ID: 964651763

View in Genome Browser
Species Human (GRCh38)
Location 3:159019414-159019436
Sequence GATCTGGATGGTGGTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 2, 1: 10, 2: 55, 3: 202, 4: 553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964651763_964651769 -6 Left 964651763 3:159019414-159019436 CCTGTGTAACCACCATCCAGATC 0: 2
1: 10
2: 55
3: 202
4: 553
Right 964651769 3:159019431-159019453 CAGATCAAGGAACTTCAGAAGGG 0: 1
1: 0
2: 1
3: 13
4: 265
964651763_964651768 -7 Left 964651763 3:159019414-159019436 CCTGTGTAACCACCATCCAGATC 0: 2
1: 10
2: 55
3: 202
4: 553
Right 964651768 3:159019430-159019452 CCAGATCAAGGAACTTCAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964651763 Original CRISPR GATCTGGATGGTGGTTACAC AGG (reversed) Intronic
902588567 1:17457183-17457205 GATCTGGGCGCTGGTTACATGGG + Intergenic
903171566 1:21557822-21557844 GATCTGGGTGGCGGTTACATGGG - Intronic
903249377 1:22041479-22041501 GATCTGGAAGGTGGTAATAAGGG - Intergenic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
903713761 1:25347111-25347133 GATCTAGATGCTGTTTACATGGG - Intronic
903820280 1:26096780-26096802 GAGATGGGTGGTGGTTACATGGG - Intergenic
903890291 1:26565417-26565439 GAGCTGGGTACTGGTTACACAGG - Intronic
904133663 1:28294150-28294172 GATTTGGATGGTAGTTGCATAGG - Intergenic
904416457 1:30364333-30364355 GATTTGGCTGGTGGTTACATGGG + Intergenic
904648161 1:31984003-31984025 GATCTGGTTGATGGTTATACAGG + Intergenic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
906249288 1:44299083-44299105 GACCTGGGTGGTAGTTACCCAGG + Intronic
906454147 1:45979189-45979211 AACCTAGATGGTGTTTACACAGG + Intronic
907146388 1:52236850-52236872 AAGCTGGATGATGGGTACACTGG - Intronic
907221815 1:52912567-52912589 GATTTGGGTGGTGGTTATAAGGG - Intronic
907240992 1:53080976-53080998 GATCTGAGCCGTGGTTACACAGG - Intronic
907466299 1:54639978-54640000 GATCTGGGTGCTGGTTTCATGGG + Intergenic
907958848 1:59259105-59259127 GATATGGGTGGTGGTTACATGGG + Intergenic
908188417 1:61675344-61675366 GAACTGGATGGTGGTTAAATGGG + Intergenic
908218330 1:61977995-61978017 TACCTGGATGGTGGTTACATGGG - Intronic
908648695 1:66308426-66308448 GGTCTGGGTAGTGGTTACATAGG - Intronic
909279971 1:73737776-73737798 GATCTGGCTCACGGTTACACAGG - Intergenic
909328639 1:74385303-74385325 GATTGAGATGGTGGTTTCACAGG + Intronic
909660987 1:78081916-78081938 GATCTGGGTGATGGTTAAACAGG - Intronic
910035732 1:82785246-82785268 GATTGGAATGGTGGTTACATGGG + Intergenic
910204725 1:84737732-84737754 GATCGGGGTGGTGATTACAACGG + Intergenic
910324761 1:85993634-85993656 GATCTTGGTGATGGTTTCACAGG + Intronic
910969495 1:92841202-92841224 GAGCAGAATGGTGGTTACAGAGG - Intronic
911135461 1:94434770-94434792 GATCTGGGTAGTGGTTAAAAGGG - Intronic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911735889 1:101336251-101336273 AATCTGAATAGTGGTTACCCAGG + Intergenic
913323130 1:117604571-117604593 GATATGGATGGCAGTTACATGGG + Intergenic
913399828 1:118419114-118419136 GATCTGAATGGTGTTTATCCCGG + Intergenic
913479488 1:119273810-119273832 GATCTGGGTGGTGCTTGCATGGG + Intergenic
915245681 1:154554903-154554925 GATCTGGCTGGTGGAGAGACTGG - Intronic
915733844 1:158072276-158072298 TTTCTGGATGGTGGTTTCACAGG + Intronic
916172865 1:162014142-162014164 GAGCTGGTTGGTGGTTACACAGG + Intronic
916640985 1:166728890-166728912 GATCTGGGTTTTGGTAACACAGG + Intergenic
917174163 1:172213399-172213421 GATCTGGATGTGGGTTACATGGG + Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
918495332 1:185129258-185129280 GATTGGGATGTTGGTTACATGGG - Intronic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
919963679 1:202499084-202499106 GATTTGGGTAGTGGTTATACTGG - Intronic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920385256 1:205567065-205567087 GATCTAGGTGGTAGTTACACAGG - Intergenic
920418685 1:205814930-205814952 GATCTGGATGGTGGTCATATGGG - Intergenic
920904797 1:210152633-210152655 GACCTGGATGGTAATTACATGGG - Intronic
921260563 1:213382254-213382276 GATCTGGATGCTGGTGGCAAAGG + Intergenic
921533554 1:216315517-216315539 GACAGGGATGGTGATTACACAGG + Intronic
921965480 1:221083718-221083740 GATCTGGGTGCTGGATGCACGGG + Intergenic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922439289 1:225639247-225639269 GACCTGGTTGGTGGCTACACAGG + Intronic
923054914 1:230418814-230418836 GATCTGGGTGGTAGTGACACAGG + Intronic
923165152 1:231354469-231354491 GATCCGGGTGGTAGTTACACAGG - Exonic
923357167 1:233169727-233169749 GAACTAGTTGGTGGTTACAGAGG - Intronic
923646487 1:235826646-235826668 GATCTGGGTGGTGATGACACAGG + Intronic
923858517 1:237869914-237869936 GATCTTGACAGTGGTCACACTGG - Intergenic
924295385 1:242581840-242581862 GATCTTGGCTGTGGTTACACAGG - Intergenic
924520377 1:244801113-244801135 GACCTGGATGGTAGTTACAAGGG + Intergenic
924876698 1:248112737-248112759 GAACTGGCAAGTGGTTACACAGG - Intergenic
1062952085 10:1511657-1511679 GATCTTGATGGTGTCTACACTGG + Intronic
1063635371 10:7777399-7777421 TATCTGGGTGGTGGTTCCACAGG + Intronic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1065403682 10:25337244-25337266 GATCTGGATGGTGGTTTACATGG - Intronic
1065612450 10:27485508-27485530 GTTCTGGATGCTGGAGACACGGG - Intergenic
1065626670 10:27636502-27636524 GATCTGGATTGTGGTTGTATAGG - Intergenic
1067949744 10:50721889-50721911 GATCTAGGTGCTGGTTACATAGG - Intergenic
1068501820 10:57848711-57848733 GATCTGTATGCTGGTTAAATAGG - Intergenic
1068546299 10:58349735-58349757 GAGCTGGGTGCTGGTTTCACAGG - Intronic
1068961439 10:62870477-62870499 GAGCTGGGTGCTGGTCACACAGG + Intronic
1069306254 10:66974015-66974037 GATTTGTGTGGTGGTTACACTGG - Intronic
1069435927 10:68382804-68382826 GACCTGGGTGGAGGTTACGCAGG + Intronic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1069760150 10:70804530-70804552 GATCTATGTGGTGGTTACATGGG + Intergenic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1070737763 10:78876131-78876153 GAGCTGGATGCTGGTTTCCCAGG + Intergenic
1071852809 10:89592378-89592400 GATCTGGGTGATGGCTATACAGG + Intronic
1071934524 10:90513050-90513072 AATAGGGATGGTGGTTACACTGG + Intergenic
1072270877 10:93775155-93775177 GACCTGGGTGCTGGTTACAAGGG - Intronic
1072282249 10:93877321-93877343 GATCTGGGTGCTGTTTACATGGG + Intergenic
1072354704 10:94596275-94596297 GATCTCGATGATAGTTACATAGG - Intronic
1072542645 10:96410026-96410048 GCTCTGGAAGATGGTGACACGGG - Intronic
1073167482 10:101469686-101469708 AATTAGGGTGGTGGTTACACAGG - Intronic
1073368217 10:102962278-102962300 GATGTGCAGGTTGGTTACACAGG - Intronic
1073834171 10:107421691-107421713 TATCTGGGTGGTAGTTAAACAGG + Intergenic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1074718918 10:116248023-116248045 ATTCTGGGTGGTGGGTACACAGG + Intronic
1075263353 10:120981013-120981035 CATCTGGGTGCTGGTTTCACAGG - Intergenic
1075422403 10:122311728-122311750 GGTCTGGGTGCTGGTTACACAGG - Intronic
1075425357 10:122337752-122337774 GTTCAGGGTGATGGTTACACAGG + Intronic
1075425677 10:122340038-122340060 GATCTGGGTGCTGGTTATATGGG - Intergenic
1075451715 10:122556512-122556534 GGGCTGGATGATGGTTACAGGGG + Intergenic
1075547975 10:123369838-123369860 GATCTGGGTGCTGGTTGCATGGG + Intergenic
1075718310 10:124569884-124569906 GATCTGTGTGGGGGTTACACGGG - Intronic
