ID: 964657083

View in Genome Browser
Species Human (GRCh38)
Location 3:159079222-159079244
Sequence TGAACTCTGTTTTAAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 185}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964657083_964657090 13 Left 964657083 3:159079222-159079244 CCCCCAGTTTAAAACAGAGTTCA 0: 1
1: 0
2: 0
3: 14
4: 185
Right 964657090 3:159079258-159079280 TTATGATCAACAGTAAGACGAGG 0: 1
1: 0
2: 1
3: 6
4: 89
964657083_964657091 14 Left 964657083 3:159079222-159079244 CCCCCAGTTTAAAACAGAGTTCA 0: 1
1: 0
2: 0
3: 14
4: 185
Right 964657091 3:159079259-159079281 TATGATCAACAGTAAGACGAGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964657083 Original CRISPR TGAACTCTGTTTTAAACTGG GGG (reversed) Intronic
902036592 1:13462626-13462648 CTAACTCTGTTTTTAAATGGGGG + Intergenic
903076007 1:20766996-20767018 TGAAATATCTTTTAAACTAGAGG - Intronic
903106831 1:21088121-21088143 TGAACACTGTTTTTAACAGAAGG - Intronic
904309077 1:29613923-29613945 AGAACTCTGTTTTTAACTCAAGG + Intergenic
907054750 1:51355161-51355183 TAAAGTTTGTTTTAAACTGTAGG + Exonic
907716578 1:56931963-56931985 TGTGCTCTGTTTTAACCTGATGG - Intronic
907977366 1:59444867-59444889 TAAACTCTGTTTTATACCAGCGG - Intronic
910324622 1:85991404-85991426 TAAACTATGTTTTAAAAAGGAGG + Intronic
910742195 1:90531931-90531953 TCAACTCTGATTTAAACTTTAGG + Intergenic
910749400 1:90612413-90612435 TAAACTCTGTTTTAGAGGGGTGG - Intergenic
911429152 1:97761098-97761120 AGAACCATGTCTTAAACTGGTGG - Intronic
913648918 1:120890704-120890726 TGAACCCTAATGTAAACTGGGGG + Intergenic
914077773 1:144372679-144372701 TGAACTCTAATGTAAACTGGGGG - Intergenic
914101406 1:144593826-144593848 TGAACTCTAATGTAAACTGGGGG + Intergenic
914172682 1:145241219-145241241 TGAACTCTAATGTAAACTGGGGG - Intergenic
914297574 1:146343810-146343832 TGAACCCTAATGTAAACTGGGGG - Intergenic
914527339 1:148482352-148482374 TGAACCCTAATGTAAACTGGGGG - Exonic
914639055 1:149584781-149584803 TGAACCCTAATGTAAACTGGGGG + Intergenic
915383948 1:155471844-155471866 TGAACTCTGCTCTTAACTTGAGG + Intronic
916653563 1:166852590-166852612 GGAACTCTGATTTAAACAGCTGG + Exonic
917804647 1:178602556-178602578 TAAAATCTGTTTTAAACAGTTGG + Intergenic
920548981 1:206842511-206842533 TGATCTCTGATTTCAGCTGGAGG + Exonic
1065200444 10:23308064-23308086 TGAACTCTGTTTGGATCTGTTGG - Intronic
1065686859 10:28294183-28294205 TTAAATATGTTTTAAACTGGAGG + Intronic
1067201589 10:44176849-44176871 TGAAATATGTTCTAAACTGTTGG - Intergenic
1067794888 10:49313776-49313798 TGGACTCTGCTTTAAACATGTGG + Intronic
1068347479 10:55800528-55800550 AGAACTTTGTTTTCAGCTGGAGG + Intergenic
1068461429 10:57334782-57334804 GGAAATCTATTTTTAACTGGTGG - Intergenic
1068831734 10:61504006-61504028 TGAACACTGTCTGAAACTAGGGG + Intergenic
1068873007 10:61965367-61965389 TTAACTCTGTATTAAAGAGGAGG + Intronic
1069675633 10:70245254-70245276 TGAATTCACTTTTGAACTGGGGG - Intergenic
1070363962 10:75717701-75717723 TGTGCTCTGTTTTAAAGGGGAGG - Intronic
