ID: 964653728

View in Genome Browser
Species Human (GRCh38)
Location 3:159043126-159043148
Sequence CTGAGAATAAGGGGCAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 199}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964653722_964653728 -9 Left 964653722 3:159043112-159043134 CCAGGTCTGAAGGCCTGAGAATA 0: 2
1: 0
2: 19
3: 132
4: 422
Right 964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG 0: 1
1: 0
2: 1
3: 12
4: 199
964653719_964653728 17 Left 964653719 3:159043086-159043108 CCAGAGTTGATGGTGTAGATCTC 0: 1
1: 0
2: 0
3: 9
4: 76
Right 964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG 0: 1
1: 0
2: 1
3: 12
4: 199
964653718_964653728 25 Left 964653718 3:159043078-159043100 CCTAAGAGCCAGAGTTGATGGTG 0: 1
1: 0
2: 1
3: 19
4: 286
Right 964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG 0: 1
1: 0
2: 1
3: 12
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964653728 Original CRISPR CTGAGAATAAGGGGCAACAA GGG Intronic
903505335 1:23830693-23830715 CTGAGAATGAGAGGAACCAATGG - Intronic
907651750 1:56302029-56302051 CAGAGGAAAAGGGGCAAGAATGG - Intergenic
907954857 1:59218364-59218386 CTGAGAACTAGGAGCATCAAGGG + Intergenic
908233477 1:62128451-62128473 TTAAGATTAAGGGGCAACAAGGG - Intronic
908863540 1:68519246-68519268 CTGAGAATAAGGGGGAACTATGG - Intergenic
911529295 1:99024978-99025000 CTGAGAAGAACTGGAAACAATGG - Intergenic
912827049 1:112915140-112915162 CTGAGGATAAGGGTGAACAGAGG + Intronic
913283452 1:117207410-117207432 CTGAGAATAAATGGCAAGACAGG - Intronic
917845754 1:179018956-179018978 CTGAGAAGCAGGGGTAGCAACGG + Intergenic
918728242 1:187953687-187953709 CTGAGAACCAGGGGAAACGATGG + Intergenic
922183106 1:223251551-223251573 ATAAGAAGAAGAGGCAACAAAGG + Intronic
922742042 1:228019411-228019433 CTTAGAATGAGGAGAAACAAAGG - Intronic
1063798673 10:9544789-9544811 CTGAAAAAAAGGGGAAAAAAAGG - Intergenic
1063914786 10:10870608-10870630 CTGAGAATTAGGACCAAAAATGG + Intergenic
1064382518 10:14859101-14859123 CTGAAAACAAGGGGGAAGAAGGG - Intronic
1065696100 10:28381101-28381123 CTGAGAACAAGGGGAATCGATGG + Intergenic
1065988774 10:30985679-30985701 CTGTGAATAAGGAGAACCAACGG - Intronic
1066069587 10:31793787-31793809 CTGAGAATGAGGCACAAGAATGG - Intergenic
1068330636 10:55562237-55562259 CAGTAAATAAGGGACAACAATGG - Intronic
1069829731 10:71275467-71275489 ATGAAAACGAGGGGCAACAAGGG - Intronic
1070763018 10:79036838-79036860 CAGAGAATAAGTGGCAATGAGGG - Intergenic
1071261976 10:83928629-83928651 CTGAGAAGAGGGGACAAGAAGGG + Intergenic
1071379802 10:85047122-85047144 CAGAAAAGAAGGGGCAAAAAGGG - Intergenic
1071680203 10:87697321-87697343 CTCAGAGCAAGGGGCAACGAGGG + Intronic