1075742124 10:124702297-124702319 TATCTTGATGGTATTTACACGGG + Intronic
1075820698 10:125306440-125306462 GACCTGGGAGGTGGTTACAAGGG - Intergenic
1076050123 10:127326139-127326161 GATCAGGATGGTGGTTGCTGAGG + Intronic
1076208263 10:128620523-128620545 GATCTGGGCCATGGTTACACAGG - Intergenic
1076314987 10:129533657-129533679 GGCCTGGATGGTGGTCACACTGG + Intronic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1077649291 11:3955288-3955310 GATTGGGGTGGTGGTTACACAGG + Intronic
1077661829 11:4075317-4075339 GATCTGGGTGGTAGTAACACAGG - Intronic
1078098009 11:8312337-8312359 GATCTGGGTGGTGATTCCATGGG - Intergenic
1078151535 11:8763764-8763786 GATCTGAGTGTTGGTTACATGGG + Intronic
1078374116 11:10778548-10778570 GACCTAAATAGTGGTTACACAGG - Intronic
1078622012 11:12916951-12916973 GTTCTGGATGGAAGTTACAGAGG + Intronic
1079204770 11:18404901-18404923 GAGCTGGGTGGTGGGTTCACAGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1079456931 11:20644750-20644772 GATTTGGGTGCTGGTTACATTGG - Intronic
1080730410 11:34945804-34945826 GATCTAGGTGGTGGTAACATGGG - Intronic
1081641751 11:44760443-44760465 GATCTGGGTTTTGGTTGCACAGG + Intronic
1081902552 11:46641663-46641685 TATCTGGATTGTGGTTATATGGG + Intronic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1082902735 11:58273348-58273370 GATCTGAGTGGTGATTACAAAGG - Intergenic
1083701332 11:64479992-64480014 GATGAAGGTGGTGGTTACACAGG - Intergenic
1083845682 11:65331646-65331668 CATCTGGGTAGTGGTTACACAGG + Intergenic
1084287036 11:68138699-68138721 GAGCTAGGTGGTGGGTACACAGG + Intergenic
1084496557 11:69508084-69508106 GATCTTGGTGGTGGTTTCATGGG - Intergenic
1084922913 11:72486069-72486091 GATCTGGGTGATAGTTCCACAGG + Intergenic
1085174525 11:74474424-74474446 CACCTGGATGGTGCTGACACAGG + Intergenic
1085230002 11:74958871-74958893 GATCTGGAGGGGAGTAACACTGG - Intronic
1085331631 11:75656864-75656886 GATCTGAGTGGTGGTGACATGGG - Intronic
1085358898 11:75867247-75867269 GATCTGGATGCTGGATATATGGG - Intronic
1085471031 11:76758131-76758153 GATCTGGATGTTGGTTCCATGGG - Intergenic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1085553703 11:77399978-77400000 AATCTAGGTGGTGGGTACACAGG + Intronic
1085907025 11:80775775-80775797 GAGCTGGATGGTGGTTACCAAGG + Intergenic
1085934898 11:81129189-81129211 AATCTAGATGGTGGTTATATGGG + Intergenic
1087035316 11:93749808-93749830 GATCTGGATAGTAGTTACATAGG - Intronic
1087086451 11:94223651-94223673 AATCTGGGGGGTGGTTACATAGG - Intergenic
1087237090 11:95732169-95732191 GAAATGGATGGTGGTTACATGGG - Intergenic
1087696719 11:101387021-101387043 GATCTAGGTAATGGTTACACAGG - Intergenic
1087915168 11:103801600-103801622 GGTCCTGATGGTGGTTACATGGG - Intergenic
1088308110 11:108431545-108431567 GATCTGGGTGACGGTTACATAGG + Intronic
1088457012 11:110043416-110043438 GTGTTGTATGGTGGTTACACAGG + Intergenic
1088858672 11:113779866-113779888 GGGCAGGATGGTGGTAACACAGG - Exonic
1089102954 11:115979501-115979523 GATCTGGGTGGTAGTTATACAGG - Intergenic
1089516104 11:119032762-119032784 AATTTAGGTGGTGGTTACACGGG - Intergenic
1089769622 11:120793823-120793845 GAGCTGGGTGGTGGTTAGAGGGG + Intronic
1089880893 11:121772384-121772406 GAACTGTGTGGTGATTACACGGG + Intergenic
1090772901 11:129937170-129937192 GATCTGGGTGCAGGTTACATGGG + Intronic
1092043870 12:5410857-5410879 GATCTGGGTGATAGTTACATAGG - Intergenic
1092237913 12:6821561-6821583 GAACTGGACGGTGGTGACTCGGG - Exonic
1094299933 12:28952100-28952122 GATTTGGATAGAGGTTACAAGGG - Intergenic
1094345751 12:29466660-29466682 GATCTGGGTGTTGGTTACATGGG + Intronic
1094722444 12:33078175-33078197 GATGTGCATGTTTGTTACACAGG + Intergenic
1095215433 12:39542058-39542080 AACCTGGGTGGTGGTTAAACAGG + Intergenic
1095529616 12:43171243-43171265 GATGTGGGTGCTGGTAACACAGG - Intergenic
1095877042 12:47090537-47090559 GATTTGGGTGATGGTTACAAGGG - Intronic
1096167761 12:49438040-49438062 GATCTGGGTGGTAATTACATGGG - Intronic
1096442747 12:51659369-51659391 GATTTCAGTGGTGGTTACACAGG + Intronic
1096642347 12:53004633-53004655 GATGTGAGTGGTGGTTACATGGG - Intergenic
1096725649 12:53559752-53559774 GAACTGGGTAGTGATTACACAGG - Intronic
1097238847 12:57559613-57559635 GATCTGTGTAGTGGTTACATGGG - Intronic
1097294571 12:57948679-57948701 AGTCTGGGTGGTGGTTACATAGG - Intronic
1098033078 12:66274255-66274277 GGTCTGAATGGTAGTTACATGGG - Intergenic
1098599700 12:72316465-72316487 GATCTGGGTGGTGGTTATCCGGG - Intronic
1098780910 12:74685486-74685508 GAGCAGGAAGGGGGTTACACTGG + Intergenic
1098874919 12:75857198-75857220 TATCTGGATGGTGGTAACATGGG - Intergenic
1099047392 12:77738586-77738608 GATTTGAATGATGATTACACAGG + Intergenic
1099104575 12:78482888-78482910 TGTCTGGATGATGGTTACAGTGG - Intergenic
1099838658 12:87938634-87938656 GATCTGGTTGGTGTTTACAGGGG - Intergenic
1099950032 12:89291710-89291732 TATTTGGATGATGGGTACACTGG + Intergenic
1100505920 12:95220137-95220159 GATCTGGGTGCTGGTTACATGGG - Intronic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100593030 12:96046902-96046924 GATCTGGGTGCTGATTGCACTGG - Intergenic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1100741109 12:97594656-97594678 GAGCTGGAAGGTGATTGCACTGG - Intergenic
1100835438 12:98562714-98562736 GATCAGGGTGGTGGTTAAATAGG + Intergenic
1100994232 12:100285133-100285155 GGTCCGGATGCTGGTTACATGGG - Intronic
1101112029 12:101495664-101495686 GGTCTGGATGTTGGTTATATGGG - Intergenic
1101525543 12:105525373-105525395 GATCTGGTTGCTGGTTATGCTGG - Intergenic
1101813512 12:108128628-108128650 GATCTGGCTGGTGGCTGCACAGG - Intergenic
1101834339 12:108284818-108284840 GACCTAGATAGTGGTTACACGGG - Intergenic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1101981655 12:109412627-109412649 GATCCGCATGGTGGTTACACAGG - Intronic
1101981816 12:109414066-109414088 AATCTGGGTGCTGGTTGCACAGG + Intronic
1102316483 12:111891908-111891930 GATCTAGGTGCTGGTTACAGAGG - Intronic
1102392519 12:112560792-112560814 GACCTGAATGCTGGTTACATTGG - Intergenic
1102808877 12:115806712-115806734 GACCTAAATTGTGGTTACACAGG - Intergenic
1103142695 12:118563641-118563663 AATCTGGAGGGTGATTACACAGG - Intergenic
1103234956 12:119364294-119364316 GATTAGGATGGTGGTTACGTGGG - Intronic
1103317683 12:120069770-120069792 GATCTCCATGGTGGTTACACAGG - Intronic
1103335346 12:120185182-120185204 GATCTGGGTGCTGGTTATACTGG + Intronic
1103558197 12:121778522-121778544 TATCTGGCTGTTGGTGACACAGG + Exonic
1103720506 12:122972464-122972486 GATCTGGGTGCTGGTTACATGGG + Intronic
1103994949 12:124823164-124823186 GATCTGGTTGCTGGTTACCCGGG + Intronic
1104584662 12:130038319-130038341 GATCTGGAGGGAGGAGACACGGG - Intergenic
1105296808 13:19094878-19094900 GATCTGGATACTGGTTATACCGG + Intergenic
1105553350 13:21419780-21419802 GAATTGGGTGGTAGTTACACAGG + Intronic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1106452631 13:29896605-29896627 GATTTGGGTGTTGGTTACATGGG - Intergenic
1106664337 13:31835983-31836005 GATTTGGGTGGTGCTTGCACAGG + Intergenic
1107522753 13:41199715-41199737 GACCGGGCTGGTGGTTACATGGG + Intergenic
1107523084 13:41202492-41202514 GACCTGAGTGGAGGTTACACAGG - Intergenic
1107577313 13:41740600-41740622 GCTCTGGATGGTGATCACTCTGG - Intronic
