ID: 964659950

View in Genome Browser
Species Human (GRCh38)
Location 3:159109257-159109279
Sequence AAATTACCACAGTTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 307}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964659950_964659956 17 Left 964659950 3:159109257-159109279 CCTTTCTCCAACTGTGGTAATTT 0: 1
1: 0
2: 1
3: 21
4: 307
Right 964659956 3:159109297-159109319 TTTCTGTCAGGCTTACTTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 174
964659950_964659952 5 Left 964659950 3:159109257-159109279 CCTTTCTCCAACTGTGGTAATTT 0: 1
1: 0
2: 1
3: 21
4: 307
Right 964659952 3:159109285-159109307 TGTAAATCCACCTTTCTGTCAGG 0: 1
1: 0
2: 1
3: 36
4: 555
964659950_964659955 16 Left 964659950 3:159109257-159109279 CCTTTCTCCAACTGTGGTAATTT 0: 1
1: 0
2: 1
3: 21
4: 307
Right 964659955 3:159109296-159109318 CTTTCTGTCAGGCTTACTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964659950 Original CRISPR AAATTACCACAGTTGGAGAA AGG (reversed) Intronic
903729770 1:25483955-25483977 AAATTAACCCAGTTGCAGACAGG + Intronic
904384180 1:30130847-30130869 TAATTCCCAGTGTTGGAGAAGGG - Intergenic
905303514 1:37001845-37001867 AAATTACCACTGTGGGTGACCGG + Intronic
905606548 1:39305575-39305597 ACATAACCACATTTGGAAAACGG - Intronic
906353607 1:45084310-45084332 TAATCCCCACTGTTGGAGAAGGG - Intronic
906575921 1:46889626-46889648 AAATTATCAAAGTTGGAGTTAGG + Intergenic
906596053 1:47078268-47078290 AAATTATCAAAGTTGGAGATAGG - Intronic
906709217 1:47916654-47916676 AAATCCACACAGGTGGAGAAGGG + Intronic
907935591 1:59039236-59039258 GAATGACCACAGTTTGAGCAGGG - Intergenic
910730495 1:90390707-90390729 AACATGCCACAGTTGTAGAATGG - Intergenic
910785356 1:90991789-90991811 TAATTCCCAATGTTGGAGAAGGG - Intronic
910835037 1:91500422-91500444 AAATTAGCACAGTGGCAGGAAGG - Intergenic
912122413 1:106488623-106488645 AACTTCCCACATTTGAAGAAAGG - Intergenic
912829607 1:112940420-112940442 AAAAAACCACACTTTGAGAACGG + Intronic
914427008 1:147586758-147586780 AAATTTCTACAGGTGGAGAGGGG - Intronic
915660939 1:157404307-157404329 TAATTCCCAGTGTTGGAGAAGGG - Intergenic
916378635 1:164183938-164183960 ACATATCCACTGTTGGAGAATGG - Intergenic
917737176 1:177932056-177932078 AAAATACAACATTTGGAGATGGG + Intronic
917780928 1:178396171-178396193 GAATTACCACAGATTGAGGAGGG - Intronic
918864972 1:189883821-189883843 AAAGTAATACAATTGGAGAAAGG - Intergenic
919963474 1:202496552-202496574 AATCAACCACAGTTGGAAAAGGG - Intronic
921188042 1:212686446-212686468 AAATTCCCAGAACTGGAGAAGGG + Exonic
923765016 1:236884988-236885010 GAATTAGCACAGTTGGTGAAGGG + Intronic
924787696 1:247214488-247214510 GAATTATCACAGGTGGAAAAGGG - Intergenic
1064577446 10:16760630-16760652 AAAATACAACAGATGGAGACAGG - Intronic
1065109479 10:22425659-22425681 AAATCACAGCAGTTGGAGGATGG - Intronic
1066409281 10:35150447-35150469 AAATTACCATATTTAGATAATGG - Intronic
1066432488 10:35364880-35364902 AAATTTCCACACTTAGAGAAGGG - Intronic
1067159691 10:43814539-43814561 AAATGACCACAGCTGCACAATGG - Intergenic