1075057304 10:119229155-119229177 TGGAGAGTAAGGGGCAAGAATGG + Intronic
1075282060 10:121147637-121147659 CTGGGAATAAAGGGCAAATAAGG - Intergenic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1079173463 11:18117768-18117790 CTGAGAATAATAGACAATAACGG + Intronic
1080839326 11:35969761-35969783 CTGCCAATAAGGGGCCTCAAGGG - Intronic
1083954753 11:65977178-65977200 CTGAGAGAAAGGGGCAGCAGAGG - Intronic
1086196200 11:84142786-84142808 CTGAGAAGAGGGGAAAACAAGGG - Intronic
1087438827 11:98157530-98157552 CTGAAAACTAGGGGCAGCAAGGG + Intergenic
1087879974 11:103404645-103404667 CTGAAAATAAGGGGAATCAGTGG + Intronic
1088227560 11:107638132-107638154 GTGAGAATAATGGGTAACAGAGG - Intronic
1089271580 11:117305265-117305287 CTGAGAAAAGGGGGCAAGGAAGG + Intronic
1089845467 11:121454628-121454650 CTCAGAGCAAGAGGCAACAATGG - Intronic
1093870511 12:24285246-24285268 CTCAGAATAAGGGGGATAAATGG - Intergenic
1094688531 12:32745442-32745464 CTCAGTTTAAGGGCCAACAAAGG - Intronic
1094747137 12:33357853-33357875 CTAAGAATAAGGGGGAAAGAAGG - Intergenic
1095943122 12:47739145-47739167 TTGAGAAGAAGGGGCATGAAGGG + Exonic
1096220384 12:49825376-49825398 CTGAGAAGCAGGGGCTAGAAAGG + Intronic
1102892385 12:116570129-116570151 CTCAGAAGAAGGGGCAAAGAGGG + Intergenic
1104106259 12:125662522-125662544 TTGAGAATAAAGGAAAACAATGG + Intergenic
1105236957 13:18565673-18565695 CTGAGAACCAGGGGAATCAATGG - Intergenic
1105691604 13:22845654-22845676 CTTAAAATAAGGGGAAAGAAAGG + Intergenic
1106290392 13:28356032-28356054 CAGGGAATATGGGGCAGCAATGG - Intronic
1107670968 13:42745962-42745984 CTAAAAATAAGGGGAAAGAAAGG - Intergenic
1109042916 13:57364054-57364076 TTAAGAATAAGTGGAAACAATGG - Intergenic
1110319236 13:74141419-74141441 ATGAAAATAAGAGGAAACAAGGG + Intergenic
1111652405 13:91108456-91108478 ATGAGAACAAGTGGCAACACAGG - Intergenic
1117166614 14:53040740-53040762 TTGAAAATAAGAGGTAACAAAGG + Intronic
1117912245 14:60647535-60647557 GTGAGGATAAGGGGAAAGAAAGG - Intronic
1120768638 14:88355214-88355236 CTGAGAATAGGCAGCAAAAAGGG - Intergenic
1122841909 14:104469439-104469461 CAGAGAATCAGAGGCACCAATGG + Intergenic
1123040605 14:105488744-105488766 GAGAGCATTAGGGGCAACAAGGG - Intronic
1125006591 15:34824050-34824072 CTGAAAGGAAGGGGCAGCAATGG + Intergenic
1127388389 15:58485805-58485827 TTGAGAAGAAGGGGCCTCAAGGG - Intronic
1128402223 15:67295124-67295146 CTGAAAGTAAGGGGAGACAAGGG - Intronic
1134422959 16:14111759-14111781 CCGAGAAAAAGGGGGAACCAGGG - Intronic
1134558221 16:15184611-15184633 CTGAGCTAAAGGGGCAACCAGGG - Intergenic
1134918753 16:18096213-18096235 CTGAGCTAAAGGGGCAACCAGGG - Intergenic