1108077067 13:46692259-46692281 GAACTGGAAGCTGGTTATACGGG - Intronic
1108202054 13:48053887-48053909 GATCTAGGTGGTGGTTATATAGG - Intronic
1108367436 13:49730063-49730085 GCTTTGGGTGGTGGTTACAGAGG + Intronic
1109933694 13:69250737-69250759 AATCTGGGTGGTTGTTACCCAGG - Intergenic
1110465340 13:75793748-75793770 GATCTGGAAGCTGGCTACTCAGG - Intronic
1110574358 13:77038796-77038818 AATCAGGATGGTGGTTACCCAGG - Intergenic
1110715231 13:78695118-78695140 TACCGGGATAGTGGTTACACAGG - Intergenic
1110928596 13:81187120-81187142 TATCTTGATGGTAGTTACATGGG + Intergenic
1111051397 13:82886595-82886617 GAACTGGGTGCAGGTTACACTGG + Intergenic
1111973190 13:94938599-94938621 GATCTGCATGATGGTTTCATAGG - Intergenic
1112279456 13:98049910-98049932 AATCTGGGTGGCAGTTACACAGG - Intergenic
1112677977 13:101726470-101726492 GATCTAGGTGATGGTTGCACAGG - Intronic
1112736423 13:102425278-102425300 TATCTGGGTGCTGGTTACACAGG + Intergenic
1113182385 13:107644809-107644831 GATCTGGGTGGTGGTTCCAGAGG - Intronic
1113273071 13:108696648-108696670 GAGCTGAATGATAGTTACACAGG + Intronic
1113841006 13:113361564-113361586 GACCTGGAGGTTGGTTACAGCGG - Intronic
1114366308 14:22030558-22030580 GATATGGGTGCTGGTTACATGGG - Intergenic
1114420552 14:22578731-22578753 GATCTGGATAGTGGTTAGACAGG + Intronic
1114722942 14:24901919-24901941 GATCTGGATGGTGTTCAAATAGG + Intronic
1115097780 14:29659089-29659111 GATCTGGGTAGAGGTTACATGGG - Intronic
1115927804 14:38456556-38456578 GATCTGGGTGCTGATTACAGTGG - Intergenic
1117119894 14:52555377-52555399 AATCTGGGTGGTGGTAACATGGG - Intronic
1117288639 14:54311221-54311243 GATCTGGGTGTTGGTTGCATGGG - Intergenic
1117294719 14:54368779-54368801 GATCTGGGTGCTGGTTACGCGGG + Intergenic
1117301381 14:54431810-54431832 GATCTGGGTGGTAGTTTAACAGG + Intronic
1117385992 14:55213397-55213419 TATCTGGGTGGTGATTACATAGG + Intergenic
1117950622 14:61079716-61079738 GTTCTGGATGGAGGATACAAAGG - Intronic
1118476048 14:66118245-66118267 GATCTGAATAATGGTTACAAGGG + Intergenic
1118478222 14:66138928-66138950 GATCTTGGTGGTGGTCACACAGG - Intergenic
1118582025 14:67310522-67310544 GATTTGGATGCTAGTTATACAGG + Intronic
1118583297 14:67326547-67326569 GATTGGCATGGTGGTTACACAGG - Intronic
1118929223 14:70224611-70224633 GACCTGGGTGGTGGTTACGCAGG + Intergenic
1120840370 14:89080242-89080264 GGTCTGGATCCTGGTTACACAGG + Intergenic
1121057093 14:90865512-90865534 GATCTGAATGATGGTTATATGGG + Exonic
1121088652 14:91166173-91166195 GATCTGGATGCTGGTTACATGGG + Intronic
1121183787 14:91949016-91949038 GATCTGGATGCTGGTTATGTAGG + Intergenic
1121238298 14:92409563-92409585 GACCTGGATGCTGGTGACATGGG - Intronic
1121259393 14:92555093-92555115 GATTTGGGTGGTAGTTACACAGG + Intronic
1121293614 14:92797925-92797947 GGTTTTGATGGTGGTTACACTGG - Exonic
1121673912 14:95736679-95736701 GAGCTGGGTGCTGGTCACACAGG + Intergenic
1122240642 14:100364071-100364093 GATTTGGGTGCTGGTTACACAGG + Intronic
1122383636 14:101328987-101329009 GATCTGGATGCCAGTTACACAGG + Intergenic
1123973121 15:25527870-25527892 TATTTGGATGGTGGTGACAGTGG + Intergenic
1124501598 15:30232258-30232280 GCTCAGAATGGTGGTTCCACGGG - Intergenic
1124741968 15:32306405-32306427 GCTCAGAATGGTGGTTCCACGGG + Intergenic
1124961607 15:34401165-34401187 GACCAGGTTGGTGGTTACATGGG - Intronic
1124978233 15:34547387-34547409 GACCAGGTTGGTGGTTACATGGG - Intronic
1125762704 15:42108017-42108039 GATCAAGGTGGTGGTTACAGGGG + Intergenic
1125905587 15:43389080-43389102 GATCTGGGTGCTGGTAATACAGG + Intronic
1125935189 15:43628890-43628912 GATCTGCATGGTGGTTACACCGG - Intronic
1125947947 15:43725202-43725224 GATCTGCATGGTGGTTACACCGG - Intergenic
1126801185 15:52298187-52298209 GATCTGGGCGGTGGTTACTTTGG - Intergenic
1127798880 15:62460812-62460834 GAGCTGGATGCAGGTTACACAGG - Intronic
1127865702 15:63030789-63030811 GTTCTGGGTGCTGGTTACAAGGG + Intergenic
1127937539 15:63656643-63656665 GATCTGGAGGGCGGTGACATGGG - Intronic
1128971661 15:72112838-72112860 GATGTAGATGTTAGTTACACTGG + Intronic
1129155853 15:73717311-73717333 GATCTGGGTAGTGGTTACATGGG - Intergenic
1129222823 15:74142904-74142926 GATCTGGATGGTGGCTACATGGG + Intergenic
1129268578 15:74407932-74407954 CATCAGGATGGGGGTTTCACAGG - Intergenic
1129828959 15:78654798-78654820 GAGCTGGATGCTGGTTACACAGG - Intronic
1129996629 15:80012199-80012221 GTGCTGGCTGGCGGTTACACAGG + Intergenic
1130014792 15:80178270-80178292 GATCTGGGTGCTGGTTGCACAGG - Intronic
1130194945 15:81770936-81770958 GATCTGGGTACTGATTACACAGG + Intergenic
1130266454 15:82409067-82409089 GACCAGGTTGGTGGTTACATGGG + Intergenic
1130505570 15:84537815-84537837 GACCAGGTTGGTGGTTACATGGG - Intergenic
1130565841 15:84994407-84994429 GATTTGGCTGGTGATTACATGGG - Intronic
1130567292 15:85007442-85007464 GATCTGGGTGCTGGTTATACAGG + Intronic
1130819074 15:87473579-87473601 TATTTGGGTGATGGTTACACTGG + Intergenic
1130884594 15:88082443-88082465 CATCTGGGTGGTGGTGATACAGG - Intronic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1131776624 15:95808426-95808448 GATCTGGGTGATGGTTACAAGGG + Intergenic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1133691283 16:8217923-8217945 GCTCTCGGTGGTGGTTACATGGG + Intergenic
1134147384 16:11777107-11777129 GACCTGGATGGTGTGTACATGGG - Intronic
1134510476 16:14842606-14842628 CATCTGGATGGTGGATACATGGG - Intronic
1134698117 16:16241094-16241116 TATCTGGATGGTGGATACATGGG - Intronic
1134973720 16:18553583-18553605 CATCTGGATGGTGGATACATGGG + Intronic
1135184300 16:20301616-20301638 GAACGGGGTGATGGTTACACAGG + Intergenic
1135484601 16:22853122-22853144 GATCTGGGTACTGGTTACACAGG - Intronic
1137325797 16:47435139-47435161 GATGTGCATGTTTGTTACACAGG - Intronic
1137575860 16:49599926-49599948 GATGTGGGTGCTGGTTACACAGG + Intronic
1137736755 16:50730265-50730287 GTTCTGAATGGAGATTACACAGG + Intronic
1137866929 16:51907410-51907432 GATCTGGGTAGTGGACACACAGG - Intergenic
1138038866 16:53639916-53639938 GATGTGGGTGGTAGTTACACAGG + Intronic
1138188708 16:54996977-54996999 GGTCTGGAAGGTAGGTACACAGG + Intergenic
1138779020 16:59760184-59760206 GCTCTGGATGCTAGTTACAGTGG + Intergenic
1139363786 16:66420348-66420370 GAGCTGGGTGCTGGGTACACAGG - Intergenic
1139389608 16:66598512-66598534 GATTGGGGTGGTGGTTACACAGG - Intergenic
1140707700 16:77646173-77646195 GATCTGGGTGTTGGTTACATAGG + Intergenic
1141017837 16:80466928-80466950 GTTCTGGATGTTGGTGACAATGG + Intergenic
1141161490 16:81632123-81632145 GATCCAGGTGGTGGTTACTCAGG - Intronic
1141520171 16:84573443-84573465 GATCTGGGTGGTGGCTTCAAAGG + Intronic
1141558571 16:84852294-84852316 CATCTGGATGGTAGTTACACGGG - Intronic
1142114644 16:88350315-88350337 GACCTGGATGGTGCCCACACAGG + Intergenic
1142116433 16:88358460-88358482 GATCTGGGTGGTTGGTACATGGG - Intergenic
1142942177 17:3389316-3389338 GATCTGTACAGTGGTCACACGGG + Intergenic
1143356575 17:6333637-6333659 AAACTGGATGGTGGATACATAGG + Intergenic
1143566983 17:7728236-7728258 AATCTGGGTGGTGGTCATACAGG + Intronic
1143844220 17:9760583-9760605 GATCTGCATGGTGGTTACATGGG + Intergenic
1143943617 17:10569488-10569510 AATCTGGATGATGATTACATAGG - Intergenic
1144083790 17:11788427-11788449 GATCTGAGTGGTGATTACATAGG - Intronic
1144533845 17:16067730-16067752 GATCTGGGTGCTGGTAACATGGG + Intronic