1069452984 10:68532084-68532106 AAAAAACCATAGTTGGAGACCGG - Intergenic
1069566878 10:69469356-69469378 AAATTATCAAACTTGGAGAAGGG + Intronic
1071573224 10:86709321-86709343 AAACTAACCCAGTTGGAGGAGGG + Intronic
1071736921 10:88311172-88311194 AATTTACTATAGTTTGAGAAGGG + Intronic
1072780550 10:98248399-98248421 AAATAACAACAGATGAAGAAAGG + Exonic
1073001012 10:100286322-100286344 AAATTATGGCAGATGGAGAATGG - Intronic
1074470701 10:113724009-113724031 AAATTAGGACAGTTAGAAAATGG - Intronic
1077711130 11:4538221-4538243 AAACTACAACAGTGGGGGAAGGG - Intergenic
1077738717 11:4820669-4820691 AAAGTAAGAAAGTTGGAGAAAGG - Intronic
1077744898 11:4891470-4891492 AAATTCCCAATGTTGGAGATGGG - Intronic
1079339851 11:19602864-19602886 AAACAACCACATTTGGAAAAAGG - Intronic
1079743442 11:24094123-24094145 AAATTACAACAGTTTGGGAGAGG + Intergenic
1081273724 11:41120760-41120782 TAATTACCAATGTTGGAGGAGGG + Intronic
1081276329 11:41153792-41153814 ATATTACCTCATTTGGAAAAAGG + Intronic
1082217531 11:49591484-49591506 AAATTACCACATTTCAAAAAAGG + Intergenic
1082721794 11:56686842-56686864 AAAATAGCAAAGTTGGAGACTGG + Intergenic
1082728800 11:56770004-56770026 TAACTCACACAGTTGGAGAAGGG + Intergenic
1082926141 11:58549618-58549640 AAATTATAAATGTTGGAGAAAGG + Intronic
1084422885 11:69069344-69069366 AAGTTACCGCAGTGGGAGCAGGG + Intronic
1086178944 11:83926699-83926721 ACATTACTAGAGTTGGATAAGGG + Intronic
1086632043 11:89032670-89032692 AAATTACCACATTTCAAAAAAGG - Intronic
1087344496 11:96953971-96953993 AAATTTAAACAGTTGGAAAAAGG + Intergenic
1087650947 11:100866764-100866786 TAATTCCCACTGTTGGAGGAGGG - Intronic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1088205930 11:107392317-107392339 TAATTACTAGAGTTGGAAAATGG + Intronic
1089129104 11:116198633-116198655 AAATTACAAAGGTTGGAGAAAGG + Intergenic
1089355087 11:117844221-117844243 AAATTACCACCTTTTGATAAAGG - Intronic
1089890350 11:121874572-121874594 AAATTACCACACTTTTAAAAAGG + Intergenic
1090160402 11:124487380-124487402 AAATACCCACAGTTAGAAAACGG + Intergenic
1090686901 11:129131670-129131692 TAATTCCCAAAGTTGGAGGAGGG - Intronic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1092853978 12:12655850-12655872 AAATGATCACATTTGTAGAATGG + Intergenic
1093563819 12:20577970-20577992 AATTTACCAGAGTGGGAGAGGGG + Intronic
1095466483 12:42492572-42492594 AAATTCCTACAGTTGCAGAAAGG - Intronic
1097397736 12:59096356-59096378 AAATTAAGACATCTGGAGAAAGG + Intergenic
1099294993 12:80819288-80819310 AAATTAACACATTTGAAAAAAGG - Intronic
1099754501 12:86826424-86826446 AAATTACCATATTTGTAAAATGG - Intronic
1100273335 12:93047260-93047282 AAAATAGCAGAGTTGGAGGATGG - Intergenic
1101249667 12:102919602-102919624 TAATTACCAGAGGTGGGGAAGGG - Intronic
1103133279 12:118486775-118486797 AAATTACCAAAATTAGAGGAGGG - Intergenic
1104101873 12:125620348-125620370 AAATTCACACAGTTTGGGAAAGG - Intronic
1104198480 12:126564603-126564625 ATATTACTACAGTGGGGGAATGG + Intergenic
1104514105 12:129407920-129407942 AAATGACCACAGATGGACAGTGG + Intronic