1070392971 10:75987494-75987516 ATCACTCTGCTTTAAACTGGTGG - Intronic
1071684430 10:87739637-87739659 TGAACACAGTTTTGAACTTGGGG - Intronic
1073828687 10:107356932-107356954 TAATTTCTGTTTTAACCTGGGGG - Intergenic
1079742185 11:24076710-24076732 TGACCTTTGTTTTTCACTGGAGG - Intergenic
1084408142 11:68990685-68990707 TTAAATCTGTTTTAAACCTGAGG - Intergenic
1084797993 11:71521118-71521140 TGAACTCTGTTGAAAACAGCGGG - Intronic
1088555519 11:111056710-111056732 TGAAGTCTGCTTTAAAATGGAGG + Intergenic
1089071093 11:115700301-115700323 TGAACTCCCTTTCAACCTGGTGG + Intergenic
1090435029 11:126679470-126679492 TGACCTCTGTTTTATAAAGGAGG + Intronic
1093910132 12:24737812-24737834 AGATCTCTGTTTTCAACTGGGGG + Intergenic
1097294513 12:57948181-57948203 TGCACTCTGTTTAACCCTGGGGG - Intronic
1097382635 12:58913505-58913527 TGAACTCTGATTTACACTGCAGG + Intronic
1099374158 12:81876505-81876527 GAAACTCTGTTTTAAAATGATGG - Intergenic
1099553580 12:84079658-84079680 TGAACTTTGCATTAAACTGCTGG + Intergenic
1099777726 12:87154725-87154747 TGAAATCTGATCTAGACTGGGGG + Intergenic
1100687187 12:96999451-96999473 TGACCTCTCTTTGAAACTGCTGG + Intergenic
1100913270 12:99389397-99389419 TGAAAACTGTTTTCAACTAGGGG + Intronic
1102312988 12:111861688-111861710 TAAACACTGTTCTAAACTGCTGG - Intronic
1102355050 12:112226849-112226871 TGAACCTTGTTGTAAACTGGGGG - Intronic
1106587088 13:31066925-31066947 AGAACTCATTTTTAAATTGGAGG - Intergenic
1107086837 13:36434031-36434053 TGAACACTGCTCTAACCTGGAGG - Intronic
1107217584 13:37939744-37939766 TGAACACAGTATTAAACTGATGG + Intergenic
1108326748 13:49340299-49340321 AGCACTCTGTGTTAAACTGAAGG - Intronic
1109127980 13:58542651-58542673 TTAGCTCTGTTTTACCCTGGAGG + Intergenic
1111046392 13:82819523-82819545 TGAACCCTGTTGTGAACTGTGGG + Intergenic
1112119970 13:96398956-96398978 TGCATTCTGTTCTGAACTGGGGG - Intronic
1112554910 13:100458172-100458194 TGAACTTTGTTTAAAAATTGTGG + Intronic
1112673320 13:101667143-101667165 TGAACATTTTTTTAAACTGATGG + Intronic
1118749511 14:68795762-68795784 TAAACTCTTTTTTAAATTGTCGG + Intronic
1118844672 14:69538392-69538414 TGAACTCTATTTCAAGCTCGAGG + Intergenic
1120164026 14:81174814-81174836 TGTACTCTTTTTCAAAGTGGAGG + Intergenic
1126686711 15:51254843-51254865 TAAACTCTGTTTACAACTTGCGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1128801112 15:70497747-70497769 AGGACTCTGTTTTAAACCAGTGG - Intergenic
1129707930 15:77805258-77805280 TGTACTCTGTTTTAGAGAGGAGG - Intronic
1134119843 16:11575885-11575907 TGAACTTTGTTTTACAATCGGGG + Intronic
1134242153 16:12513998-12514020 TGAACTCTGCTTTATAACGGGGG - Intronic
1138401771 16:56751448-56751470 TTATCTGTGTTTTAAACTTGAGG + Intronic
1138731123 16:59196259-59196281 TGAACTCCCTATTAAACAGGTGG + Intergenic
1138731231 16:59197215-59197237 TGAACTCCCTATTAAACAGGTGG + Intergenic
1148771094 17:50066967-50066989 TGAACACTGTTTTAAGCTCCAGG + Intronic
1149300076 17:55297120-55297142 TGAAATTTCTGTTAAACTGGAGG + Intronic