1136102092 16:28003847-28003869 CCCAGAAGCAGGGGCAACAAAGG + Intronic
1140363371 16:74363183-74363205 CTGAGGAAAAGGAGCAAAAACGG - Intergenic
1144334018 17:14253069-14253091 CTCAGAGTAAGGGCCCACAAAGG + Intergenic
1145400546 17:22528492-22528514 CTGAGAATAAGGGAAATCAGTGG - Intergenic
1145850787 17:28093636-28093658 CTAAGAATAAGGGGCAGAACTGG - Intronic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1149766472 17:59282997-59283019 CTGAGATTAAGGGCCAGAAAAGG + Intergenic
1153215920 18:2821089-2821111 CTGAGAACCAGGGGAGACAATGG + Intergenic
1153589832 18:6661754-6661776 ATGAAAAACAGGGGCAACAAAGG + Intergenic
1153746142 18:8181499-8181521 CTGAGACTGAGGGGCGAAAAAGG + Intronic
1154512587 18:15124242-15124264 CTGAGAACCAGGGGAATCAATGG + Intergenic
1156556619 18:38075713-38075735 CTGAGAACCAAGGGCACCAAGGG + Intergenic
1156960302 18:43020555-43020577 TTGAGAATAAGGAGCAAAACTGG + Intronic
1157188462 18:45560437-45560459 CTGAGAAGGAGGGCCAAAAAGGG - Intronic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1162406088 19:10474755-10474777 CTGAAAATATGGGTCAAAAATGG + Intergenic
1162867756 19:13561745-13561767 CTGAGAACCAGGAGCACCAAGGG - Intronic
1166443705 19:42839687-42839709 CTGAGAAAAAGATGCAACCATGG - Intronic
1166466475 19:43036276-43036298 CTGAGAAAAAGATGCAACCATGG - Intronic
1166894955 19:46017224-46017246 CTGAGAAAAAGGAGTAACCAAGG - Intronic
928815765 2:35292893-35292915 GTGTGAATAAGGTGCAACAGAGG - Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
932104356 2:68928971-68928993 CTGAGAATAAATGTTAACAATGG - Intergenic
932444380 2:71766280-71766302 CTGAGAACCAGGGGCACTAAGGG - Intergenic
933061841 2:77747769-77747791 CTGAGAGTAGGAGGCAAAAATGG - Intergenic
937015533 2:118602035-118602057 CTGAGAAGAAGATGTAACAAAGG + Intergenic
938142420 2:128807225-128807247 CTGGAAAGAAGGGGAAACAATGG - Intergenic
938512831 2:131968876-131968898 CTGAGAACCAGGGGAATCAATGG + Intergenic
940641636 2:156350594-156350616 CTGATGATAAGAGGCAACATAGG - Intergenic
941133058 2:161678019-161678041 GTGAAAATAATGGGCAAAAAAGG - Intronic
942745690 2:179229385-179229407 CTGAGGACTAGGAGCAACAATGG - Intronic
942966246 2:181895776-181895798 CTAACAATTAGGGGCAAAAATGG - Intronic
945016752 2:205526411-205526433 TTTAGAAAAAGGGGCCACAAAGG - Intronic
949030048 2:241790746-241790768 CTGAGAAGAAAGGAAAACAAAGG - Intronic
1169819838 20:9698157-9698179 CTGAGAATAAGAGGGAAAAGTGG + Intronic
1172148250 20:32772557-32772579 CAGAGAATGAGGGGCAGCATTGG - Intronic
1172863483 20:38076566-38076588 CTGAGAAGCAGAGGCAGCAAGGG - Intronic
1174768126 20:53272912-53272934 CTGAGAATGAGGGGCTACCAAGG + Intronic
1176780944 21:13193958-13193980 CTGAGAACCAGGGGAATCAATGG - Intergenic