1106048811 13:26170788-26170810 AACTTACAAAGGTTGGAGAAAGG + Intronic
1106448654 13:29860058-29860080 TGGTCACCACAGTTGGAGAATGG + Intergenic
1106487868 13:30188540-30188562 CAATTAAAACACTTGGAGAACGG + Intergenic
1106752928 13:32793589-32793611 AAATTGCTACAGATGGAGATGGG - Intergenic
1107020532 13:35746521-35746543 AAATTACCATGGTTGGGGAATGG - Intergenic
1107389991 13:39953845-39953867 AACCCACCAAAGTTGGAGAAAGG + Intergenic
1108705994 13:52987861-52987883 AAATTACCACAGTTTAATTATGG - Intergenic
1110493118 13:76132947-76132969 AATTTAGCACAGTTGAAGAATGG - Intergenic
1110786237 13:79530410-79530432 AAATTGCCACAGCTGGAGCTGGG - Intronic
1110867653 13:80414857-80414879 AAATTACCAGAGACAGAGAAAGG - Intergenic
1111109633 13:83689615-83689637 ACATTTCCAATGTTGGAGAAGGG - Intergenic
1112638375 13:101243733-101243755 GAATTACTCCAGGTGGAGAAGGG - Intronic
1113391819 13:109905118-109905140 AAATTGCCAGTGTTGGAGGAGGG + Intergenic
1114376672 14:22153746-22153768 AAATAAGCACATATGGAGAATGG - Intergenic
1115386924 14:32808422-32808444 AAATTATCAAGGGTGGAGAAAGG + Intronic
1116252024 14:42498730-42498752 TAATTCCCACTGTTGGAGATGGG + Intergenic
1116360575 14:43991396-43991418 AAATTACCTTAGAAGGAGAATGG + Intergenic
1116425172 14:44782105-44782127 ATATTAACAAGGTTGGAGAAAGG - Intergenic
1116694227 14:48151113-48151135 TAATTCCCAATGTTGGAGAAGGG + Intergenic
1117268179 14:54112959-54112981 TAATCCCCAAAGTTGGAGAAGGG + Intergenic
1117718075 14:58601083-58601105 AACGTACCACAGATAGAGAATGG - Intergenic
1118546088 14:66890777-66890799 AATATACCACAGTAGCAGAATGG + Intronic
1119027060 14:71162229-71162251 TAATTACCACAGGCTGAGAAGGG + Intergenic
1119413504 14:74454082-74454104 AAAGTCACACAGTTAGAGAATGG + Intergenic
1120002515 14:79318572-79318594 ACATGACAACAGCTGGAGAATGG - Intronic
1122419948 14:101569518-101569540 AAATAACCCCAGTTAAAGAAAGG + Intergenic
1123175958 14:106419247-106419269 ATATTTCCAAATTTGGAGAAGGG + Intergenic
1123805007 15:23861475-23861497 AAAATGCCACAGTTAGAGCAGGG - Intergenic
1123879208 15:24659216-24659238 AAGTTATCACAGATGAAGAAGGG - Intergenic
1128570631 15:68730748-68730770 AAAGCACCCCAGGTGGAGAAGGG + Intergenic
1129912273 15:79238259-79238281 AAATTGCAACAGCTGGAAAATGG + Intergenic
1130861480 15:87894698-87894720 ACATACCAACAGTTGGAGAAGGG - Intronic
1132142110 15:99404871-99404893 AAAGTACTGCAGTGGGAGAAAGG - Intergenic
1133079527 16:3307404-3307426 AACTTACCCCCCTTGGAGAAGGG + Intronic
1133562303 16:6961354-6961376 AAATTACTACAGTTTGAACACGG - Intronic
1139502490 16:67378646-67378668 AAAATTCAACAGTTGGAGGAAGG + Exonic
1142801270 17:2347441-2347463 AAACTACCACTGTTGGGGAGAGG + Intronic
1143245700 17:5484196-5484218 ATCTTACCATAGTTGGAGTAGGG - Intronic
1144301577 17:13926377-13926399 AGATTTCCTCAGTTGGAGCACGG - Intergenic
1144611184 17:16717531-16717553 AAACTACTCCACTTGGAGAATGG - Intronic
1145130956 17:20348237-20348259 AAACTACTCCACTTGGAGAATGG - Intergenic
1146284753 17:31566937-31566959 AAAATACCACATTTCGACAATGG + Intergenic
1146577566 17:34008153-34008175 TAATTACTGCATTTGGAGAATGG - Intronic
