ID: 964651763

View in Genome Browser
Species Human (GRCh38)
Location 3:159019414-159019436
Sequence GATCTGGATGGTGGTTACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 822
Summary {0: 2, 1: 10, 2: 55, 3: 202, 4: 553}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964651763_964651768 -7 Left 964651763 3:159019414-159019436 CCTGTGTAACCACCATCCAGATC 0: 2
1: 10
2: 55
3: 202
4: 553
Right 964651768 3:159019430-159019452 CCAGATCAAGGAACTTCAGAAGG 0: 1
1: 0
2: 0
3: 18
4: 181
964651763_964651769 -6 Left 964651763 3:159019414-159019436 CCTGTGTAACCACCATCCAGATC 0: 2
1: 10
2: 55
3: 202
4: 553
Right 964651769 3:159019431-159019453 CAGATCAAGGAACTTCAGAAGGG 0: 1
1: 0
2: 1
3: 13
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964651763 Original CRISPR GATCTGGATGGTGGTTACAC AGG (reversed) Intronic