1155114440 18:22750820-22750842 TGAACTGTAATTTGAACTGGAGG - Intergenic
1160590598 18:79942681-79942703 TGAACTCTGTTTGAACATGCAGG - Intronic
1163434955 19:17289899-17289921 TGGCCCCTGTTTTACACTGGAGG - Intergenic
1165381687 19:35486058-35486080 TGCTCTCTGGTTGAAACTGGGGG + Intergenic
925553488 2:5102323-5102345 TGAACTTTTTTTTTAAGTGGAGG - Intergenic
928762550 2:34601906-34601928 TGAACTTTGTTTTCAACTCTGGG - Intergenic
930388194 2:50724714-50724736 TGAACACTATTTTAAAATTGAGG + Intronic
931927463 2:67088824-67088846 TGAACTCTGATTTCAACAGGAGG + Intergenic
932351488 2:71035824-71035846 TGAGCTCTGTTGAAAACTTGTGG + Intergenic
932407863 2:71525887-71525909 TGTACTATGTTTTAACCGGGAGG + Intronic
939283721 2:140101013-140101035 TGAACTCTATATTAAATTTGTGG + Intergenic
939393322 2:141597181-141597203 TGAATTTTGCTTCAAACTGGTGG - Intronic
943145689 2:184042159-184042181 AAAAATCTGTTTTAAACTGAAGG + Intergenic
943226957 2:185189992-185190014 TGATCTCTGTTCTGAACTGTTGG - Intergenic
946467664 2:219926484-219926506 TTATGTCTGTTTTAATCTGGAGG + Intergenic
948279099 2:236732761-236732783 TGAACTCTGGCTTAGACAGGTGG - Intergenic
1169240984 20:3980698-3980720 TGAACTCTGCTGTAAAGTTGTGG - Intronic
1170210859 20:13845207-13845229 TGACCTCTGTTTAACACAGGAGG - Intergenic
1174917371 20:54667768-54667790 TGTACTCTTTTTAAAACTGTGGG + Intergenic
1176697482 21:9997504-9997526 TGCCCTGTGTTGTAAACTGGGGG - Intergenic
1176889066 21:14292422-14292444 TGCACTCTGATTTAAATTGTAGG + Intergenic
1181994592 22:26866196-26866218 TGAACTCTGTTCTATTCTGTTGG + Intergenic
1182600344 22:31458269-31458291 TTAACTCTTTTTTAAGCTGGTGG - Intronic
1183972688 22:41489754-41489776 TGATCTCTGGGTTAAAATGGTGG + Intronic
950356546 3:12414984-12415006 TTAAGTTTGTTCTAAACTGGAGG - Intronic
951276501 3:20693115-20693137 AGAATACTGTATTAAACTGGAGG + Intergenic
955486419 3:59438990-59439012 TGAACTCAGTTTCCAACTGCAGG + Intergenic
956416389 3:69034545-69034567 TGAACTCTTTTTTAACCTTCAGG - Intronic
956985638 3:74696685-74696707 TGAACTCATTTTTGAACTTGGGG + Intergenic
957397987 3:79668975-79668997 TCAACTCTATTTTAAACTTATGG - Intronic
958574294 3:95927367-95927389 TGAACTCAGCTTTTAACTGCTGG + Intergenic
958936788 3:100263731-100263753 TGAATTGTGTCATAAACTGGCGG + Intronic
960534271 3:118799449-118799471 TGATCTCTGTTTTTAGCTGTGGG + Intergenic
961593522 3:127998571-127998593 TGAACTCTGTTTCAGCCTAGAGG + Intergenic
963651621 3:147988080-147988102 TAAACTTTTTTTTAATCTGGTGG - Intergenic
964657083 3:159079222-159079244 TGAACTCTGTTTTAAACTGGGGG - Intronic
969632500 4:8346717-8346739 TGAACACTGGGTTAAAATGGGGG + Intergenic
969845786 4:9919034-9919056 TGAATTCTGTTTAGAACTGATGG + Intronic
977308543 4:95355614-95355636 TAAACTCTGTTTCATGCTGGGGG - Intronic
977646709 4:99420858-99420880 TGATTTGTGTTTTTAACTGGAGG - Intronic
977786439 4:101040566-101040588 TGAACTCTGTTTGAAAATACAGG - Exonic
978467570 4:109025648-109025670 TGAAGCCTGTTTTAAAATGAGGG + Intronic