1147529663 17:41263535-41263557 AAGCAACCACAGTTGGACAATGG - Intergenic
1149807700 17:59634564-59634586 AAGCAACCACAGTTGGAGAGAGG - Intronic
1150323639 17:64237713-64237735 AAATTCCCAGACTTGGTGAATGG - Intronic
1153404200 18:4717587-4717609 AAATTACCACATATGGCTAATGG - Intergenic
1153497513 18:5714931-5714953 ACAATACCAAAGTTGGAGAGAGG - Intergenic
1153669432 18:7396378-7396400 AGATTACCACATCTGGTGAAGGG + Intergenic
1153882017 18:9429511-9429533 AAACTAACACAGTTTGAGATTGG - Intergenic
1155036782 18:22031166-22031188 GAACTTCCACAGTTGGACAACGG - Intergenic
1155673665 18:28403234-28403256 TAATCACCACTGTGGGAGAAAGG + Intergenic
1155795596 18:30032852-30032874 TAATTACCACAATGGGAGGAAGG - Intergenic
1157272209 18:46284654-46284676 TAATTACCACAATTGCAGGAAGG + Intergenic
1158163063 18:54507790-54507812 AAATTACCACACTGGCAGTATGG + Intergenic
1159062829 18:63533812-63533834 AAATAAACATATTTGGAGAAGGG + Intergenic
1159169463 18:64746442-64746464 TAATGCCCACATTTGGAGAAAGG + Intergenic
1159237895 18:65700948-65700970 AATTTATCACAGTTGTAAAAAGG + Intergenic
1160127378 18:76189018-76189040 ACAAGAACACAGTTGGAGAAAGG - Intergenic
1161981783 19:7633765-7633787 GCATCCCCACAGTTGGAGAAGGG + Intronic
1164890707 19:31820887-31820909 AAAATACCACAGATGGAGGCAGG + Intergenic
1166583002 19:43919336-43919358 AGATGACCACAATTTGAGAAAGG + Intronic
1168544381 19:57238640-57238662 AAATGAGCATAGATGGAGAAAGG - Intergenic
925538422 2:4940709-4940731 AAATTACGACATGTGGAGATAGG - Intergenic
926666665 2:15531899-15531921 AAATAATCAGAGATGGAGAATGG - Intronic
926956854 2:18311181-18311203 TTATTACCCCAGTTGGAGACAGG - Intronic
927773527 2:25884282-25884304 TAATTCCCACTGTTGGAGGAGGG + Intergenic
928238476 2:29565855-29565877 AAATTAACACAGTTAAAAAAGGG + Intronic
928646782 2:33362624-33362646 AAGTTAACACAGATGGAAAATGG - Intronic
928859784 2:35843735-35843757 AAATTGCTCCATTTGGAGAAGGG + Intergenic
929643965 2:43609140-43609162 AAATTACCAGGGTTGCAGGAAGG - Intergenic
929905551 2:46042967-46042989 AAACTACCACAATTCTAGAAGGG - Intronic
931063017 2:58552392-58552414 AAATTATAACTGTTAGAGAAAGG - Intergenic
932283480 2:70514264-70514286 ATATTAACACACATGGAGAAAGG + Intronic
932811838 2:74832848-74832870 ACATTAGCACTGGTGGAGAATGG - Intergenic
932971513 2:76548926-76548948 AAATGTCCACAGTTGGAGACAGG + Intergenic
934164477 2:89281730-89281752 AAATGACGACAGCAGGAGAATGG + Intergenic
934202797 2:89900794-89900816 AAATGACGACAGCAGGAGAATGG - Intergenic
934777548 2:96948999-96949021 AAGTTACAACAGGAGGAGAAAGG - Intronic
935066123 2:99650108-99650130 AAGTTTCCACAGTTGGAATATGG + Intronic
935437703 2:103054670-103054692 AATTTACCAAACTTAGAGAAAGG - Intergenic
935572028 2:104671679-104671701 ACATTTGCACAGTTGGTGAATGG - Intergenic
935718144 2:105956782-105956804 AAATTTCCACAGTTCAATAAAGG - Intergenic
939566070 2:143787995-143788017 GGATTACAACAGTTGTAGAATGG + Intergenic
939952683 2:148494139-148494161 AAATTACCACAATTCCATAATGG - Intronic
940811234 2:158245051-158245073 AAATTCCCACACTGGGAGAATGG + Intronic
