ID: 964655743

View in Genome Browser
Species Human (GRCh38)
Location 3:159064273-159064295
Sequence CCCTGACTGGTTTGATGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964655743 Original CRISPR CCCTGACTGGTTTGATGAGC AGG Intronic
900315957 1:2056397-2056419 CCTTGTCTGGTGTGCTGAGCGGG + Intronic
902342478 1:15793028-15793050 CCCTGAGGGCTTTGATGATCAGG - Intergenic
902507771 1:16948918-16948940 CCCTGACTGGTACGAGGGGCTGG + Exonic
904276703 1:29389584-29389606 CCCTGACTAGCCTGATGACCTGG - Intergenic
906120044 1:43383476-43383498 ACCTGAGTGGGCTGATGAGCCGG + Intergenic
906199388 1:43949296-43949318 CCCTGACTGGGGGGCTGAGCAGG - Intronic
907508860 1:54943627-54943649 TCCTGACTGCTTTCATGGGCTGG - Intergenic
909068363 1:70963217-70963239 TCCTGACTGATTTCATGGGCTGG + Intronic
913208401 1:116563293-116563315 TCCTGGCTGCTTTCATGAGCTGG + Intronic
915333005 1:155125310-155125332 CACTGAGTGTTGTGATGAGCTGG - Intergenic
916514361 1:165501777-165501799 CCATGACTGGTAAGGTGAGCTGG - Intergenic
918396334 1:184116904-184116926 ACCTGCTTGGCTTGATGAGCTGG - Intergenic
920175872 1:204101455-204101477 CCCAGGCTGGTTTGAACAGCTGG - Intronic
924584609 1:245350969-245350991 CCCTCACTGCTTTGGTGACCAGG - Intronic
1064158564 10:12923909-12923931 CCCTGAGTGGGTAGAGGAGCAGG - Intronic
1065638924 10:27760850-27760872 CACTGACTTGTTGGATGGGCTGG + Intergenic
1065725161 10:28661836-28661858 CCCTGACTGGTGTGAGGGTCAGG + Intergenic
1066006403 10:31150061-31150083 CTGTCACTGGTTTGCTGAGCAGG - Intergenic
1067215779 10:44301547-44301569 CCCTGCCTGGTGTGCTGAGCTGG - Intergenic
1067928987 10:50540671-50540693 CCATGACTGGATTGAAGAGGGGG + Intronic
1070032575 10:72692035-72692057 CCTTGACTGAGTTGATGAGGCGG - Intergenic
1079949577 11:26784636-26784658 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
1080065165 11:28002526-28002548 ACCTGGCTGCTTTCATGAGCTGG - Intergenic
1080153420 11:29078998-29079020 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
1080768907 11:35322455-35322477 CCTTCACTGATTTGATGAGGTGG + Intronic
1081769077 11:45636183-45636205 TCCTGGCTGGTTTCATGGGCTGG - Intergenic
1082981945 11:59132045-59132067 CCCCGGCTGCTTTCATGAGCTGG - Intergenic
1087261189 11:96014089-96014111 CCCTTAGAGGTTTGATCAGCGGG + Intronic
1089042410 11:115464743-115464765 CCCTGACTGAATAGATGAGTAGG + Intronic
1091932137 12:4404516-4404538 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
1092326328 12:7534942-7534964 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
1094397569 12:30024697-30024719 TCCTGGCTGTTTTCATGAGCTGG + Intergenic
1095345830 12:41147947-41147969 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1097406354 12:59195027-59195049 TCCTGAGTGCTTTCATGAGCTGG + Intergenic
1098357539 12:69625897-69625919 CCATGACTGGGTTGATGTGAGGG + Intergenic
1098630965 12:72721015-72721037 TCCTGACTGCTTTTATGGGCTGG - Intergenic
1100533588 12:95483511-95483533 CACTGACAGGTTTGAAGAGTAGG + Intronic
1109098327 13:58145507-58145529 TCCTGACTGCTTTCATGGGCTGG - Intergenic
1109407282 13:61918577-61918599 CCCTGGCTGCTTTCATAAGCTGG + Intergenic
1109481783 13:62964685-62964707 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
1109496452 13:63178310-63178332 TCCTGACTGCTTTCATGGGCTGG - Intergenic
