ID: 964664544

View in Genome Browser
Species Human (GRCh38)
Location 3:159157741-159157763
Sequence TTGTATGTGCATAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964664544_964664547 10 Left 964664544 3:159157741-159157763 CCTTCCACTTTATGCACATACAA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 964664547 3:159157774-159157796 ATTTCCTCTTATTTACACATGGG 0: 1
1: 0
2: 4
3: 35
4: 375
964664544_964664548 11 Left 964664544 3:159157741-159157763 CCTTCCACTTTATGCACATACAA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 964664548 3:159157775-159157797 TTTCCTCTTATTTACACATGGGG 0: 1
1: 0
2: 3
3: 55
4: 494
964664544_964664546 9 Left 964664544 3:159157741-159157763 CCTTCCACTTTATGCACATACAA 0: 1
1: 0
2: 0
3: 19
4: 190
Right 964664546 3:159157773-159157795 CATTTCCTCTTATTTACACATGG 0: 1
1: 0
2: 3
3: 22
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964664544 Original CRISPR TTGTATGTGCATAAAGTGGA AGG (reversed) Intronic
900646685 1:3712177-3712199 TTATATGTGCGTAAAGCTGAGGG + Intronic
905163793 1:36063690-36063712 ATGAATGTGAATAAATTGGAAGG + Exonic
906927715 1:50137044-50137066 TCGTATGTAGGTAAAGTGGAGGG + Intronic
909328674 1:74385840-74385862 ATGAAAGTGCATAAATTGGATGG + Intronic
909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG + Intergenic
910606218 1:89087654-89087676 TTGTAGGTACCTAAACTGGAAGG + Intergenic
910872965 1:91851899-91851921 CTGAATGTGCATATAGTGGAGGG - Intronic
911485204 1:98496977-98496999 TTGAATGTGTATAAAGTGTGTGG + Intergenic
911613124 1:99978673-99978695 TTTTGTGAGCAAAAAGTGGATGG + Intronic
915060986 1:153184799-153184821 CTGAATGTGCAAAAACTGGAAGG - Intergenic
915072426 1:153281617-153281639 TTGGATGTGGATGAAGAGGAAGG + Intergenic
915124515 1:153654313-153654335 TTGTATGTGCAGTAGTTGGATGG + Intergenic
916728559 1:167545629-167545651 TTGTATTTTCATAAAGAGGGTGG - Intronic
918393151 1:184087553-184087575 TTCTATGTGTAGAACGTGGAGGG + Intergenic
921906182 1:220497650-220497672 TAGAATGTGCATAAATTGCAGGG - Intergenic
924401310 1:243685344-243685366 TAATTTGTGCATAAAGTGTAAGG + Intronic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1064797707 10:19032231-19032253 AAGAATGTGCATAAAGTAGACGG - Intergenic
1067414508 10:46093246-46093268 TTGTGTGTGCATTCAGTGGGAGG - Intergenic
1067434570 10:46267788-46267810 TTGTGTGTGCATTCAGTGGGTGG - Intergenic
1068800022 10:61130193-61130215 TTCTTTGTGTATAAAATGGAAGG - Intergenic
1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG + Intergenic
1071854259 10:89607362-89607384 TTATATGGGCATAATGTGGTGGG + Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1079239450 11:18712310-18712332 TTGTGTGCACATGAAGTGGAAGG - Exonic
1081075504 11:38668038-38668060 TTATATGGGCACAAGGTGGAGGG + Intergenic
1082758333 11:57100354-57100376 TAGGTTGTGCACAAAGTGGAAGG - Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085590519 11:77755458-77755480 TTGTTTGTACATAAAGATGATGG + Intronic
1085874309 11:80387577-80387599 TTGTCTCTGCATTGAGTGGAAGG - Intergenic
1085902404 11:80717100-80717122 TTATATGAGCATAAAGCTGAAGG + Intergenic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1089781990 11:120879756-120879778 TCGCATGTGCAAAAACTGGAGGG - Intronic