1176992606 21:15516713-15516735 CAGAGAATAATGGGTAATAATGG - Intergenic
1177106422 21:16961602-16961624 CTTAGAAAAATGAGCAACAAAGG - Intergenic
1177957909 21:27623697-27623719 CTGAGAGTCAGGAGCACCAACGG - Intergenic
1177978625 21:27883071-27883093 CTGAGAACCAGGGGAATCAATGG - Intergenic
1179356422 21:40664704-40664726 CTGAAAATAAGGGACAACAGTGG + Intronic
1179797493 21:43793875-43793897 CTGAGAATACAGGGGAACACTGG + Intronic
1179837463 21:44046356-44046378 CTGGGAAGAAGGGACAACAGCGG - Intronic
1180020469 21:45121929-45121951 CTAAGAATTAGTAGCAACAATGG - Intronic
1181157699 22:20934576-20934598 CTGAGAATTTGGGGCAAACAAGG - Intronic
1183127300 22:35795659-35795681 CTGAGCATAATGGTCAACAGGGG + Intronic
1184485544 22:44776641-44776663 CTCAGAATAAAGGGCAACACAGG - Intronic
949603625 3:5630445-5630467 ATGAGAAATAGGGGCAACTATGG - Intergenic
950317674 3:12019034-12019056 CAGAGAATAAGAGGCATCATTGG - Intronic
950645657 3:14375058-14375080 CTGAGAATTAGGAGCTAGAATGG - Intergenic
950883818 3:16345609-16345631 CTGAGAACCAGGAGCAACAAGGG - Intronic
951578519 3:24137914-24137936 CTGAAAACAAGGGCCAAAAATGG + Intronic
953360936 3:42295928-42295950 CTGAGCATCTGGGGCAACACAGG + Intergenic
953513099 3:43563324-43563346 CTGACAAGAACGTGCAACAAAGG + Intronic
956908450 3:73791448-73791470 CTGAGAACTAGGAGCATCAAAGG - Intergenic
957289065 3:78253871-78253893 CTGAGAAGCAGGAGCACCAAAGG - Intergenic
958059139 3:88455962-88455984 CTAAGAATATGGGGAAATAATGG - Intergenic
958745074 3:98124358-98124380 CTGAGAATGAGGCGCATAAAGGG + Intergenic
961123205 3:124391879-124391901 CTGAGACAAAGTGGCAAAAACGG + Intronic
962476582 3:135760351-135760373 CTGAGAACCAGGGGAACCAATGG - Intergenic
963484174 3:145915525-145915547 CTGAGGATAAGTGGCAATATGGG - Intergenic
964074120 3:152672299-152672321 ATGAGATTAATGGGAAACAAGGG + Intergenic
964653728 3:159043126-159043148 CTGAGAATAAGGGGCAACAAGGG + Intronic
964714493 3:159707794-159707816 CTGAAAATTAGGGGGGACAAAGG - Intronic
964748960 3:160037350-160037372 CAGAGAATAATGGGCCACACTGG + Intergenic
964849600 3:161081054-161081076 CAAAGCATGAGGGGCAACAAAGG + Intergenic
966504600 3:180685337-180685359 CAGAGGATAAGAGTCAACAATGG - Intronic
966636084 3:182135226-182135248 CTGAGATTAAGCAACAACAAAGG + Intergenic
967810272 3:193753936-193753958 GAGAGAATAAGTGCCAACAAGGG - Intergenic
969707990 4:8822918-8822940 CAGAGAATAAGGGAAAAAAATGG + Intergenic
970449295 4:16151061-16151083 CTCAGCCTATGGGGCAACAATGG + Intergenic
971260662 4:25053892-25053914 CTGGGAATATGGGGCATAAACGG + Intergenic
972888184 4:43519453-43519475 CTGTGAATAAGTGGAAAAAAGGG - Intergenic
973563695 4:52162664-52162686 CTGAAAATCAGGGGAAACTAAGG - Intergenic