941709945 2:168701433-168701455 AAATTTCAACACTGGGAGAAAGG - Intronic
942199736 2:173559138-173559160 AATTTACCACAGGGGGAGGATGG - Intergenic
943293182 2:186102041-186102063 AAAGTATCACAGTTGTAGTAGGG - Intergenic
943719788 2:191191762-191191784 AGATTCCTAGAGTTGGAGAAAGG - Intergenic
943893943 2:193329266-193329288 ATAATACCACAGATTGAGAAGGG - Intergenic
943977295 2:194500232-194500254 AAAATAGCAAAGTAGGAGAAAGG - Intergenic
944421410 2:199534836-199534858 AAATTTTTACTGTTGGAGAATGG - Intergenic
945122633 2:206473386-206473408 TAATTACCAAATTTGGAGTAAGG - Intronic
946042538 2:216794961-216794983 TAATTACCAGAGTTTGGGAAGGG + Intergenic
947067252 2:226241566-226241588 AAATGCCCTCAGTTGGTGAATGG - Intergenic
947079999 2:226385485-226385507 AAAAAAGCACAGTTGGAGGATGG - Intergenic
948383094 2:237564458-237564480 AAAGTGCCACAGGTGGAGGAAGG + Intergenic
1168790190 20:571018-571040 AAAAAACCACATTTTGAGAAGGG - Intergenic
1170904218 20:20497773-20497795 GAATTGCCACACTGGGAGAATGG - Intronic
1172021070 20:31914524-31914546 AGATTAACACAGTTTGATAACGG - Intronic
1172478442 20:35256280-35256302 AAGGTCCCACAGTTGGTGAATGG + Intronic
1174075583 20:47933432-47933454 AAATTACCAGAAGTGCAGAAAGG - Intergenic
1174967929 20:55240300-55240322 TAATTTCCAGTGTTGGAGAAGGG + Intergenic
1177399597 21:20585605-20585627 AAATTTCCTCAGTTTGAGAAAGG + Intergenic
1177707854 21:24732386-24732408 AAATAAATACAGTTGCAGAAAGG - Intergenic
1177891456 21:26808863-26808885 AATTTACCTCAGGTGGAAAAGGG - Intergenic
1178468237 21:32868864-32868886 CAATGACCACAGGAGGAGAATGG + Intergenic
1179615249 21:42579376-42579398 AAATGTCCACAGTGGGAAAAAGG - Intronic
1179946390 21:44680841-44680863 ATATTACCAGAGGTGAAGAACGG + Intronic
1182382532 22:29904153-29904175 AAATTAACACCGTGGGAGTATGG + Intronic
1184544344 22:45156317-45156339 AAGTGACTACATTTGGAGAAAGG + Intergenic
1185183940 22:49381379-49381401 AAATCACCACACTTGAAGATTGG - Intergenic
950151607 3:10691820-10691842 ATATTTCCATAGTTGCAGAAAGG + Intronic
950346659 3:12301277-12301299 TTAGTACCACAGTTGGAGAAAGG + Intronic
950671850 3:14532100-14532122 AAGTTCCCACAGCTGGCGAATGG - Intronic
950697233 3:14712041-14712063 ATATTACCACATTTGGAAATAGG + Intronic
950938377 3:16866740-16866762 ATATTGCCACATTTGGAGACAGG - Intronic
952117793 3:30203419-30203441 AGACTAAGACAGTTGGAGAAAGG + Intergenic
952458391 3:33497382-33497404 AAATTACCAGTTTTGGTGAAAGG - Exonic
952738286 3:36711375-36711397 AAAGTACCTCTGTTGCAGAAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953772506 3:45789476-45789498 AAACTTCCACAACTGGAGAATGG + Intronic
953992046 3:47491543-47491565 TAATTCCCACTGTTGGAGATGGG - Intergenic
956055367 3:65293020-65293042 AAAATAACACAGATAGAGAAAGG + Intergenic
956622124 3:71232227-71232249 AAATCACAACAATTAGAGAAGGG + Intronic
956960541 3:74394700-74394722 AAACTAACAAAGTTAGAGAAAGG + Intronic
957129939 3:76210267-76210289 AAAGTAGCACATTTGGAAAAGGG - Intronic
960039386 3:113134183-113134205 AATTTGCCAAAGTTGTAGAAAGG + Intergenic
