronic
1063059043 10:2531922-2531944 AGACGGGGTAACCAGCTTCTGGG + Intergenic
1063157460 10:3393513-3393535 CCACTAGGTTACCAGGTTCTTGG + Intergenic
1065215366 10:23443128-23443150 TCATTGGTTAACCACATTCTTGG + Intergenic
1070628762 10:78069510-78069532 CCTCTGAGTAACCATCCTCTTGG + Intergenic
1079553415 11:21729828-21729850 TCCCTGGGTAAGCACCTGCTGGG + Intergenic
1084104949 11:66975158-66975180 CCACTGCCTCCCCACCTTCTGGG - Intergenic
1087721154 11:101666535-101666557 TCACTGGAAAGCCACCTTCTGGG + Intronic
1090637366 11:128698360-128698382 CCACTTGGTAACCACCTGAGGGG - Intronic
1091992142 12:4964021-4964043 CAACTGGGCACCCACCTGCTGGG + Intergenic
1092793821 12:12091658-12091680 CCTCTGGGTCACCAGCCTCTGGG - Intronic
1093846306 12:23975639-23975661 CCACTCATTAGCCACCTTCTGGG + Intergenic
1097178742 12:57158786-57158808 CCCCTGTGTGACCCCCTTCTTGG + Intronic
1101845380 12:108359172-108359194 GCACTGAGTAGCCACCCTCTGGG - Intergenic
1105578227 13:21672247-21672269 CCACCCGGCCACCACCTTCTTGG - Intronic
1115099325 14:29679007-29679029 CCACAGGGCAATCACTTTCTTGG + Intronic
1115441884 14:33445024-33445046 CCATTGTGTTCCCACCTTCTAGG + Intronic
1120268214 14:82277574-82277596 CCACTGGGGCACCACCTAGTGGG + Intergenic
1122854324 14:104552913-104552935 GCCCTGGGTAACCTCCCTCTGGG + Intronic
1125778461 15:42241242-42241264 CAAATGGGTAACCACCTTGCAGG + Intronic
1126881704 15:53105912-53105934 CCTCAGGCTCACCACCTTCTAGG - Intergenic
1127364196 15:58272045-58272067 TCACTGGGAAGCCACCTGCTGGG - Intronic
1127986667 15:64077809-64077831 CCAATGGGTAACATCCTTCATGG - Intronic
1128242339 15:66109527-66109549 CCATTGGGTAACTACCTCTTCGG - Intronic
1128528190 15:68426566-68426588 CCACAGGGGCACCAGCTTCTAGG - Intronic
1132389279 15:101426884-101426906 GCAGTGGGAAACCACCTTCCCGG - Intronic
1133384870 16:5361336-5361358 CCTCTGGGTAACTACCTAGTTGG - Intergenic
1138054892 16:53822414-53822436 CCACTTGTTAAACACTTTCTAGG - Intronic
1140410398 16:74737602-74737624 CCACTCTGTCCCCACCTTCTAGG + Intronic
1141127084 16:81408504-81408526 GCACAGGGTAACCAGGTTCTCGG - Intergenic
1142052361 16:87967044-87967066 CCCCTGGGAAACCTCCTTCAGGG - Intronic
1142569335 17:862580-862602 CCACTGGGTAACAAGTTACTGGG + Intronic
1143775775 17:9197938-9197960 CCAAAAGGTCACCACCTTCTTGG - Intronic
1144185536 17:12791751-12791773 CCTCTTGGTAACCAGCTGCTTGG - Intronic
1144730531 17:17523417-17523439 TCACTAGGGAGCCACCTTCTGGG - Intronic
1145064465 17:19752783-19752805 CCACTGTGTCCACACCTTCTGGG + Intergenic
1146945246 17:36869187-36869209 CCACTGGGGAACCAAGATCTTGG + Intergenic
1147636063 17:41965059-41965081 CCACTGCTTCACCACCTTCTCGG - Exonic
1153656495 18:7287508-7287530 CGACCGGGTAATCACATTCTAGG - Intergenic
1157094241 18:44672859-44672881 CCACGGGGGTACCATCTTCTTGG + Intergenic
1157274303 18:46299492-46299514 CCACTCAGTAACCCCCTTCTAGG + Intergenic
1164552230 19:29221392-29221414 ACACTGGCCCACCACCTTCTCGG + Intergenic
925593042 2:5528801-5528823 CCAGATGGAAACCACCTTCTGGG + Intergenic
936712591 2:115149348-115149370 CCCCTGGGTAACCAAATTGTAGG - Intronic
937197513 2:120172759-120172781 CCACTGGGCAGCTACCATCTTGG - Intronic
940420443 2:153475109-153475131 CCACAGAGCAACCACTTTCTGGG - Intergenic
941190720 2:162378705-162378727 CCAATGGGTGACCACATTTTGGG - Intronic
942329648 2:174808842-174808864 CCTCTTGGTAATCACCTTCCTGG - Intronic
943819297 2:192299819-192299841 CCACTGGTTACCCAGCTACTGGG + Intergenic
944129061 2:196326298-196326320 CCACTGGTGAGCCACCTCCTGGG - Intronic