1144887668 17:18474718-18474740 GTTCTGGGTGGTGGTCCCACAGG - Intergenic
1145144548 17:20469582-20469604 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145176000 17:20700984-20701006 GTTCTGGGTGGTGGTCCCACAGG + Intergenic
1145243775 17:21254340-21254362 GATTTGGATGGTGGTCACACGGG - Intergenic
1145416138 17:22715425-22715447 GCTCTGGGTGGTGGTGACAGTGG - Intergenic
1145806884 17:27740731-27740753 GTTCTGGGTGGTGGTCACACAGG - Intergenic
1145832029 17:27924170-27924192 GATTTGGGTGGTGGTTCCAGGGG + Intergenic
1145958984 17:28874926-28874948 GACCTGGATGGTGATTACATGGG - Intergenic
1146131166 17:30276783-30276805 GATATGAATGATGGTTACATGGG - Intronic
1146175753 17:30665361-30665383 GGTCTGCATGGTGGATACATGGG - Intergenic
1146234674 17:31147161-31147183 GATCTGGATACTGGTTACACTGG - Intronic
1146349201 17:32081442-32081464 GGTCTGCATGGTGGATACACAGG - Intergenic
1146782674 17:35689045-35689067 AAGCTGGATGATGGGTACACAGG - Intronic
1147012892 17:37465840-37465862 AAGCTGGATGATGGATACACGGG - Intronic
1147560585 17:41506560-41506582 GTCCTGGGTGGTGTTTACACAGG - Intergenic
1148641084 17:49188156-49188178 GATCTAGGTGATGGTGACACAGG + Intergenic
1149448231 17:56730261-56730283 AATCTGGGTGCTGGTTACAAAGG + Intergenic
1149801774 17:59575591-59575613 GATCTGGATGTGGGTTACAAAGG - Intronic
1149844715 17:59999889-59999911 GATCTGGATGTGGGTTACAAAGG + Intergenic
1150299107 17:64033761-64033783 GATCTGGGAGGTGGTTATACTGG + Intergenic
1150383348 17:64738204-64738226 TATCTGGATAGTGGTTACCTGGG + Intergenic
1150646847 17:66983998-66984020 GATCAGGGTGCTGGTTATACGGG + Intronic
1150772896 17:68056563-68056585 TATCTGGATGGTGGTTACCTGGG - Intergenic
1151581796 17:74983474-74983496 GAGCTGGGTGCTGGTTACACAGG - Intergenic
1152756017 17:82087377-82087399 GATGTGGATGGCGGTGACACGGG + Exonic
1152972000 18:170965-170987 GATGTGCATGCTTGTTACACAGG - Intronic
1153270993 18:3321079-3321101 GATCTGGGTGGTGGCTATAGGGG + Intergenic
1153597730 18:6745556-6745578 GTTTTGGATGGTAGTTACATGGG - Intronic
1154378495 18:13828547-13828569 GTTCCCCATGGTGGTTACACGGG - Intergenic
1155097963 18:22578090-22578112 AATCTGGATGGTGGTCACATAGG - Intergenic
1155481539 18:26293732-26293754 GATCGGCATGATGATTACACAGG - Intronic
1156283362 18:35664177-35664199 GATTTGGCTGATGGTTACACAGG - Intronic
1156675896 18:39527045-39527067 GATATGGATTCTGCTTACACAGG + Intergenic
1157089634 18:44622254-44622276 GAACTGGATGCTGGTGACAGGGG + Intergenic
1157164164 18:45342928-45342950 GGTCTGAATAATGGTTACACAGG - Intronic
1157323617 18:46653365-46653387 GATCTGAATACTGGTTGCACAGG + Intronic
1157885936 18:51366383-51366405 GATCTCAGTGGTGGTTACACAGG - Intergenic
1158425105 18:57332553-57332575 GATTGGGATTGTGGTTTCACAGG + Intergenic
1158658343 18:59361132-59361154 AATCTGGATGCTGGTTGCATGGG - Intergenic
1159047921 18:63387114-63387136 GATCTGGGTGGTTGATACAAAGG - Intergenic
1159908011 18:74115995-74116017 GACCTGGATGGTGATCACACAGG + Intronic
1160075053 18:75666941-75666963 GATGTGTATGGTGGTTATTCTGG - Intergenic
1162983217 19:14252518-14252540 GGTCTGCATGGTGGATACACAGG + Intergenic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1164848504 19:31458077-31458099 GATCTAGATGGAAATTACACAGG - Intergenic
1165723651 19:38097494-38097516 GATTTGGATAGTGATTACCCAGG + Intronic
1165840357 19:38785540-38785562 GATTGGGGAGGTGGTTACACAGG + Intergenic
1165986713 19:39775991-39776013 GATCTGGGTGCTGGCTACATGGG + Intergenic
1166203836 19:41256059-41256081 AATCTGGGTGCTGGTTACATGGG + Intronic
1166811759 19:45518636-45518658 GATCTGGGAGGTGGTTTCCCGGG - Intronic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1167084725 19:47301382-47301404 GATCTGAGTGTTGGTTACACAGG - Intronic
1167347165 19:48953883-48953905 TATCTGAATGGTGTTTACATGGG - Intergenic
1167450488 19:49565368-49565390 GATCTGGGTGCTGGTTACATGGG + Intronic
1167554669 19:50186997-50187019 AATTTTGTTGGTGGTTACACAGG + Intergenic
1167731640 19:51261935-51261957 GACCTCAGTGGTGGTTACACTGG - Intronic
1168178117 19:54640300-54640322 GATCTGCAGGTTTGTTACACAGG + Intronic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
924974642 2:161457-161479 GGCCGGGATGGTGGTTCCACTGG + Intergenic
925597882 2:5574200-5574222 GATTGGGGTGATGGTTACACAGG - Intergenic
925819012 2:7780745-7780767 GATCTGGGTGCTGGTTACATGGG - Intergenic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
926336077 2:11863857-11863879 GAGCTGGATGGTGGGGAGACTGG - Intergenic
927183378 2:20464717-20464739 GATCTGCAGGTTTGTTACACAGG - Intergenic
927448527 2:23186776-23186798 AATGTGGTTGGTGGTTACTCTGG + Intergenic
927612511 2:24556034-24556056 GATCTGCAGGTTTGTTACACAGG + Intronic
927659966 2:24984784-24984806 GATCTGAGTGGGGGTTACATAGG + Intergenic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928145710 2:28773107-28773129 GATCTGGATGATGGTTACTCAGG + Intronic
928346774 2:30505610-30505632 TAACTGGCTGCTGGTTACACAGG - Intronic
928991315 2:37235360-37235382 GATTTGGGTGCTGGTTACATGGG - Intronic
929171705 2:38938656-38938678 GATCTGGGTGGTGATCACAGGGG - Intronic
929463788 2:42126721-42126743 AAGCTGGATGGTGGGTACATGGG - Intergenic
929752356 2:44728913-44728935 AATCTGGGTGGTGGTTAGAAGGG + Intronic
930414177 2:51068877-51068899 TATCTGGTTGGTGGTTACACAGG - Intergenic
930625138 2:53688336-53688358 GTTTGAGATGGTGGTTACACAGG - Intronic
931468542 2:62514238-62514260 GATCTGGTTGCTGGTTACACAGG - Intergenic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
932170980 2:69556170-69556192 GTTTTAGATAGTGGTTACACAGG - Intronic
932313198 2:70760699-70760721 GACCTGCATGGTGGTCACACGGG + Intronic
932361440 2:71110985-71111007 GATCTGAATGGTAGGTACATGGG - Intronic
932533257 2:72561878-72561900 TAACTGGATGGTGGTTCCAGTGG - Intronic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
933206766 2:79515169-79515191 CATCAGGATGTTGGTAACACTGG - Intronic
933338619 2:80993191-80993213 GATCTGGAAAGTGGGTACCCTGG - Intergenic
933568879 2:83983810-83983832 GACCTGAGTGGTGATTACACAGG - Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
936055529 2:109259338-109259360 GCTCTGGATGGTGGTCTCAGAGG - Intronic
936339864 2:111621600-111621622 GATCTTGGTGGTGGTTTCATGGG + Intergenic
936645286 2:114362128-114362150 GGTCTGGGCGGTGGTTACACAGG + Intergenic
938480616 2:131658739-131658761 GCTCTGGACTGTGGTTCCACAGG - Intergenic
938602514 2:132856624-132856646 CATCAGGATAATGGTTACACAGG + Intronic
938834460 2:135085858-135085880 GATATGAATGGTGGTAACATGGG - Intronic
938981648 2:136532697-136532719 GAGCTGGGTAGAGGTTACACTGG + Intergenic
940754584 2:157667384-157667406 GATCTAGGTGTTGGTTACATGGG + Intergenic
941251217 2:163165890-163165912 GATCTGGATACTGGTTACATAGG - Intergenic
941541682 2:166794002-166794024 GATCTGGATGGTGGGTGCCCAGG + Intergenic
942124894 2:172814113-172814135 GATCTGGTTGGTAATTACTCCGG + Intronic
942298030 2:174536160-174536182 GATCTACATGGTGATTACACAGG - Intergenic
942560783 2:177216323-177216345 GATCTGGATACTGATTACACAGG - Intronic
942571165 2:177315797-177315819 GATCTGGGTGCTGGTTACATGGG + Intronic
943764444 2:191645625-191645647 GATCTGGGTGTTGGTTACATGGG + Intergenic
944134088 2:196379328-196379350 GATCTGGGTGGCAGTTATACAGG + Intronic
944377568 2:199064903-199064925 TATCTGGATGGTGGTTTCATAGG + Intergenic