960690261 3:120339765-120339787 AATTTCCCACAGTTAAAGAAAGG - Intronic
960784603 3:121358268-121358290 AAATTACCAGAGGGTGAGAAGGG - Intronic
961844842 3:129753073-129753095 ACATTCCCAGAGTTGGAGGAAGG - Intronic
962096023 3:132293569-132293591 TAATCACCAATGTTGGAGAAGGG - Intergenic
962745101 3:138391106-138391128 AAATTGCCAGAGTAGGAGGAGGG - Intronic
964553279 3:157909017-157909039 AAGATACCACTTTTGGAGAATGG - Intergenic
964659950 3:159109257-159109279 AAATTACCACAGTTGGAGAAAGG - Intronic
964693239 3:159477615-159477637 AAAATAACACAGTTAAAGAATGG - Intronic
965756095 3:172029111-172029133 TAATTACCAATGTTGGAGATGGG + Intergenic
966077797 3:175959566-175959588 AATTTCTCACAGTGGGAGAAAGG - Intergenic
966905688 3:184524224-184524246 AAATTTTCACAGCAGGAGAATGG + Intronic
969270900 4:6100475-6100497 AAATGTCCTCAGTTGGTGAATGG - Intronic
970261389 4:14228580-14228602 AAAGTACTACACTTGGAGACTGG + Intergenic
970846116 4:20539530-20539552 AAATTACTACAGTTGCACCAGGG + Exonic
971190934 4:24428412-24428434 AAAATGCTACATTTGGAGAATGG + Intergenic
971845271 4:31910990-31911012 TGATTACCAGAGGTGGAGAAAGG - Intergenic
972882602 4:43444911-43444933 AAATTACAACTGTTTGAAAAGGG + Intergenic
973580217 4:52336498-52336520 AAAGTAACACAGTTGGGAAATGG - Intergenic
973750252 4:54010394-54010416 AAATCACCAAAGTCTGAGAAGGG + Intronic
974805520 4:66874988-66875010 AAATTACCACAGTTAAAACATGG - Intergenic
980730585 4:136819181-136819203 AAAGTAGCACTGTTGGAAAAAGG + Intergenic
981731411 4:147903043-147903065 CAATTCCCAAAGTTGGAGAAGGG - Intronic
982850622 4:160310828-160310850 AAATAAACACAGCTGGAGAAAGG - Intergenic
982964466 4:161886257-161886279 AAATGTCCACACTTTGAGAAGGG - Intronic
983391968 4:167143383-167143405 ATATTATCACACTTGGAGATAGG - Intronic
983706446 4:170666070-170666092 CAGTTGCCACAGTAGGAGAATGG + Intergenic
984085108 4:175300799-175300821 TAATTCCCAAAGTTGGAGGAGGG + Intergenic
985209425 4:187576457-187576479 ATTTTACCACAGTTGCAAAAAGG + Intergenic
985653374 5:1117304-1117326 AAATTATCACCGTTGGTGGAAGG + Intergenic
986218834 5:5748125-5748147 AAATTACCACAGTTGTATAAGGG + Intergenic
987907921 5:24103099-24103121 CATTTTCCACTGTTGGAGAATGG - Intronic
989647416 5:43650245-43650267 AAATTACTACTGTGGGAAAAGGG - Intronic
991186428 5:63814346-63814368 TAATTCCCACTGTTGAAGAAGGG + Intergenic
991447682 5:66717571-66717593 AAATTTCCCAAGTTGGAAAAAGG + Intronic
993492728 5:88571432-88571454 AAATATCCATAGGTGGAGAAGGG + Intergenic
993755714 5:91727120-91727142 AAATTAACACAGTAAGATAAGGG + Intergenic
995042628 5:107606215-107606237 ATAATACCACAGTTTGGGAAAGG - Intronic
995404874 5:111783600-111783622 AAACTTCCTCAGATGGAGAAGGG - Intronic
995981704 5:118112285-118112307 AAATCATCACAGAAGGAGAAAGG - Intergenic
996147831 5:119997064-119997086 AAATTACCTGAGTTGGAGATGGG + Intergenic
997520415 5:134520038-134520060 AAAGTAACAGAGCTGGAGAATGG + Intergenic
997739625 5:136242258-136242280 AAATGACCACAGGTGAGGAAAGG - Intronic
999544292 5:152609813-152609835 AATTTACCACACTTAGAAAAAGG + Intergenic