1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG + Intronic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1096719661 12:53511747-53511769 TAGTATGTGCTTTATGTGGATGG - Intronic
1099028447 12:77495000-77495022 TTGAATGTGCAGACAGTGGGAGG + Intergenic
1100295694 12:93258825-93258847 TTGTGTATGCATGAAGAGGAAGG - Intergenic
1100459749 12:94787695-94787717 TGGTATGTACATACAGTGGAAGG + Intergenic
1100890123 12:99116119-99116141 TTTTATGTGCGTAAAGTGCTAGG + Intronic
1103646801 12:122400199-122400221 ATGAATGTGAATGAAGTGGAAGG - Intronic
1107227041 13:38063797-38063819 TTGTAAGTGCATTAAATGCATGG + Intergenic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1107742721 13:43469639-43469661 GTGTATGTTCATATATTGGAAGG + Intronic
1111603851 13:90510878-90510900 TGGTATGTCCATACAATGGAAGG + Intergenic
1112123700 13:96441073-96441095 TTGAATCTGCATATGGTGGAGGG - Intronic
1112702041 13:102021072-102021094 GTGTATGTGCCTTAAGTGGAGGG + Intronic
1114363262 14:21999524-21999546 TGGAAGGTGTATAAAGTGGAAGG - Intergenic
1115063254 14:29220704-29220726 CTGTCTGTGCATAGAGAGGAGGG + Intergenic
1115444468 14:33473333-33473355 TTGCATGTGAATCATGTGGAGGG - Intronic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1116854659 14:49941432-49941454 TTGTATGTCCATGCATTGGAGGG - Intergenic
1116923956 14:50613878-50613900 ATGTATTTACATAAAGTGGGAGG + Intronic
1118666733 14:68077988-68078010 TTATATGTACATAAGGTGGAAGG + Intronic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1127896075 15:63300014-63300036 TTATATGTGCATGAAATGGCAGG + Intronic
1128431517 15:67599638-67599660 TTGCATGGGCAGAAAATGGATGG - Intronic
1131464012 15:92640116-92640138 TTGTATCAGCATAAATTAGACGG + Intronic
1133703216 16:8328787-8328809 TTGTGTGTGCAATAAGTGAAAGG - Intergenic
1139878395 16:70164516-70164538 ATGAATGGGCAAAAAGTGGAGGG + Intergenic
1140359169 16:74330300-74330322 ATGAATGGGCAAAAAGTGGAGGG - Intergenic
1144389748 17:14783002-14783024 TTTAATGTGCATAGCGTGGAGGG + Intergenic
1146649638 17:34598636-34598658 TTTGATGTGCAGAAGGTGGAAGG + Intronic
1149875302 17:60226727-60226749 GTGTATGTACATAGAGTGAAGGG + Intronic
1152991691 18:369167-369189 TGGTATGTGCATTGAGTGGTAGG - Intronic
1153582887 18:6593150-6593172 TTGCAAATGCATAGAGTGGAAGG + Intergenic
1153795239 18:8615827-8615849 TTGTAAGTGCAGACAGTGAAAGG - Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1156111912 18:33738577-33738599 CTGTCTGTGCAGAAACTGGAAGG - Exonic
1156914765 18:42452739-42452761 TTGAATGTAGATAAAGTGGATGG + Intergenic
1157570316 18:48708051-48708073 TTATATGGCCATAAAGAGGAAGG - Intronic
1158731511 18:60029409-60029431 TGGTATATTCATAAAATGGATGG - Intergenic
1158795007 18:60835117-60835139 TTGTATGTAAATATAGTGCAAGG + Intergenic
1159435414 18:68410549-68410571 TTGCATTTGCATATAGTGCATGG - Intergenic
1159958993 18:74541109-74541131 TTGTAGGTTCTGAAAGTGGAGGG + Intronic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1163345226 19:16737042-16737064 TTCTATAGACATAAAGTGGAGGG - Intronic
1163823017 19:19507108-19507130 TTTTTTGTGCATAACTTGGATGG + Exonic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