944846101 2:203669513-203669535 GATCTGGGTGGTTGTTACCTGGG - Intergenic
945510471 2:210695463-210695485 GATCTGGGTGGTAATTACATGGG - Intergenic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
946293083 2:218760648-218760670 GATTTGGATGTTGGTTACGTGGG + Intergenic
946805443 2:223466432-223466454 TATCTGGATGTTGGTCACATTGG - Intergenic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
947717253 2:232347755-232347777 GATCTGGGTGGCGGTTACTTTGG - Intergenic
1169230655 20:3886868-3886890 GATCTGGGTGGGGGTTACATGGG - Intergenic
1169270052 20:4192260-4192282 GATCTGGGTGGCGGTTGCATGGG + Intergenic
1169281450 20:4270747-4270769 GATTTGGGCGATGGTTACACAGG - Intergenic
1169468923 20:5866366-5866388 GATCAGGATGCTGGCTACACAGG - Intergenic
1169531832 20:6493356-6493378 AATCTGGATGATGGTTACATGGG - Intergenic
1169802690 20:9527100-9527122 GATCTGCATGCTGGTTGCAGAGG - Intronic
1169998389 20:11585545-11585567 GTTCTGGGTGCTGGTTACATGGG + Intergenic
1170040957 20:12038748-12038770 GATCTGGATAGTGATTACATAGG + Intergenic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1170584814 20:17726618-17726640 GATCTGGGTAGTGGGTACATAGG - Intronic
1170832716 20:19857051-19857073 GATCTGGATGGTGGCTACCGGGG - Intergenic
1170950856 20:20934611-20934633 GATCTGAATGGTGATTACATGGG + Intergenic
1172041444 20:32049392-32049414 GATTGGGGTGGTGGTTACACAGG + Intergenic
1172202332 20:33135355-33135377 GATCTGGGTGGTGGTTGCAAGGG - Intergenic
1172422556 20:34829638-34829660 GATCTAGGTGGTGGTAACACAGG - Intergenic
1172440388 20:34961350-34961372 AAGCTGGATGGTAGGTACACAGG - Intergenic
1172562425 20:35901031-35901053 GATCTGCATGGTGGTTATACAGG + Intronic
1172848190 20:37942704-37942726 GCTCTGGATGGTGGTTACACAGG + Intronic
1173030639 20:39356409-39356431 GATCTGGATAGTAATTACATGGG + Intergenic
1173075630 20:39816742-39816764 GTTCTGAGTGGTGGTTACATAGG - Intergenic
1173839480 20:46148015-46148037 GACATGGATGGTGGTCACACAGG - Intergenic
1174530095 20:51204881-51204903 GATCATGGTGGTGGTTACATGGG - Intergenic
1174594441 20:51672517-51672539 GCTCTGGATGGTGGATTCAGAGG - Intronic
1174726888 20:52871838-52871860 AATCTGCATAGTGGTTACCCAGG + Intergenic
1174771860 20:53307712-53307734 GATCTGGCGGGTGGTTAAATGGG - Intronic
1174846270 20:53946187-53946209 GATTTGGATGGTGGTTTTAGGGG - Intronic
1175230128 20:57468631-57468653 GATCTGGGTGCTGCTTACCCAGG - Intergenic
1175273849 20:57754167-57754189 GTTCTGGGAGATGGTTACACAGG - Intergenic
1175517114 20:59576921-59576943 GAGCTGGTTGGTGGTTACAAAGG + Intergenic
1176292743 21:5054979-5055001 GATGTGGATGGTGGGTAGAAGGG - Intergenic
1176898770 21:14415779-14415801 GATCAGTGTGGTGGTTACACAGG + Intergenic
1178685376 21:34706517-34706539 GATCTGCACGGTGGCTACACGGG - Intronic
1178691001 21:34749843-34749865 GATCTGGGTAGTGGTTACATGGG - Intergenic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1178912376 21:36685806-36685828 GATCTGGGTGGTGGTTATATGGG - Intergenic
1178990233 21:37348079-37348101 GATCTGACTGGTGGTTATGCAGG - Intergenic
1179152252 21:38819004-38819026 CATCTGGATGGTTATTACATGGG - Intronic
1179161007 21:38899176-38899198 GATTGGGATGATGGTTACACAGG + Intergenic
1179248433 21:39653035-39653057 GATCTCGGTGGTGATTACATGGG - Intronic
1179558768 21:42198886-42198908 GATCTGGATGGTGAATGTACAGG + Intergenic
1179864517 21:44208671-44208693 GATGTGGATGGTGGGTAGAAGGG + Intergenic
1181568705 22:23754789-23754811 GATCTGGGTGGAGGTTGCAGGGG - Intergenic
1181716104 22:24730592-24730614 TATCTGGATGATGGGTATACAGG + Intronic
1181953143 22:26569286-26569308 TGTCAGGATGGTGGTTACCCCGG + Intronic
1182064669 22:27421817-27421839 GCGCTGGCTGGTGGTTACATGGG - Intergenic
1182347487 22:29676939-29676961 GATCTGGGTGCTGGGTACATGGG - Intronic
1182595837 22:31419645-31419667 GATTGGTTTGGTGGTTACACAGG + Intronic
1182808065 22:33092498-33092520 GATGTGCATGTTTGTTACACAGG + Intergenic
1183169667 22:36177966-36177988 GATCTGGAGGGCGTTTTCACTGG - Intergenic
1183497969 22:38160949-38160971 GATTCGAGTGGTGGTTACACAGG + Intronic
1183526955 22:38328771-38328793 GATCTGGATGGTGGTTGGCTGGG + Intronic
1183600391 22:38836660-38836682 GATCTGGCTGGCGCTTTCACAGG + Intronic
1184443485 22:44533424-44533446 GATCTGGGTGCTGGATACATGGG + Intergenic
1184558000 22:45243595-45243617 GATCTGGGGGCTGGTTACACGGG + Intergenic
1184796210 22:46734557-46734579 GATCCGGGTGATGTTTACACAGG + Intronic
949458898 3:4269060-4269082 GATCTGGGTGGTGTTTCCAGAGG - Intronic
949625216 3:5858123-5858145 GATCTGGGTGGTGGTTATATAGG + Intergenic
949864740 3:8538161-8538183 GATCTTGAAGGTGGCTGCACGGG - Intronic
950634616 3:14306079-14306101 GATCCGGGTGGTGGCTCCACGGG + Intergenic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
950762795 3:15248592-15248614 GATCTGGGTGATGGTTACCCAGG + Intronic
951095362 3:18623457-18623479 AATCTTGATGGTGGTTAACCAGG + Intergenic
951425301 3:22537775-22537797 GATCTGGGTGGTGACTACACAGG + Intergenic
951520589 3:23607452-23607474 GCTTTGGGTGGTGGTTACACAGG - Intergenic
951597127 3:24330450-24330472 GATCTGAATGGTGGGTACATGGG - Intronic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
952329676 3:32352749-32352771 GATTTGGATGCTGGTTACACAGG + Intronic
952334233 3:32391442-32391464 GATCTGGGCGACGGTTACACAGG + Intergenic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952470577 3:33646791-33646813 GATCTGGATACTGGTTATACTGG - Intronic
952476557 3:33717190-33717212 GGTCTGGGTAGTGTTTACACAGG + Intronic
952493981 3:33900004-33900026 GATATGGGTGGTGATTCCACAGG - Intergenic
952800265 3:37284229-37284251 GATGTGCAGGGTTGTTACACTGG + Intronic
953051277 3:39346305-39346327 GATCTGAGTAGTGGTTACACAGG + Intergenic
953111001 3:39938079-39938101 GATCTGTGTGCTGGTTACACAGG - Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953534033 3:43763770-43763792 CATCTGGGTGCTGGTTACATAGG + Intergenic
953603219 3:44387954-44387976 AATCTGGGTGGAGGTTACATGGG - Intronic
953648843 3:44781198-44781220 GATCTGGTTAGTGGTTATACAGG - Intronic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
954165850 3:48757334-48757356 GATCTAGGAGGTGGTTATACAGG - Intronic
955301119 3:57780548-57780570 GATCTGGGTGGTAGTTACAAGGG + Intronic
955386197 3:58482611-58482633 TATCTGCATGTTGGTTACAAGGG + Intergenic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
956006767 3:64788174-64788196 AAGCTGGATGATGGGTACACAGG + Intergenic
956473259 3:69592065-69592087 GATCTGGTTAGTTGTTACAATGG - Intergenic
956729158 3:72180805-72180827 GAGCTGGGTGGTGGTTGCATAGG + Intergenic
956822616 3:72967569-72967591 GATCGGGACGGTAGTTCCACTGG - Exonic
957224965 3:77431616-77431638 GAGCTGGATGCTGGGAACACAGG - Intronic
957433077 3:80138943-80138965 CATGTGAATGGTTGTTACACAGG - Intergenic
959882996 3:111467953-111467975 GATGTGCAGGGTTGTTACACAGG + Intronic
960229909 3:115213412-115213434 GATCTTGATGTTGGCTGCACAGG - Intergenic
961035005 3:123636099-123636121 GATCCGGGTAGAGGTTACACAGG + Intronic
961072771 3:123950699-123950721 GATCTAGGTGGTGGCTACAGGGG + Intronic
961537997 3:127581515-127581537 GATCCAGGTGGTGGGTACACAGG + Intronic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962056592 3:131878533-131878555 AATCTGGATGCTGGTTTTACAGG + Intronic