979469263 4:121074664-121074686 TGAGTTCTGTCTTAAACTTGTGG + Intergenic
980331212 4:131414256-131414278 TAAACTCTGTTTGAAAAAGGCGG - Intergenic
980446117 4:132910154-132910176 TGAAAACTTTTTAAAACTGGGGG - Intergenic
980474074 4:133287982-133288004 TCAACTATGTTGTAAAATGGAGG - Intergenic
982539031 4:156644307-156644329 TGAAGTCAATTTTAAATTGGTGG - Intergenic
982911878 4:161152647-161152669 TGAAGTCTGTTTTAAACATTTGG + Intergenic
984876704 4:184374870-184374892 TGATTTCTGTTTTATATTGGTGG + Intergenic
986364561 5:7017666-7017688 TCAACTCTGTTTTAAATGTGAGG + Intergenic
988477788 5:31602895-31602917 TGAATTGCGTTTTAAAGTGGAGG - Intergenic
989230358 5:39079074-39079096 TGAACTCCTTTTTAAATTGATGG + Intergenic
989508966 5:42261085-42261107 TGAACACTAATTTAAACTGTGGG + Intergenic
989980180 5:50633994-50634016 TGAACCCTAATGTAAACTGGGGG + Intergenic
990511987 5:56497905-56497927 GGAAATCTGTCTGAAACTGGTGG + Intergenic
993218443 5:85057723-85057745 TGAAATATGTATTACACTGGTGG - Intergenic
993697338 5:91077472-91077494 TGAACTCTGTTTGAAATTAAGGG - Intronic
994010717 5:94899194-94899216 TGACATCTGTTTTATACTGATGG + Intronic
995527897 5:113065170-113065192 TGAACTCTGATGTAAACTATGGG + Intronic
998058054 5:139096273-139096295 GGAACTCAGGTTTAAACTGCCGG - Intronic
999186050 5:149709783-149709805 AGAACTAGGTATTAAACTGGGGG - Intergenic
1000785086 5:165533210-165533232 TCAATTCTGCTTTAAACTGTTGG - Intergenic
1002944089 6:1744573-1744595 TGAACACTGTTAAACACTGGGGG + Intronic
1004002922 6:11612151-11612173 TGAAAACTGTTTAAAAGTGGGGG - Intergenic
1007605810 6:43117158-43117180 TGAATGCTCTTTTAAACAGGTGG - Intronic
1008895458 6:56548674-56548696 TGCACACTGTTATAAATTGGTGG - Intronic
1009920584 6:70054874-70054896 TAAAATATATTTTAAACTGGAGG + Intronic
1010389986 6:75325784-75325806 TGAACACTTTTTTACACTGCTGG + Intronic
1010478906 6:76324873-76324895 TGAACTGTGTTTTAAATTAAGGG + Intergenic
1011417307 6:87135993-87136015 TGAACTCTTTTATAAAGTGAAGG - Intergenic
1012382734 6:98639719-98639741 AGAACATTGTTTTAAACTGGAGG - Intergenic
1012777630 6:103518066-103518088 TGAACTCTAATTTAAACTATTGG - Intergenic
1014107213 6:117580335-117580357 TTATCACTGTTTTAAACTGAGGG - Intronic
1015498499 6:133906365-133906387 TGAGCTCTGTTTACAACTAGAGG + Intergenic
1016140333 6:140600785-140600807 TGAGCTCTTTTTTACCCTGGGGG + Intergenic
1016264632 6:142217296-142217318 TGAACTTAGTTTTAAAATGTGGG + Intronic
1017088359 6:150736010-150736032 TCAACTGTGTTTTACACTAGGGG + Intronic
1017180593 6:151548127-151548149 TAAACTCTGTTTTAGACCTGGGG - Intronic
1017289861 6:152723347-152723369 TGAGCTTGGTTTTAAACTTGAGG - Exonic
1018124149 6:160665781-160665803 TGGATACTGTTTTAAACGGGAGG - Intergenic
1018934812 6:168266713-168266735 TGAACTCTTTTTTAAGCTAAGGG - Intergenic
1023679748 7:42673537-42673559 TGAGCTGTGTTTTCACCTGGAGG + Intergenic
1024219421 7:47276399-47276421 TGAACTCTGCTTTAAAGTGAGGG - Exonic
1026835190 7:73634054-73634076 CGAACTGTGTCTTTAACTGGCGG + Intergenic