1113613096 13:111661845-111661867 CCCCGAGTGGTTTCAGGAGCTGG + Intronic
1114869347 14:26637217-26637239 CCCAGACTGTTTTGATGATAAGG + Intergenic
1114987641 14:28250706-28250728 TCCTGACTGCTTTCATGGGCTGG + Intergenic
1114989711 14:28272076-28272098 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1115009138 14:28522812-28522834 TCCTGACTGCTTTCATGAGCTGG - Intergenic
1115935735 14:38550106-38550128 CCCTAACTGTTTTCATGAGTGGG + Intergenic
1116080301 14:40162787-40162809 CCCTGGCTTCTTTCATGAGCTGG - Intergenic
1120504404 14:85336850-85336872 CCCTGAACTGTTTAATGAGCTGG + Intergenic
1122928368 14:104921242-104921264 CCCTGCCTGGTTTGAGTATCAGG + Intergenic
1123189165 14:106551418-106551440 CCATGACTGCTTTGATAGGCTGG - Intergenic
1125062185 15:35437736-35437758 CACTGACTGGTTTGCTGGCCTGG - Intronic
1126533213 15:49733001-49733023 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1126539275 15:49804134-49804156 TCCTGGCTGCTTTAATGAGCTGG + Intergenic
1128348223 15:66868820-66868842 CCTTTTCTGGTTTGAGGAGCAGG + Intergenic
1128760903 15:70215388-70215410 CACTGACTGGTTAGGGGAGCTGG + Intergenic
1130232633 15:82108621-82108643 CCCTGGCTGACTTCATGAGCTGG - Intergenic
1130916328 15:88307903-88307925 CCCTGATTGGTTCAATCAGCTGG - Intergenic
1142133652 16:88442091-88442113 CCCTGACTGGGCAGATGAGGAGG + Intergenic
1142230106 16:88896078-88896100 TCCTGACTGGTTTTATGGGTCGG + Intronic
1144293754 17:13853738-13853760 CCCTGACTAATTCAATGAGCAGG + Intergenic
1145991024 17:29079573-29079595 TCCTGGCTGCCTTGATGAGCAGG - Intronic
1146263420 17:31436069-31436091 CCCTTCCTGGATTGCTGAGCAGG + Intronic
1146729735 17:35183255-35183277 CCCTGACTGGTTGAATGAAGGGG - Intronic
1151375617 17:73686813-73686835 CCCTGGCTGGTCTCATGGGCTGG - Intergenic
1151421090 17:73998426-73998448 CCCTGACTGTTTTAATATGCTGG + Intergenic
1151985597 17:77541258-77541280 ACCTGCCTGGTCTGAGGAGCTGG - Intergenic
1153772747 18:8428734-8428756 CCCTGACTGATTCGCTGTGCTGG - Intergenic
1157298825 18:46464985-46465007 CTCTGACTGGTTGGAGGACCAGG - Intergenic
1159215618 18:65387283-65387305 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
1160089071 18:75808880-75808902 CCGTGCCTGGTTTGAACAGCAGG - Intergenic
1160396299 18:78574727-78574749 CCCTTGCTGCTTTCATGAGCTGG - Intergenic
1165635458 19:37336161-37336183 CCCTGACTGGTTTGTTAAGTTGG + Intronic
1166525026 19:43505116-43505138 CCCTGACCGGTTTGGGGAGCTGG + Intergenic
926000809 2:9330932-9330954 GCCTGACTGATTTGAAGAGCAGG - Intronic
926926534 2:17993584-17993606 CCCTGGCTGCTTTCATGGGCTGG - Intronic
928436887 2:31260529-31260551 CCTTGAGTGGTTTGCCGAGCGGG + Exonic
932307500 2:70714472-70714494 CCCTGGCTGGATTGAGGAGGAGG - Intronic
933663556 2:84946535-84946557 CCCTGCCTTGGTTGATGAGGTGG + Intergenic
937870912 2:126785460-126785482 CCCTCACAGGTTTGAGGACCTGG - Intergenic
938276189 2:130026202-130026224 CCCTGAATGTTTTGCTGTGCTGG - Intergenic
938327147 2:130416958-130416980 CCCTGAATGTTTTGCTGTGCTGG - Intergenic
938362791 2:130704519-130704541 CCCTGAATGTTTTGCTGTGCTGG + Intergenic
938439181 2:131311132-131311154 CCCTGAATGTTTTGCTGTGCTGG + Intronic
940790727 2:158027520-158027542 TCCTGACTGCTTTCATGGGCTGG + Intronic