962127618 3:132638299-132638321 AATTTGGATGATGGATACACAGG + Intronic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
962557483 3:136570132-136570154 CATCTTGGTTGTGGTTACACAGG - Intronic
964103117 3:153010261-153010283 TATTTTGATGGTGGTTACTCAGG + Intergenic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
965657422 3:171003021-171003043 GATCTGGGTGCTAGTTACATAGG - Intronic
966450548 3:180055462-180055484 GAGCTGGACGCTGGTTACACAGG + Intergenic
966681768 3:182649179-182649201 GATTGGGGTGGTGGTTACATAGG + Intergenic
966951988 3:184828822-184828844 TATCTGGATTCTGGTTACACAGG - Intronic
967672301 3:192251895-192251917 TATCTGGATAGTGGTTACACAGG + Intronic
967890029 3:194358271-194358293 GGTCTAGATGCTGATTACACAGG + Exonic
968854882 4:3112353-3112375 GACCTGGGTGGCGGTTACAAGGG - Intronic
969076294 4:4580896-4580918 GATCTGAGTGGTGGTTCCAAGGG - Intergenic
969095455 4:4729255-4729277 GAACTGGATGGGGCTTAGACAGG - Intergenic
969710823 4:8842086-8842108 GATGTTGATGGTGGTGACAGTGG + Intergenic
969713264 4:8856579-8856601 GATGCGGGTGGTGGCTACACGGG + Intronic
970488806 4:16551134-16551156 ATTCTGAATGGTGGTTACTCTGG + Intronic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
971248397 4:24950825-24950847 GTTCTGAATGGTGGCTACACAGG - Intronic
972150863 4:36089046-36089068 GTTTTGGATGGTGGTCACATGGG - Intronic
972456176 4:39257908-39257930 GATCTGGGTGGGGGGTACACAGG - Intronic
972578478 4:40373789-40373811 GACCCGGATGGTGGTTACGTAGG + Intergenic
972593346 4:40508753-40508775 AATCTGGGTGGTGGTTCCACAGG + Intronic
973076195 4:45929230-45929252 GCTCTGCATGGAGGTGACACTGG + Intergenic
973639583 4:52889713-52889735 GGTCTGGGTACTGGTTACACTGG - Intronic
974539075 4:63209719-63209741 CATGTGGATGTTGGTTACAAGGG - Intergenic
974984216 4:68999113-68999135 GATCTGGATAGTGGTGATAGTGG + Intergenic
975540699 4:75507971-75507993 GATCTGGGTAGTGGTTACAAAGG + Intronic
975547054 4:75570556-75570578 GGTCTGGGTGGTGGTCACAGGGG + Intergenic
975558726 4:75689972-75689994 GATCTGTGTGCTGGTTACATGGG + Intronic
975865514 4:78720011-78720033 AATCTGGATGATGGGTATACAGG + Intergenic
976123316 4:81806297-81806319 GATATGGATGGTGAATACATGGG + Intronic
976603959 4:86965033-86965055 GATGTGGAGGGTGGTTATAATGG + Intronic
976733427 4:88286409-88286431 GATCTGGGTGCTGGATACAAAGG - Intergenic
977734954 4:100403110-100403132 CATCTGGAGGTTGGTTACATGGG + Intronic
977790881 4:101101719-101101741 GATCTGGGTAGTGGTTTCATGGG - Intronic
978060580 4:104332399-104332421 GTTCTGGGTTGTGGTTACATAGG - Intergenic
978122586 4:105098353-105098375 GATCAGGATGGTGGTTGCTGAGG + Intergenic
978779066 4:112530813-112530835 GATTGTGATGGTGGTTACAAAGG + Intergenic
979482329 4:121234447-121234469 GATGTGGGTGCTGGTTACGCTGG - Intergenic
979514653 4:121593828-121593850 GATCTGGATTGTAGTTATATGGG + Intergenic
980057009 4:128087508-128087530 AATCTAGATGGTGGCTAGACAGG - Intronic
980342008 4:131562786-131562808 GATATGGAAGTTGGTTACATGGG - Intergenic
981305589 4:143243871-143243893 TATCTGTGTGGTAGTTACACAGG - Intergenic
981590812 4:146358455-146358477 GATTTGGGTGATGGTTACCCAGG - Intronic
981720236 4:147794491-147794513 GCTCTGGATGCTACTTACACTGG - Intronic
981807422 4:148732829-148732851 GACCTGGGTGTTGGTTACACAGG - Intergenic
981910557 4:149976415-149976437 GGTCATGATGATGGTTACACAGG + Intergenic
982041474 4:151401227-151401249 GATCTGGGTGCTGATTACATGGG + Intergenic
982130682 4:152226199-152226221 GATTAGGGTGTTGGTTACACAGG - Intergenic
982205085 4:152991646-152991668 GATCTGGATGCTGATTACTTGGG + Intergenic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
983600972 4:169527214-169527236 TATCTGAATGGTGTTTTCACAGG - Intronic
983772194 4:171564842-171564864 TATCTGGGTGCTGGTAACACAGG + Intergenic
984043148 4:174762809-174762831 GATCTGGGTAGTAGTAACACAGG - Intronic
984818778 4:183861892-183861914 CACCTGGATGGTGGTTACGTGGG - Intronic
985324410 4:188751871-188751893 CATCTGCATGGTAGTTACTCTGG + Intergenic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
987675390 5:21066805-21066827 GATTTGGATGCTGATTACACAGG + Intergenic
988877257 5:35460203-35460225 GAGGAGGATGGTGGTGACACTGG + Intergenic
989129354 5:38090601-38090623 GATCAGGTTGATGGTTACACAGG + Intergenic
989227306 5:39044179-39044201 GATCTGGGTGCTGGTTTCACAGG + Intronic
989237814 5:39169815-39169837 GGTTTTGATGGTGGTTATACTGG + Intronic
990104389 5:52238809-52238831 GATTTGGGTAGTGGTTACAAGGG - Intergenic
990178344 5:53132254-53132276 GATCTGTCTGGAGGTTACACAGG - Intergenic
990230397 5:53706797-53706819 GATGTGCATGTTTGTTACACAGG + Intergenic
990772438 5:59263883-59263905 AATCTGGGTGGTGATTACAGGGG + Intronic
990895271 5:60693046-60693068 GATCTGAATGTTGGTTACATGGG + Intronic
991249785 5:64546854-64546876 TGTCTGAATGGTGGCTACACAGG - Intronic
991426296 5:66495530-66495552 GCTCTGAATGGTGGTTATAAGGG + Intergenic
991446992 5:66710939-66710961 AATATGGGTGCTGGTTACACGGG - Intronic
991588318 5:68222240-68222262 GGTAGGGGTGGTGGTTACACAGG + Intronic
992133090 5:73714741-73714763 GCTCTGGGTGATGGTGACACAGG - Intronic
992171994 5:74112000-74112022 GATCTGGGTGGTGGTTGTATGGG + Intergenic
992383190 5:76258758-76258780 GATTTGGGTGGTGGTTACATGGG - Intronic
993029746 5:82692185-82692207 AATCTAGGTGGTGGTTACCCAGG - Intergenic
993642704 5:90424928-90424950 GATCTGCATGGTGGTTACCTGGG + Intergenic
994513325 5:100736722-100736744 GATCTGGATGGTGAATTCATTGG - Intergenic
994621930 5:102173963-102173985 AATCTTGATGGTGATTACATGGG + Intergenic
995404299 5:111776841-111776863 GATCTGAATGGTGTTTACAAAGG + Intronic
995460618 5:112399373-112399395 AACCTGGATGGTGATTACACAGG - Intronic
995664839 5:114530250-114530272 GATTGAGATGGTGGTTACATGGG + Intergenic
995745365 5:115396576-115396598 AAACTGGATGATGGGTACACGGG + Intergenic
996340262 5:122429970-122429992 GATCTGGCTGATGGTGACAGTGG - Intronic
997047697 5:130339164-130339186 GATCTACATGGTAGTTACACTGG - Intergenic
997138674 5:131354310-131354332 GACCTGGGTGGTAGCTACACAGG - Intronic
997259965 5:132458194-132458216 GATTTGGATGCTGGTTACTCGGG - Intronic
997489864 5:134264668-134264690 GCTTTGGGTGGTGGTTACATGGG + Intergenic
997558899 5:134827146-134827168 GATCTGGGTAGTGACTACACTGG - Intronic
997566359 5:134890000-134890022 GATCAGGATGGTAGTTACTGAGG + Intronic
997705726 5:135950496-135950518 GATTTGGGTGCTGATTACACAGG + Intronic
997927756 5:138046466-138046488 TAATTGGATGGTGGCTACACAGG + Intronic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998244382 5:140484938-140484960 CCTCTGGGTGCTGGTTACACAGG + Intronic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
998658587 5:144209502-144209524 GCTCTAGATGGTGGGTACAAAGG - Intronic
999509321 5:152231649-152231671 GATTGGGATGGTGGTTACATGGG - Intergenic
999547982 5:152652114-152652136 AATCTGGGTGGTGATTACACAGG - Intergenic
999563181 5:152827552-152827574 GATCTGGTTGCTGGTGACATTGG - Intergenic
999843320 5:155452028-155452050 GGAGAGGATGGTGGTTACACAGG + Intergenic
999949567 5:156634369-156634391 GATGTGCAGGTTGGTTACACAGG - Intronic
1000422198 5:161051000-161051022 GATCTGGGTAATGGTTACATGGG + Intergenic
1000721796 5:164717403-164717425 GATCTGGATGCTAGTTACACTGG - Intergenic
1000729715 5:164818388-164818410 AATCTAGGTGGTGATTACACAGG + Intergenic
1000847429 5:166299321-166299343 GTTCTGGGTGGTGGTTACGAGGG + Intergenic