1027440642 7:78215748-78215770 GCCACTCTGTTTTAAAGTGGAGG + Intronic
1028480983 7:91304247-91304269 TGAAATGTGTTTGAAACTGAGGG - Intergenic
1028606162 7:92658143-92658165 TAAACTCTGTTTTTAGCTTGAGG - Intronic
1032800867 7:135316438-135316460 GGAACTGGGTTATAAACTGGGGG - Intergenic
1033590800 7:142806655-142806677 TGAACTGTGATTAAAACTGTTGG - Intergenic
1035874927 8:3177733-3177755 TGAACTCAGTATTGATCTGGTGG - Intronic
1035963388 8:4162763-4162785 TGAACCCTATTGTAAACTGGGGG - Intronic
1036165577 8:6429669-6429691 TGACCTCTGGTTAAATCTGGTGG - Intronic
1038389677 8:27183963-27183985 TGAATTCTCTTTTAATCTAGAGG + Intergenic
1038602000 8:28953880-28953902 ACAACTCTTTTTTTAACTGGTGG - Intronic
1038624260 8:29175430-29175452 TTTCCTCTGTTTTAAAATGGAGG + Intronic
1040955177 8:52972383-52972405 TGAAGATTGTTTTAAACTGAAGG - Intergenic
1040960792 8:53030484-53030506 TGAATTCTGTATCAAACTGAGGG + Intergenic
1041411902 8:57565259-57565281 CCCTCTCTGTTTTAAACTGGAGG + Intergenic
1043296033 8:78665313-78665335 TGAACTCTGTTAGAGACGGGCGG + Intergenic
1044418717 8:91966400-91966422 TAAAGGCTGTTTTAATCTGGGGG + Intronic
1045964462 8:108008343-108008365 TGAACTCTGTGTTAAATAGATGG - Intronic
1047020753 8:120772772-120772794 TGATCCCTGTTTTAGACTAGAGG - Intronic
1047023453 8:120802407-120802429 TGAAATCTGTATTAAAATGCTGG - Intronic
1047395640 8:124496358-124496380 TGAACCCTGATGTAAACTGTGGG - Intronic
1049717995 8:144102647-144102669 AGAACTCTGTCTTAAGCAGGAGG + Intronic
1049754468 8:144303566-144303588 TGAACTGTATTTAAAACTTGTGG + Intronic
1050696482 9:8285118-8285140 TGAACGTTGTTGTAGACTGGGGG + Intergenic
1051541089 9:18218446-18218468 TGAACTTTTTTTTAAAGTGTAGG - Intergenic
1053634602 9:39983866-39983888 TGCCCTGTGTTGTAAACTGGGGG - Intergenic
1053771326 9:41480467-41480489 TGCCCTGTGTTGTAAACTGGGGG + Intergenic
1054209285 9:62266831-62266853 TGCCCTGTGTTGTAAACTGGGGG + Intergenic
1054315530 9:63581299-63581321 TGCCCTGTGTTGTAAACTGGGGG - Intergenic
1057091867 9:92265550-92265572 TGAACTTTGTTTTTGACAGGTGG - Exonic
1057572329 9:96214123-96214145 GGATCTCTGTTTAAAACTGTGGG + Intergenic
1057692090 9:97294284-97294306 TGAACTCTCTTTTGACCAGGGGG - Intergenic
1058561172 9:106230792-106230814 CGAACTCTGTTTTAAACAAAAGG - Intergenic
1186972229 X:14860051-14860073 TGTCCTCTATTTTAAACTTGAGG - Intronic
1189645122 X:43119950-43119972 TGAAGTCTCTTTTAAATGGGAGG + Intergenic
1191724586 X:64266355-64266377 TGCACACCGTTTTAATCTGGAGG - Intergenic
1192083185 X:68068000-68068022 TGAATTCTGTTTTATAGTGAAGG - Intronic
1193410429 X:81156394-81156416 TCAACTCTGATTTAAACTTTAGG - Intronic
1194377120 X:93150489-93150511 TAAACTCTGTTTTATATTGGGGG + Intergenic
1195053149 X:101116797-101116819 TGAACCCTGTTATAGACTGCTGG - Intronic
1197129076 X:122983186-122983208 TGAACTGTTTTTCAAACTGTGGG - Intergenic
1197563123 X:128048218-128048240 AGATCTCTGTGTTAATCTGGAGG + Intergenic
1201061573 Y:10051198-10051220 TGAAGGCAGCTTTAAACTGGAGG + Intergenic