941118115 2:161495113-161495135 CCCTGACAGGTTTAGTGGGCTGG + Intronic
941525148 2:166597766-166597788 CCATGACTGCTTTCATGGGCTGG + Intergenic
942727566 2:179026725-179026747 TCCTGGCTGCTTTCATGAGCTGG - Intronic
945583442 2:211626620-211626642 CACTTACTGGTTTTATAAGCAGG - Intronic
1172177677 20:32982518-32982540 CCCTGATTGCTTGGAGGAGCAGG + Intergenic
1173602593 20:44306724-44306746 CCTTGTTTGGTTTGCTGAGCTGG - Exonic
1175083023 20:56437196-56437218 CCCTGACTGCTCTGACGAGCTGG + Exonic
1181402068 22:22655918-22655940 TTCTGACTGTTGTGATGAGCAGG + Intergenic
1182999628 22:34844392-34844414 CCCTGACTGCTTTCATGGGCTGG - Intergenic
1184403960 22:44289565-44289587 CCCTGACAGGGAGGATGAGCTGG - Intronic
1185377232 22:50488157-50488179 CCCTGCCTGGGTTGGGGAGCAGG + Intronic
951773452 3:26283588-26283610 TCCTGACTGCTTTCATGGGCTGG + Intergenic
953022719 3:39125924-39125946 TCCTGACTGGCTGGAAGAGCAGG - Intronic
956503306 3:69910522-69910544 TCCTGACTGTTTTCATGGGCTGG - Intronic
957870826 3:86089115-86089137 CCCTGGCTGCTTTCATGTGCTGG + Intergenic
959068423 3:101680262-101680284 CCCGGAGTAGTTTGTTGAGCTGG - Intergenic
959172473 3:102859816-102859838 TCCTGACTGCTTTCATGGGCTGG + Intergenic
959593559 3:108104684-108104706 TCTTCACTGGTTTCATGAGCTGG - Intergenic
960021865 3:112964350-112964372 TCCTGGCTGCTTTCATGAGCTGG - Intronic
960710808 3:120526084-120526106 CACTGACTAGTTTGCTGAGGGGG - Intergenic
964150469 3:153518424-153518446 TCCTGACTGCTTTCATGGGCTGG + Intergenic
964655743 3:159064273-159064295 CCCTGACTGGTTTGATGAGCAGG + Intronic
965028685 3:163335440-163335462 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
965795277 3:172432810-172432832 TCCTGGCTGATTTCATGAGCTGG + Intergenic
970382078 4:15518404-15518426 TCCTGGCTGCTTTCATGAGCTGG + Intronic
972260901 4:37407536-37407558 CACTGATTGGTTGGATAAGCAGG - Intronic
974963308 4:68730486-68730508 CCCTGGCTGCTTTCATGGGCTGG + Intergenic
976277210 4:83289922-83289944 TCCTGACTGCTTTCATGAGCTGG - Intergenic
976581289 4:86740047-86740069 TCCTGGCTGGTTTCATGGGCTGG + Intronic
983083434 4:163414987-163415009 CCCTGGCTGCTTTCATGGGCTGG - Intergenic
983322360 4:166211413-166211435 TCCTGACTGCTTTCATGGGCTGG + Intergenic
983322662 4:166213488-166213510 TCCTGACAGCTTTCATGAGCTGG + Intergenic
983789865 4:171783180-171783202 TCCTGACTGCTTTCATGGGCTGG + Intergenic
984056972 4:174942151-174942173 CCATGACGGCTTTCATGAGCTGG + Intronic
984454332 4:179945522-179945544 TCCTGGCTGGTTTCATGGGCTGG - Intergenic
985809245 5:2070931-2070953 TCCTGGCTGCTTTCATGAGCTGG - Intergenic
986069793 5:4270615-4270637 TCCTGACTGCTTTCATGGGCTGG + Intergenic
986323259 5:6651057-6651079 CTCTGCCTGGTTAGCTGAGCTGG + Intronic
986975446 5:13388278-13388300 CCATGGCTGCTTTCATGAGCTGG - Intergenic
988396042 5:30698918-30698940 CTCTGTCTGCTTTCATGAGCTGG - Intergenic
988471874 5:31547292-31547314 TCCTGGCTGTTTTCATGAGCTGG + Intronic
988603057 5:32657046-32657068 TCCTGGCTGCTTTGATGGGCTGG + Intergenic
989224606 5:39011556-39011578 TCCTGACTGCTTTCATGGGCTGG - Intronic
989696958 5:44212762-44212784 TTCTGACTGGTTTTATGAGCTGG - Intergenic
994405299 5:99338319-99338341 CTCTGACTGGTTTGGTTATCAGG - Intergenic
994637634 5:102363127-102363149 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