1000567450 5:162867520-162867542 AAATTCCCAATGTTGGAGATGGG + Intergenic
1000649131 5:163794200-163794222 AACTTCCCACAGTGGGAGATTGG - Intergenic
1000938245 5:167329006-167329028 ACATGACAATAGTTGGAGAAAGG + Intronic
1001346999 5:170912348-170912370 AAATTACCATTGTAGGAAAATGG + Intronic
1002681119 5:180965565-180965587 AAAATAACACAGTTGTAAAACGG + Intergenic
1007172673 6:39875211-39875233 AGCTTACCATAGGTGGAGAAGGG + Intronic
1008225776 6:48914210-48914232 AAATAAACAAAATTGGAGAATGG - Intergenic
1008235719 6:49046534-49046556 AAATTCCCACACTTCCAGAATGG - Intergenic
1009412540 6:63382876-63382898 AAGTTACAACAGTTCAAGAATGG + Intergenic
1009438848 6:63651716-63651738 TGATTACCAGAGTTGGGGAAGGG - Intronic
1009663441 6:66645874-66645896 AAGTTTCCAAATTTGGAGAAAGG - Intergenic
1009702231 6:67199951-67199973 AAATAACCTCTGTTGAAGAATGG + Intergenic
1010226989 6:73499332-73499354 AAATAACCACAATTGGCGAGTGG - Intronic
1010601456 6:77832981-77833003 AAATGAACACAGCTAGAGAAAGG - Intronic
1010929330 6:81781608-81781630 AAATTAAAACATTTGGAAAAAGG + Intergenic
1011996750 6:93599332-93599354 AAATTTCCAGTGTTGGAGCAGGG + Intergenic
1014064589 6:117110465-117110487 AAAATACCAAAGTTGGGGACAGG + Intergenic
1015360247 6:132331726-132331748 AAAGTACCACAGCTGGGAAAGGG + Intronic
1015656517 6:135524926-135524948 AATTGACCACAGTTGAAGAAAGG - Intergenic
1016662543 6:146598524-146598546 AAATTAACACAGTGGGTGTAAGG - Intergenic
1016693777 6:146968814-146968836 AAATAGCCACAGTTTGAGAATGG + Intergenic
1018117304 6:160599839-160599861 AACTTACTACAGTTCTAGAATGG - Intronic
1018119048 6:160617459-160617481 AACTTACTACAGTTCTAGAATGG - Intronic
1018119651 6:160623005-160623027 AACTTACTACAGTTCTAGAATGG - Intronic
1018120252 6:160628549-160628571 AACTTACTACAGTTCTAGAATGG - Intronic
1018121450 6:160639642-160639664 AACTTACTACAGTTCTAGAATGG - Intronic
1018122052 6:160645189-160645211 AACTTACTACAGTTCTAGAATGG - Intronic
1018775172 6:167008258-167008280 AAAATTCCACAGCTGGGGAAGGG - Intronic
1019131832 6:169882621-169882643 TAATTACCACAGTAGCATAAAGG + Intergenic
1020747446 7:12094912-12094934 GAATGCCTACAGTTGGAGAAGGG - Intergenic
1021858529 7:24882050-24882072 ATGTTACCACATTTGGAAAAAGG - Intronic
1022066134 7:26859385-26859407 AAATGCCCAAAGTTGGAAAATGG + Intronic
1023210727 7:37801937-37801959 AAATCAACACAGTTGAAGATAGG - Intronic
1023636477 7:42216185-42216207 AAATTACAACACTTTGAGACAGG - Intronic
1024084122 7:45879661-45879683 TAATTCCCACTGTTGGAGGAGGG - Intergenic
1024735930 7:52303706-52303728 AAATGACCACAGGATGAGAATGG - Intergenic
1028709848 7:93894290-93894312 CTATGACCACAGATGGAGAAAGG + Intronic
1029368106 7:100129263-100129285 AAATCATCACACTTGGGGAAGGG - Intergenic
1030733898 7:113021267-113021289 AAATAAGCACATATGGAGAATGG + Intergenic
1030811376 7:113976374-113976396 AAATAAGCACAGATGGAGAGTGG - Intronic
1031057515 7:117009810-117009832 AAGTAACCACAGCTGGAAAAAGG - Intronic
1031253537 7:119418120-119418142 ATATTACCACATCTGGACAACGG + Intergenic
1031293303 7:119967235-119967257 AAATATCCAGGGTTGGAGAAGGG + Intergenic