1001444035 5:171769366-171769388 GAACTGGGTGATGGTTACAAGGG + Intergenic
1002108151 5:176890497-176890519 AAACTGGATGGAGGTTAAACTGG + Intronic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1003667394 6:8124222-8124244 GATCTGGGTGCTGGTTACGCAGG - Intergenic
1004077360 6:12356761-12356783 GATCTGGGTTGTGGCTACATGGG + Intergenic
1004101027 6:12611566-12611588 GCTTTGGATGGAGGTTACAAGGG + Intergenic
1004323965 6:14656742-14656764 GTTCTGGGTGATGGTTACTCGGG - Intergenic
1004868276 6:19875868-19875890 GATATGGGTGCTGGCTACACAGG - Intergenic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1005163015 6:22887016-22887038 AATCTGAGTGGTGATTACACAGG - Intergenic
1005339310 6:24828588-24828610 GATCTAAATGGCAGTTACACAGG - Intronic
1006010236 6:31036823-31036845 GATCTGGGTGGTGATTACAAGGG + Intergenic
1006669237 6:35719379-35719401 GATCTAGGTGATGGTTACATGGG + Intronic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1006947189 6:37792524-37792546 GATGTGGAGGGCGGTTACACAGG - Intergenic
1006995695 6:38257876-38257898 GATCTGAGTGGTAGTTACACGGG + Intronic
1007082233 6:39115793-39115815 CATCTGGGTGGTAGTTACACAGG - Intergenic
1007550327 6:42724485-42724507 GATCTAGACGGTGGTTGCCCAGG - Intergenic
1008532347 6:52474926-52474948 AACCTGGATGGTGGTTATATGGG + Intronic
1008778901 6:55077426-55077448 GATCTGCAGGTTTGTTACACAGG - Intergenic
1009950518 6:70390081-70390103 GACTTGGATGGTGGTTAAATGGG + Intergenic
1010046339 6:71448440-71448462 GATCTGAGTGTTGGTTACACAGG + Intergenic
1010082901 6:71885356-71885378 GATGTGGAGGGTTGTTACATAGG - Intergenic
1010244659 6:73652000-73652022 AATCTGGGTGCTGGTTACATGGG + Intronic
1011368526 6:86607048-86607070 GAGAAGGATGGTGGTTACAAGGG + Intergenic
1011838521 6:91465703-91465725 GATCTAGACGGTGGGTATACAGG - Intergenic
1011926899 6:92656470-92656492 GGCCTGGATGGTGTTTACATGGG + Intergenic
1012330693 6:97982043-97982065 GAGCAGAATGGTGGTTACATGGG - Intergenic
1012491065 6:99782861-99782883 GATTTGGATGTTCGATACACAGG - Intergenic
1013313531 6:108919970-108919992 GAGCTGGATGATGGGTACACAGG - Intronic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1013471632 6:110471735-110471757 GATTTGGGTGGGGGTAACACAGG + Intronic
1013601898 6:111712798-111712820 GACCTGGCTGGTGGCCACACAGG + Intronic
1014164165 6:118204727-118204749 GATTTGGATACTGGTTACAGAGG - Intronic
1014264996 6:119267605-119267627 GATCTGGATGCTGCTTACTATGG - Intronic
1015065182 6:129016726-129016748 GATCTATATGATGGTTACATAGG + Intronic
1015767204 6:136731188-136731210 GATCTAGGTGCTGGTTACTCTGG + Intronic
1015807511 6:137126347-137126369 GATCTGGGCAGTGGTTACACAGG + Intergenic
1015948192 6:138524314-138524336 GATCTGGGTGCTGGTTACATGGG - Intronic
1016432207 6:143997830-143997852 GCTCTTGAATGTGGTTACACAGG + Intronic
1016537083 6:145119549-145119571 GATCTGAGTAGTGCTTACACAGG - Intergenic
1016755730 6:147684043-147684065 GATCTGGATGGTGGTGACATGGG - Intronic
1018240874 6:161773146-161773168 GATCCAGGTGGTGGTTACAGAGG + Intronic
1018578793 6:165288891-165288913 GATGTGGAGGTTTGTTACACAGG - Intronic
1019619489 7:1983690-1983712 GATCTGGACGGTGGATACGTAGG - Intronic
1020089541 7:5331080-5331102 CCTATGGATGGTGCTTACACTGG + Intronic
1020658717 7:10957156-10957178 GATGTGGATGGTGTTTATAAGGG + Intergenic
1020779883 7:12503538-12503560 AAACTGGATGATGGTTACATGGG + Intergenic
1020811983 7:12859052-12859074 GATCTGTATGGTGGTTACATAGG - Intergenic
1021154587 7:17194449-17194471 GATCTGGGTGCTGGTTACATAGG + Intergenic
1021378147 7:19934268-19934290 GATTAGGTTGATGGTTACACTGG + Intergenic
1021634989 7:22683240-22683262 GATTTGGGTAGTGGTTACACAGG + Intergenic
1021826275 7:24555397-24555419 CACCTTGCTGGTGGTTACACAGG + Intergenic
1021843836 7:24745157-24745179 CACCTGGATAGTGGTTAAACAGG - Intronic
1021866089 7:24959589-24959611 GTTCTGGACGCTGGTTACACAGG + Intronic
1022015911 7:26348098-26348120 GATCTGAGTGGTAGTTACACAGG - Intronic
1022194865 7:28054982-28055004 GATCTGGATGGTGTTTACCAGGG + Intronic
1022786896 7:33647322-33647344 GCTGTGGGTGCTGGTTACACGGG - Intergenic
1022896441 7:34754468-34754490 GATTTGGGTGCTAGTTACACTGG - Intronic
1022948316 7:35310410-35310432 GACCTGGGAGATGGTTACACTGG + Intergenic
1023667469 7:42539431-42539453 GATATGGGTGGGGGTTACATGGG + Intergenic
1023713474 7:43019324-43019346 GGTCTGGCTGCTGGTTACAGGGG + Intergenic
1023956266 7:44889332-44889354 GATCTGGAAGGTAGTTAGACTGG + Intergenic
1024039188 7:45536591-45536613 GATTTGAGTGGTGGTTACATGGG + Intergenic
1024336021 7:48205941-48205963 AATCATGATGGTGGTTACACAGG - Intronic
1024358220 7:48440201-48440223 AATCTGGGTGGTGGTTACGCAGG - Intronic
1025726206 7:64063895-64063917 GCTCTGGGTGGTGGTGACAATGG - Intronic
1026016458 7:66674851-66674873 GATCTAGGTGGTGGTTGGACGGG + Intronic
1026176211 7:67999730-67999752 GACCTAAATGGTGATTACACTGG - Intergenic
1026394017 7:69933039-69933061 GATCTGCACGTTGGTTACACTGG + Intronic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1026659453 7:72287106-72287128 AATCTGGGTGGTGGGTACATGGG - Intronic
1026814818 7:73502409-73502431 AACCTGTATGGTGGGTACACAGG - Intronic
1026973608 7:74482605-74482627 GATCTGGGTGCTGGTTACCTGGG - Intronic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1028846668 7:95488788-95488810 CATCTGGATGCTGGTTACATAGG - Intronic
1029014640 7:97302951-97302973 TATCTGGATGCTGGTTACATGGG - Intergenic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1029593320 7:101521708-101521730 AATGTGGGTGCTGGTTACACAGG - Intronic
1029827839 7:103219594-103219616 GATATGCATGTTTGTTACACAGG + Intergenic
1029891972 7:103939949-103939971 GAACTGGATGAAGGTTACATGGG + Intronic
1029908070 7:104112354-104112376 GATCTGAGTAGTGGTTACACTGG - Intergenic
1030032162 7:105379620-105379642 GATCTACATGGTCGTTACAGGGG + Intronic
1030037561 7:105420976-105420998 GATTTAAATGGTGGTTACATGGG - Intergenic
1030154857 7:106444274-106444296 AATATGGATGATGGTTACAGGGG + Intergenic
1030858921 7:114598833-114598855 AATCTGAATGGTGGTTCCATGGG - Intronic
1031440140 7:121784575-121784597 GATCTGGATAGTGGATACGTTGG + Intergenic
1031509284 7:122628348-122628370 GATCTGGGAGGTGGCTACACAGG + Intronic
1031938107 7:127757027-127757049 GATTTGGGTGGTAGATACACTGG - Intronic
1032597849 7:133259923-133259945 CAGCTGGACAGTGGTTACACAGG - Intronic
1032790628 7:135239972-135239994 GATGTGGATAGTAGTTACACAGG - Intronic
1033409334 7:141102959-141102981 GATCCAGATGGTGGTTCCAGAGG - Intronic
1033803430 7:144927426-144927448 GATCTGGATAGTGGTTACATGGG - Intergenic
1035328174 7:158078392-158078414 GTTCTGTATGTTGGTAACACAGG + Intronic
1035567991 8:654452-654474 GATCTGGGTGTGGGTTACAGGGG + Intronic
1036826970 8:11984881-11984903 GGGCAGGATGCTGGTTACACAGG - Intergenic
1037914979 8:22767672-22767694 GATCTCGGTGGTGGTTACTTGGG + Intronic
1038457741 8:27688866-27688888 GACCTGGGTGAAGGTTACACAGG + Intergenic
1038606014 8:29005645-29005667 GATCTGGAGGGTGGTTATATGGG - Intronic
1039083530 8:33757445-33757467 GATATGGATGGAGGTTGCATAGG + Intergenic
1039307306 8:36276529-36276551 GATCTGGGTGGTGGTTATGAGGG + Intergenic
1039581350 8:38669331-38669353 GATGTGCATGTTTGTTACACAGG - Intergenic
1039703705 8:39986628-39986650 GATCTGGAAGGCTGTTACAGAGG - Intronic