997052455 5:130398738-130398760 TCCTGACTGCTTTCATGGGCTGG - Intergenic
997201465 5:132012183-132012205 CCCTCACTGGTTTGCAGAGGTGG - Intronic
997295713 5:132767027-132767049 CCCTGACTTGTTTGAGGGGATGG - Intronic
1001473345 5:172031591-172031613 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1002180391 5:177428193-177428215 CCCTGGCTGGTTGGATGACGAGG - Intronic
1003129535 6:3383750-3383772 CTCTGCCTGTTTTGCTGAGCTGG - Intronic
1004495338 6:16157644-16157666 ATCTGACTGGATTGAAGAGCCGG + Intergenic
1005529729 6:26690807-26690829 CTCTTACTGGTTTGATGAAAAGG - Intergenic
1005541067 6:26810840-26810862 CTCTTACTGGTTTGATGAAAAGG + Intergenic
1006463259 6:34176428-34176450 CCCTGCCTGGTTTCCTCAGCTGG + Intergenic
1006816194 6:36851855-36851877 CTCTGACTGGCTTGAGGATCTGG + Intergenic
1014475910 6:121872089-121872111 TCCTGACTGCTTTCATGGGCTGG + Intergenic
1016589538 6:145729376-145729398 CCATGGCTGCTTTCATGAGCTGG - Intronic
1016632591 6:146249815-146249837 CCCTGGCTGCTTTCATGGGCTGG - Intronic
1020093253 7:5353124-5353146 CTTTGACTGGTTCGATGGGCAGG - Intronic
1023586706 7:41738373-41738395 CACTGCCTGGTGTGATCAGCAGG - Intergenic
1023870880 7:44262450-44262472 CCCTGACTGTTTTCTTGCGCTGG - Intronic
1030579414 7:111334575-111334597 CCCTGAATGCCTTTATGAGCTGG - Intronic
1031172458 7:118308886-118308908 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1034037281 7:147837888-147837910 TCCTGACTGCTTTCATGGGCTGG + Intronic
1034707466 7:153158447-153158469 CCCTCTCTGGGCTGATGAGCAGG + Intergenic
1034896400 7:154879063-154879085 CCCTCTCTGGGCTGATGAGCAGG - Intronic
1035404913 7:158590365-158590387 CCCTGGATGGTTCGATGGGCCGG + Intergenic
1038085460 8:24192038-24192060 GCCTAACCGGTTTGATGACCTGG + Intergenic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1048489875 8:134882847-134882869 CACTGATTGCTTTGAGGAGCAGG + Intergenic
1048668862 8:136694704-136694726 CCCTGAGAGGTTTGAGGAGCAGG - Intergenic
1050255667 9:3789682-3789704 TCCTGACTGCTTTCATGGGCTGG - Intergenic
1052220594 9:26017358-26017380 TCCTGACTGTTTTCATGGGCTGG + Intergenic
1052893962 9:33730398-33730420 GCCTGGCTGTTTTGAGGAGCAGG - Intergenic
1054797107 9:69312896-69312918 CCATGGCTGCTTTCATGAGCTGG + Intergenic
1054982967 9:71227999-71228021 CTTTGTCTGGTTTGATGATCAGG - Intronic
1058906882 9:109489182-109489204 CCCTGGCTGGATGGAGGAGCAGG - Intronic
1060201421 9:121653747-121653769 CCCTGCCTGGTCAGCTGAGCAGG - Intronic
1061827886 9:133273327-133273349 GCCTGACTGATTTGTGGAGCCGG + Intronic
1186987700 X:15034560-15034582 CCCTTACTGGTATGTTGTGCAGG - Intergenic
1187572028 X:20514644-20514666 CCCTGAGTGGGTTGATGAGGAGG + Intergenic
1188187256 X:27130550-27130572 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1192919989 X:75696463-75696485 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1193808058 X:86016875-86016897 TCCTGGCTGCTTTTATGAGCTGG - Intronic
1194756351 X:97743639-97743661 CCCTGGCTGCTTTCATGGGCTGG - Intergenic
1196228051 X:113189308-113189330 GCCTGACTGCTTTGTTAAGCGGG - Intergenic
1196566017 X:117206310-117206332 TCCTGGCTGCTTTCATGAGCTGG + Intergenic
1202015472 Y:20401826-20401848 CCCTGGCTGCTTTCATGAACTGG + Intergenic