973589802 4:52429570-52429592 CTGATACTATGGAGCAACAAGGG - Intergenic
974972544 4:68847237-68847259 CTAAGAATAAAGGCCAGCAAAGG - Intergenic
975408877 4:74024452-74024474 CTGAGAATAAGGCTGAAAAATGG - Intergenic
977476149 4:97512553-97512575 CTGAGAAGAAGGGAGAACAGAGG + Intronic
977801331 4:101236554-101236576 ATGAGAGCAAGGGGCAAGAATGG + Intronic
978353956 4:107850554-107850576 CTGAGATCAAGGGGCATCCAGGG + Intronic
978926003 4:114245414-114245436 CTCAGAAGCAGAGGCAACAATGG + Intergenic
979801792 4:124918959-124918981 CTGAAAATAATGCTCAACAAAGG - Intergenic
979840285 4:125430710-125430732 CTGATAATAAGGGGAGAAAAGGG + Intronic
981670721 4:147283985-147284007 CTGAGAATAAAGACAAACAAGGG - Intergenic
983095491 4:163556446-163556468 ATGAGAATAAGCATCAACAATGG - Intronic
983719234 4:170826388-170826410 CTGAGATTAAGTTGCAATAACGG + Intergenic
987859756 5:23469307-23469329 CTGAGATTAGGGGGCCACAATGG + Intergenic
988041813 5:25899350-25899372 CTAAGAACAAGGGGAGACAAAGG - Intergenic
991178352 5:63718150-63718172 ATGAGAACAAAGTGCAACAATGG + Intergenic
992065640 5:73105039-73105061 CTGAAAAAAAGGGGGAAGAAAGG - Intergenic
996465484 5:123797276-123797298 GAGAGAATAAGGTGCAAAAAAGG + Intergenic
1001134525 5:169091389-169091411 CTGACAATAAGGGGGAGCCATGG + Intronic
1004721607 6:18272605-18272627 CTGAGAACCAGGAGCACCAAGGG - Intergenic
1005723765 6:28628933-28628955 CTGAGAACCAGGAGCATCAAGGG + Intergenic
1008879497 6:56366429-56366451 CTGAGAATCAGGAGTAAGAATGG + Intronic
1009685965 6:66958055-66958077 AAGAGAAAAAGGGGCAAGAAAGG - Intergenic
1011781285 6:90792304-90792326 CTGAGGATAATGGGAAAAAATGG + Intergenic
1015424490 6:133050013-133050035 CTTGGAATAAGTGACAACAAAGG - Intergenic
1015958639 6:138624153-138624175 CTGAGAAGAGGTGGCAGCAATGG + Intronic
1016291272 6:142530783-142530805 CTGAGAATCAGGGGAGTCAATGG - Intergenic
1016540215 6:145156357-145156379 CTGAGAATCAGGGGAAACAGTGG - Intergenic
1016654913 6:146507736-146507758 CTGAGAAAAAGAAACAACAAGGG + Intergenic
1016930575 6:149403492-149403514 TTGAAAATAAGTGGCAAGAATGG - Intronic
1017203566 6:151780732-151780754 CTGAGAATGAGGAGAATCAATGG - Intronic
1018224154 6:161611642-161611664 CTGAGGAGAAGGGGCAAGACAGG - Intronic
1018539815 6:164866763-164866785 CAGAAAATAAGGGGAAACATTGG + Intergenic
1020494768 7:8835907-8835929 CTGAGGATAAGGAGCACCAAGGG + Intergenic
1020693253 7:11385321-11385343 TTGAAAATAAGTGGCAACAGTGG + Intronic
1020706825 7:11554764-11554786 CAGAAAAAAAGAGGCAACAAAGG - Intronic
1022426908 7:30277852-30277874 CTGAGCACAGGGGTCAACAAAGG - Intergenic
1024715179 7:52071389-52071411 CTGAGAACCAGGGGAGACAATGG - Intergenic
1024871674 7:53970541-53970563 CTGAGAACCAGGAGCACCAATGG + Intergenic