946035343 2:216737743-216737765 CCACGGGGTAATTACTTTCTGGG + Intergenic
946035670 2:216740343-216740365 CCAGTGGCTAACCTTCTTCTAGG + Intergenic
1172029663 20:31972898-31972920 CCTCTGGGAAACTACATTCTTGG + Intronic
1178514283 21:33232767-33232789 TCACTGGGCACCAACCTTCTGGG + Intronic
1178704891 21:34864902-34864924 CCACTGTGTTTCCACCTTCATGG - Intronic
1179029000 21:37703674-37703696 CCACTGGGCCACCACCTTCCTGG + Intronic
950372477 3:12542775-12542797 CCACTGGGTCCCCACATTCTAGG - Intronic
950400749 3:12767684-12767706 CCCCTTGGAGACCACCTTCTGGG - Intronic
954197471 3:49005193-49005215 CCATTGGGTAAACAACTTGTGGG - Intronic
959111053 3:102123467-102123489 CCCCTGTGTATCCACATTCTTGG - Intronic
960037247 3:113114269-113114291 CCACTGGGTAAGGACTCTCTAGG - Intergenic
964651504 3:159016298-159016320 CCACTGGGTAACCACCTTCTCGG - Intronic
965321571 3:167258288-167258310 CTACTGGGTATCAATCTTCTAGG + Intronic
966332492 3:178829973-178829995 CCACCGTGTAACCACCTTAAGGG + Intronic
969585670 4:8090056-8090078 CCACTGGGCCAGTACCTTCTGGG + Intronic
971269948 4:25133367-25133389 TCACTGGGTAAACACTTTATGGG - Intronic
978342591 4:107734310-107734332 CCTCTGGGTCGCCACCTACTGGG - Intergenic
981886828 4:149685511-149685533 GCTCAGGGTAACCACTTTCTTGG - Intergenic
984345487 4:178518426-178518448 CCACTGGGAAACTCCCTTCTAGG - Intergenic
985545420 5:506552-506574 CCACAGGTTCCCCACCTTCTGGG + Intronic
986519077 5:8594534-8594556 CCACTTAGAAACCAACTTCTAGG + Intergenic
988791470 5:34612092-34612114 CCTCTGGGCAACCTCTTTCTTGG + Intergenic
995530352 5:113085988-113086010 CCACTGGATAACTACCTTTAAGG + Intronic
1004196261 6:13508401-13508423 CATCTGTGTAACCACCTTCCGGG + Intergenic
1005011743 6:21342361-21342383 CCACTGAGTACCCACTTTCAGGG + Intergenic
1005963115 6:30707489-30707511 CCCCTGGGCAACCAGCTGCTTGG - Intronic
1007076863 6:39073876-39073898 CCACTGGGTAACCCTCTTCCTGG + Intronic
1007736008 6:43982609-43982631 GCCCTGGGGAACCAGCTTCTAGG + Intergenic
1008536378 6:52509226-52509248 CCTCTGGGTTTCTACCTTCTTGG - Intronic
1014419816 6:121229737-121229759 CCACTGGGTAACCAAATAGTAGG - Intronic
1019060508 6:169254498-169254520 CCACTGGGAGACGTCCTTCTAGG - Intergenic
1020078414 7:5273769-5273791 CCACTGTGTGACCAGCTGCTTGG + Intergenic
1020496886 7:8865161-8865183 CCTCTGGAAAACCACCTTTTGGG + Intergenic
1024217293 7:47258196-47258218 CCACTGGGTAAACACCTAAGAGG + Intergenic
1025200480 7:56958424-56958446 CCACTGTGTGACCAGCTGCTTGG - Intergenic
1025671464 7:63618508-63618530 CCACTGTGTGACCAGCTGCTTGG + Intergenic
1027031035 7:74889038-74889060 CCCCAGGGTCACCACCTCCTAGG - Intergenic
1029171462 7:98632122-98632144 TCACTGGGGAACTACTTTCTGGG + Intergenic
1036470026 8:9044756-9044778 CCACTGGGAAAATACCGTCTTGG - Intronic
1039203452 8:35122921-35122943 ACACTAGCTCACCACCTTCTTGG - Intergenic
1048524490 8:135189497-135189519 CCTCTGTGTAACCTCCTTCCTGG + Intergenic
1051788662 9:20774497-20774519 CCACTGGATAACCAACTAGTAGG - Intronic
1057027601 9:91746778-91746800 CCTCTGGGAAATCACCTTCCTGG - Intronic
1058751755 9:108045950-108045972 CTACTGGGAGATCACCTTCTGGG - Intergenic
1061798792 9:133103262-133103284 CCATTGGGTGTCCACCTTCCAGG - Exonic
1187173659 X:16875037-16875059 CCAGTGGGCAACACCCTTCTTGG + Intergenic
1196721254 X:118856192-118856214 CCACTGGTTATCCTCCTCCTGGG - Intergenic
1199317802 X:146400799-146400821 CCACTGGGGAACCACCTAGTGGG + Intergenic
1200056782 X:153465768-153465790 CCACTGGGTCTCCTCCTTCAGGG + Intronic
1200376339 X:155784411-155784433 CCAGTGAGTAAACACCCTCTAGG - Intergenic