1039775160 8:40728766-40728788 GTTCTGAATGGTTATTACACAGG - Intronic
1040617535 8:49053232-49053254 GATTGGAATGGTGGTTACACAGG + Intergenic
1041930017 8:63276525-63276547 AATCTGGGTGGTAGTTACACAGG - Intergenic
1042139588 8:65664493-65664515 GATCTAGGTGGTGGTTACAAAGG + Intronic
1042369810 8:67978298-67978320 GCTCTGGATGTTAGTTACACAGG - Intronic
1043620417 8:82184438-82184460 GATTTGGATGCTGGTTACATAGG + Intergenic
1043836165 8:85049459-85049481 TATCTGGAAGGAGGCTACACAGG - Intergenic
1043964432 8:86457045-86457067 GATTGTAATGGTGGTTACACAGG + Intronic
1044271047 8:90244413-90244435 GAACTAGATGATGATTACACAGG + Intergenic
1044593254 8:93934360-93934382 TATTTTGATGGTGGTTATACAGG - Intergenic
1044902587 8:96963757-96963779 GATCTGGGTAGCAGTTACACAGG - Intronic
1046942690 8:119946402-119946424 TATTTGGGTGGTGGTTCCACAGG - Intronic
1047359793 8:124158679-124158701 GATTTGAATGCTGGCTACACAGG - Intergenic
1047560531 8:125983252-125983274 GATCAGGGTGGTGGTTACTGAGG - Intergenic
1047887563 8:129268799-129268821 GATATGGATGCTGGTTATACAGG - Intergenic
1049296212 8:141841030-141841052 GATGTGGATGGGGGTCACAGAGG - Intergenic
1049429379 8:142552195-142552217 GTGCTGGGTGGTGGTTACAAAGG - Intergenic
1050656181 9:7831248-7831270 GAAATGGATGGTGGTTACACAGG - Intronic
1051115235 9:13686797-13686819 GATCTAGGTGGTGCTTACACAGG + Intergenic
1051776730 9:20642475-20642497 CATCTGGATGGTGGTTAAATGGG + Intergenic
1051811891 9:21058418-21058440 GATATGCATGTTTGTTACACAGG - Intergenic
1052082415 9:24223513-24223535 CACCTGTGTGGTGGTTACACAGG + Intergenic
1052322980 9:27188263-27188285 AATCTGAGTGGTGGTTACATGGG + Intronic
1052804208 9:32998356-32998378 AATCTGGATGGTGGTCACATAGG + Intronic
1053241910 9:36502750-36502772 GATCCAGATCATGGTTACACAGG - Intergenic
1053242588 9:36508188-36508210 GATCTGTGTGGTGGTTACATGGG + Intergenic
1053509406 9:38674848-38674870 GACCTAGGTGATGGTTACACAGG + Intergenic
1054705671 9:68459286-68459308 GATCCAGATGGTAGTTACACGGG - Intronic
1054824511 9:69559332-69559354 GATCTGGATGGTATTTGCATGGG - Intronic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1055028046 9:71743330-71743352 GACCTGGGTGGTGGCTACACAGG + Intronic
1055326115 9:75131903-75131925 GATCTGGGTGTTGGTTACGTGGG - Intronic
1055468214 9:76586224-76586246 TATCTTGGTGGTGTTTACACAGG - Intergenic
1056082303 9:83108144-83108166 GATCTGGGTAGTGTTTACATGGG + Intergenic
1057531589 9:95851900-95851922 GCTCCAGATGGTGGTTACACAGG + Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1057870884 9:98716342-98716364 GTTCTTGATGGTGATTACATGGG - Intergenic
1057936682 9:99245762-99245784 GGCCTGAGTGGTGGTTACACAGG - Intergenic
1058040215 9:100294413-100294435 GATCTGGTTTGTGCTTGCACAGG + Intronic
1058580633 9:106452767-106452789 TATCTGGAAAGTGGTTACATGGG - Intergenic
1059022663 9:110593558-110593580 GATGTGGAGGTTTGTTACACAGG + Intergenic
1059837063 9:118167237-118167259 AATCTGTGTGGTGGTTACATGGG - Intergenic
1059865606 9:118510807-118510829 GATTTTGGTGGTGCTTACACAGG - Intergenic
1059895985 9:118866021-118866043 GATTGGGATGGTGGTAACAAGGG + Intergenic
1060070799 9:120545458-120545480 GATCTGGATGGTAGCTCCACAGG + Intronic
1060672525 9:125482236-125482258 GATCTGGGTGCTGATTACATGGG - Intronic
1061524524 9:131147857-131147879 GATCTGGATGCTAGTTACCAAGG - Intronic
1062011272 9:134268178-134268200 GATCTGCTTGGTGGGGACACTGG - Intergenic
1062672598 9:137720234-137720256 GGTCTGGTTGGTGGCTACACAGG - Intronic
1062676387 9:137747746-137747768 GATCTGGGTGGTGGCCACACAGG - Intronic
1186521470 X:10210382-10210404 GTCCTGGGTGCTGGTTACACAGG - Intronic
1186639755 X:11443050-11443072 GATTTGGGTGGTCGTTATACAGG - Intronic
1186691342 X:11979054-11979076 TATCTGGGTGGTGGGTACATGGG - Intergenic
1187312362 X:18157539-18157561 GATCTGGGTAGTTGTCACACAGG - Intergenic
1187387019 X:18858223-18858245 GATCTGGGTGCTGGTTACGTGGG - Intergenic
1187428258 X:19198115-19198137 GATTGGTGTGGTGGTTACACTGG - Intergenic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1187499793 X:19830301-19830323 GATCTGGGTGGTGGTTATAGAGG + Intronic
1187687370 X:21828914-21828936 GAGATGGGTGGTGGTGACACAGG + Intergenic
1187947605 X:24441638-24441660 GATCTGGGTGCTGGCTACCCAGG + Intergenic
1188099448 X:26065401-26065423 GCTTTGGGTGGTGGTTACATGGG + Intergenic
1189157941 X:38778768-38778790 GATTGGGATAGTGGTTACAGAGG - Intergenic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189302482 X:39962115-39962137 GATTTGAATGCTGGTTACACGGG - Intergenic
1189327151 X:40119729-40119751 GATCTGGAAGCTGGTTACATGGG + Intronic
1189488638 X:41452271-41452293 GATTGGGGTGGTGGTTACACAGG + Intronic
1190146559 X:47896664-47896686 AATAGGGGTGGTGGTTACACTGG - Intronic
1190437182 X:50437265-50437287 GATCTGGATGGTGTTTCAACAGG - Intronic
1190524924 X:51319361-51319383 GTTTTGGGTTGTGGTTACACAGG + Intergenic
1190545305 X:51519531-51519553 GTTTTGGGTTGTGGTTACACAGG - Intergenic
1190816182 X:53931734-53931756 GATAGGGATGTGGGTTACACAGG + Intergenic
1191590385 X:62876725-62876747 GATGTGCATGCTTGTTACACAGG - Intergenic
1191767328 X:64712420-64712442 AAACTGGATGGTGAATACACAGG - Intergenic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1192451748 X:71249292-71249314 AAGCTGGCTGGTGGATACACAGG - Intronic
1192506762 X:71690451-71690473 GATCTGGATGGCGGTTACATGGG + Intergenic
1192513176 X:71738589-71738611 GATCTGGATGGCGGTTACATGGG - Intergenic
1192513521 X:71742924-71742946 GATCTGGATGGCGGTTACATGGG + Intergenic
1192519935 X:71791095-71791117 GATCTGGATGGCGGTTACATGGG - Intergenic
1192566107 X:72164837-72164859 GACCTGCATGGTAGTCACACTGG + Intergenic
1192851637 X:74962616-74962638 AATCTGGATGAGGGGTACACAGG - Intergenic
1194430743 X:93801079-93801101 GATGGGGATGGTGGTTACATGGG - Intergenic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195588328 X:106592794-106592816 GATCTGGATGTTGGTTCCATGGG - Intergenic
1195760525 X:108241037-108241059 GATCTGGATGGTGGGTACTTGGG + Intronic
1195866846 X:109441662-109441684 GTGCTGCATGGTGGTTAAACAGG - Intronic
1195922179 X:109994747-109994769 GATCTGGGTGGTGATTACAGTGG + Intergenic
1196428822 X:115600453-115600475 TTGCTGGATGTTGGTTACACAGG - Intronic
1196651518 X:118172992-118173014 GATGTGGGTAGTGGTTACATGGG - Intergenic
1196776419 X:119342124-119342146 AATCAGGATGTTGGTTACATTGG + Intergenic
1198236570 X:134741039-134741061 GATCTGGGTATTGGTTACACGGG + Intronic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198327129 X:135585189-135585211 GATCGGGGTGGTGGCTACTCAGG + Intergenic
1198501316 X:137250774-137250796 AAACTGGATGGTGATTACAAAGG + Intergenic
1198562258 X:137863785-137863807 CATTTGGGTGCTGGTTACACTGG - Intergenic
1198814217 X:140570166-140570188 GCCCTGGGTGTTGGTTACACAGG + Intergenic
1199758299 X:150885226-150885248 GACCTGGTCGGTGGTGACACAGG + Intronic
1199794969 X:151185589-151185611 GATATGTGTGGTGGTTACATGGG - Intergenic
1199880622 X:151971942-151971964 GATCTAGGTGTTGGTTACACGGG + Intronic
1200313725 X:155107988-155108010 GATCTGGGTTGTGGTTGCATAGG - Intronic
1200366293 X:155668479-155668501 GATCTATATAGGGGTTACACAGG + Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic
1202299320 Y:23394926-23394948 GATTTGGGTAGTGGTTATACTGG - Intergenic
1202571489 Y:26275672-26275694 GATTTGGGTAGTGGTTATACTGG + Intergenic