1028308564 7:89298994-89299016 CTGAGAAAAATGGGCCATAAAGG - Intronic
1031754220 7:125618065-125618087 CTGAGAGTAAGAGCCAACAGTGG - Intergenic
1032626864 7:133600723-133600745 CTGGGAATAAAGGGCAAAGATGG - Intronic
1033205371 7:139416207-139416229 CAGAAAACAAGGGGAAACAAAGG - Intronic
1033835280 7:145302992-145303014 CTGAAAATAAGGGTAAACTATGG + Intergenic
1036922132 8:12866986-12867008 CTGAGAATTGGAGGCAATAAAGG + Intergenic
1037603632 8:20419640-20419662 TAGAGAATCAGGGGAAACAATGG - Intergenic
1039633319 8:39135951-39135973 CTGAAAATAAGAAGCAACCAGGG - Intronic
1041407237 8:57513475-57513497 CTGAGAATAAGGAGCTTCATGGG + Intergenic
1042212291 8:66392678-66392700 CTAAGAATATGGAGCAAGAAAGG - Intergenic
1043538819 8:81236128-81236150 ATGAGAATAAAGGGCCACACAGG - Intergenic
1043926285 8:86040748-86040770 CCCAAAAGAAGGGGCAACAAAGG - Intronic
1046204556 8:110975732-110975754 CTGAGAATTAAAGGGAACAATGG + Intergenic
1047184680 8:122622071-122622093 CTGAGAGCCAGGGGCACCAAAGG - Intergenic
1047306693 8:123658463-123658485 GGGAGAATAAGGGGAAAAAAAGG + Intergenic
1048398104 8:134034242-134034264 CTGAGAAGGAGGGGCAACATGGG + Intergenic
1049028220 8:140012426-140012448 CTGAGAATGAGAGGGAAGAAGGG + Intronic
1049535734 8:143180764-143180786 CCGAGAATAAATGGAAACAAAGG - Intergenic
1051024774 9:12595279-12595301 CTGAGAACTAGGAGCACCAATGG + Intergenic
1051197875 9:14583417-14583439 CTGAGAAGAATGAGCAAAAAGGG + Intergenic
1051453369 9:17223292-17223314 CTGAGGGTAAGGGGGAACTACGG + Intronic
1052156966 9:25204020-25204042 CTGAGAAAAATGTGCAACCATGG + Intergenic
1052580164 9:30345156-30345178 ATGAGAATAAGGCACAACATAGG - Intergenic
1052695330 9:31870254-31870276 CTGAGCATAAAGGGCCCCAAAGG - Intergenic
1055663455 9:78530544-78530566 CTGAGAATCAGGAGCACCAATGG + Intergenic
1056833962 9:89939641-89939663 CTGAGAACAAAGGGCCAAAAGGG - Intergenic
1060840740 9:126791425-126791447 ATGAGAACAACGGGCAACACTGG + Intergenic
1188369635 X:29352809-29352831 CTGAAAATAAGGAACAACACTGG - Intronic
1190880798 X:54491363-54491385 CTGAGAATAAGGGTAAACTGAGG + Intronic
1193984654 X:88225771-88225793 CTGAGAATCAGGAGAACCAATGG - Intergenic
1194192353 X:90853335-90853357 CTGAGAATAAAGAACAAAAACGG - Intergenic
1194197254 X:90910029-90910051 CTGAGAATTAGGAGCACCAAGGG - Intergenic
1197678665 X:129358715-129358737 CTGAGAACCAGGAGCACCAAGGG + Intergenic
1198012488 X:132572474-132572496 CTGTGAATCAGGAGCAACCAAGG + Intergenic
1198752456 X:139949313-139949335 CTAAGAATTAGAAGCAACAAAGG - Intergenic
1198949017 X:142048573-142048595 CTGAGCAAAAGAGGCGACAAAGG + Intergenic
1200544465 Y:4502782-4502804 CTGAGAATTAGGAGCACCAAGGG + Intergenic