1031396285 7:121278262-121278284 AAAGAAGGACAGTTGGAGAAAGG + Intronic
1032437982 7:131917447-131917469 AAATTACCATAGATAAAGAAGGG + Intergenic
1033948968 7:146759886-146759908 AAAGTATCACAGTAAGAGAAAGG + Intronic
1034719453 7:153276177-153276199 GAATTACCAAAGTTGAAGATAGG + Intergenic
1035671144 8:1417983-1418005 AAATCAGCACGTTTGGAGAATGG + Intergenic
1035797366 8:2370678-2370700 ACAAGACCACAGATGGAGAAGGG - Intergenic
1036026142 8:4911248-4911270 AAATTACGACTGGTGGACAAAGG - Intronic
1036043489 8:5113299-5113321 AAACTTCCACTGGTGGAGAATGG + Intergenic
1037565969 8:20118835-20118857 TAATCTCCAAAGTTGGAGAAGGG + Intergenic
1037693243 8:21201679-21201701 GAAATACCACAGTTGTAAAAAGG + Intergenic
1039267756 8:35844284-35844306 AAATTACAACAATGGCAGAAGGG - Intergenic
1042005605 8:64177112-64177134 AAATAACCACATTTTGATAAGGG + Intergenic
1043085097 8:75819883-75819905 AATTTACCATAGGTGGACAAGGG - Intergenic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1043985214 8:86686792-86686814 ACAGTACCACAGCTGGAGAAAGG + Intronic
1044108700 8:88244666-88244688 AAATTCACACAGTTGGTAAAAGG + Intronic
1046093644 8:109532981-109533003 AAGTTTCCTCATTTGGAGAAGGG - Intergenic
1047440992 8:124878599-124878621 AAATGACCAGATTTGGAAAATGG + Intergenic
1047861142 8:128968324-128968346 AAAATATCACCTTTGGAGAATGG - Intergenic
1047922595 8:129650989-129651011 AAAGTACTACTTTTGGAGAATGG - Intergenic
1048610922 8:136022320-136022342 AAATTAGCATAGCAGGAGAATGG - Intergenic
1051054009 9:12962032-12962054 AAATTAGCACAGTTTGAAAGAGG - Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1058116544 9:101091254-101091276 AAATTAACACAGTGAGAGAGAGG - Intronic
1058338958 9:103870125-103870147 AAATTACCACACATCGAGAAAGG - Intergenic
1059458886 9:114417140-114417162 AAATCAACACAGTTTGTGAATGG + Intronic
1060707272 9:125815594-125815616 AAAGTACAACAGTTAAAGAAGGG - Intronic
1062162060 9:135086242-135086264 AAATTCCAACTGTTGGGGAAGGG - Intronic
1186217660 X:7317311-7317333 AACTTAGGAAAGTTGGAGAATGG - Intronic
1186623970 X:11272212-11272234 AAATTACCACAGGTGGATAGTGG + Intronic
1187552250 X:20317763-20317785 AAATGACAAAAGTTTGAGAATGG + Intergenic
1189881813 X:45501953-45501975 AAAATAGAACAATTGGAGAAAGG - Intergenic
1194464982 X:94222408-94222430 AATTTACTAGAGTTGGATAATGG + Intergenic
1194603965 X:95958378-95958400 TAATTCCCAATGTTGGAGAAGGG + Intergenic
1195465881 X:105178139-105178161 TAGTTACCAGAGTTGGGGAAGGG - Intronic
1195952413 X:110289204-110289226 AAATTGCCACATGTGGATAATGG - Intronic
1197874902 X:131092076-131092098 TAATAACCACTGTGGGAGAAAGG + Intergenic
1198837068 X:140816541-140816563 AAATTCCCAGAGTGTGAGAAGGG - Intergenic
1199024221 X:142918519-142918541 AAATGACCACAGGAGGAGACTGG - Intergenic
1199179517 X:144836804-144836826 AAAATAACACAGATGGAGGAGGG + Intergenic
1199598095 X:149524005-149524027 CAATTTCCACAGTCTGAGAAGGG + Intronic
1200393752 X:155970292-155970314 AAATTCCCAAAGTTGCAAAATGG - Intergenic
1201587674 Y:15579196-15579218 AACTTAGGAAAGTTGGAGAATGG - Intergenic