926473206 2:13287829-13287851 TGGTATGTGCATAAGTTTGAAGG - Intergenic
926545128 2:14230567-14230589 TTGTATGTGGCTATAGTGAATGG + Intergenic
927005653 2:18845449-18845471 TCATATGGGCAGAAAGTGGAGGG - Intergenic
927693155 2:25222518-25222540 GTGTATGTGCATAAAACAGATGG + Intergenic
927745330 2:25614653-25614675 TACTATGTTCATAAAATGGAAGG + Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
929376977 2:41299298-41299320 GTGTATGTGCAGGAGGTGGAGGG - Intergenic
931910535 2:66894787-66894809 CTGCATCTGCATAAAGTGAAGGG + Intergenic
933279490 2:80317372-80317394 TTGTATATTCTGAAAGTGGAAGG - Intronic
934123553 2:88863889-88863911 TTGTAGGTGCAAAAACTTGAGGG + Intergenic
934791352 2:97064670-97064692 TTGTAAGTGCATAAAACTGAAGG + Intergenic
934815081 2:97317873-97317895 TTGTAAGTGCATAAAACTGAAGG - Intergenic
934822614 2:97390610-97390632 TTGTAAGTGCATAAAACTGAAGG + Intergenic
935100418 2:99989393-99989415 TTGTATGTCCATAAAGCTGATGG - Intronic
935609350 2:105004986-105005008 TTGTGTGTGCATAAAATTCATGG + Intergenic
937268969 2:120635113-120635135 TTGTATGTGCATTAATAGGTTGG - Intergenic
937465891 2:122132729-122132751 TTGAGTGTGCTTTAAGTGGAAGG + Intergenic
937630296 2:124094123-124094145 TGGTGTGTGAATAAAGGGGATGG + Intronic
938400328 2:130986100-130986122 TTGTGTGTGCATGTAGTGCATGG + Intronic
939815479 2:146891237-146891259 TTGCATGAGCATAAAGTAAAAGG + Intergenic
941689784 2:168488179-168488201 TGGTAAGTTCATAAAGTGAAGGG + Intronic
942183460 2:173402474-173402496 GTGTATGAGGATAAAGTGGCTGG + Intergenic
942442974 2:176055187-176055209 TTGTATCTTCACATAGTGGAGGG + Intergenic
944281264 2:197900722-197900744 TTGTATGTTTACAAAGTGAAAGG + Intronic
945335113 2:208582967-208582989 TTGTCTTTGCATGAAGTGGCTGG + Intronic
1170312583 20:15008712-15008734 ATGCATGTACTTAAAGTGGATGG + Intronic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1175084183 20:56445126-56445148 TTATATGTATATAAATTGGATGG + Intronic
1175928764 20:62483736-62483758 ATGTATGTGCATTAAGTGTGGGG - Intergenic
949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG + Intronic
951520677 3:23608448-23608470 TAGTTTGTACATAAAGTGCAAGG - Intergenic
951665700 3:25121076-25121098 ATGCATGTGTATAAAGTGGTGGG + Intergenic
952193538 3:31048431-31048453 TGGTGTGTGCATGGAGTGGAAGG + Intergenic
952645294 3:35650000-35650022 CTGTGTGTGTTTAAAGTGGATGG - Intronic
956269876 3:67440205-67440227 TAGTTTTTGCATAAAGTGTAAGG - Intronic
956829982 3:73037131-73037153 TCGTCTGTGTATTAAGTGGAGGG - Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957150061 3:76475334-76475356 TTGAATGAGGATGAAGTGGAAGG + Intronic
957169787 3:76723567-76723589 TTGTATGAGAATGAAGTGGGCGG - Intronic
957442733 3:80271458-80271480 ATGTATGTGCATATAGAGGCAGG + Intergenic
957975501 3:87438478-87438500 TTGTATATGCACAAAGTGCAAGG - Intergenic
959482839 3:106894488-106894510 TAGTATGTACAGAAAGTAGAGGG + Intergenic
959496870 3:107061771-107061793 TTGTATGTGCACATGATGGAAGG - Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960620904 3:119635857-119635879 GTTGATGTGCATAACGTGGAAGG + Intergenic
963777519 3:149453897-149453919 ATGTATGTGCACAAAGGGAAGGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
966312906 3:178614843-178614865 GTGTCTGTGCATAAAGTGTTAGG + Intronic
966645357 3:182240537-182240559 TTGTAAGTACAGAAAATGGAGGG + Intergenic
966710657 3:182969100-182969122 TTGTAAGTGTAAGAAGTGGAGGG - Intronic
966828032 3:183981689-183981711 TTGTATGTGCATGTGGTAGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967519294 3:190410235-190410257 AAGTGTGTGCATAAGGTGGAAGG - Exonic
969324450 4:6432961-6432983 TTTTCTGTTCATTAAGTGGAAGG - Intronic
970040297 4:11789240-11789262 TTGTGTGTGCATAATATGTATGG + Intergenic
971030600 4:22633643-22633665 GTGTGTGTGTATAAAGTGGAAGG + Intergenic
971246446 4:24933200-24933222 TTGTATGTACTTAAATGGGAGGG + Intronic
971492227 4:27225269-27225291 TTGTACTTCCATAAAATGGAAGG + Intergenic
971680716 4:29696459-29696481 GTGTATATGCATAAAGTTAAGGG + Intergenic
975112178 4:70640494-70640516 TTGCAACTGCATAAAGTGCAAGG + Intronic
976479984 4:85530896-85530918 TTGCATTTGCATAATGTGCAGGG + Intronic
976554946 4:86439450-86439472 TGGTACATCCATAAAGTGGAAGG - Intronic
977650768 4:99466651-99466673 TTTTCTGGGCATAAAGAGGACGG - Intergenic
980305226 4:131052378-131052400 TTGTATGTGACAAAATTGGAAGG + Intergenic
980341451 4:131553531-131553553 TTGTATGTTTATATAGTAGAAGG - Intergenic
981070836 4:140536373-140536395 TTCTATGTGAATATAGAGGAAGG + Intronic
981131048 4:141158853-141158875 TTATCTGTGAATAAATTGGAAGG - Intronic
982342623 4:154318723-154318745 ATGTATGTTCATAGAGTGAAAGG + Intronic
982549544 4:156780604-156780626 TTGTATGTGCCTTGAGTGGAAGG + Intronic
982700474 4:158655631-158655653 TTAGATGTGGATAAAGTAGAAGG + Intergenic
983686751 4:170419338-170419360 TTCTATGTTAATAAATTGGAAGG + Intergenic
987888287 5:23840515-23840537 TTGTATATACATAAAGTGTCAGG + Intergenic
989359019 5:40578281-40578303 GTGTATGTGCATGCATTGGACGG + Intergenic
990728537 5:58783773-58783795 TTGTTTGTGGATAAAGGGGAAGG - Intronic
991366304 5:65871514-65871536 TTTTATGTCCATCAAGTGTATGG - Intronic
993806172 5:92412639-92412661 CTCTATCTTCATAAAGTGGATGG - Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
995609386 5:113892808-113892830 TTGTATGTGGAAAAAGTCTATGG + Intergenic
997717756 5:136054723-136054745 TTGTATGGGCATCAATTGGAGGG - Exonic
998232399 5:140369188-140369210 TGGTGTGTGCCTAAGGTGGAAGG + Intronic
998388622 5:141772838-141772860 GTGAATGTGGATGAAGTGGATGG + Intergenic
999215865 5:149934594-149934616 ATGGCTGTGAATAAAGTGGATGG - Exonic
1000579653 5:163019842-163019864 TTGTAAGTGCATGAAATTGAAGG - Intergenic
1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG + Intronic
1004084275 6:12429266-12429288 TTGTGTGTGCATGAAGAGGGTGG + Intergenic
1004084288 6:12429453-12429475 GTGTGTGTGCATAAAGTGTGTGG + Intergenic
1004665084 6:17741906-17741928 TTGTAGGTGTCTAAAGTTGATGG + Intergenic
1005020894 6:21417807-21417829 TTGGATTTGCATAATGTTGACGG - Intergenic
1007065703 6:38988323-38988345 TTGTATGTGTATAAAGTGCTGGG + Intronic
1008297777 6:49799040-49799062 TTTCAAGTGCATACAGTGGAGGG - Intergenic
1009733422 6:67640704-67640726 GTGTATGTGCATAAATTGTCTGG - Intergenic
1009789453 6:68383128-68383150 TTGTTTGTGCAAACAGTGGTAGG - Intergenic
1010139923 6:72602323-72602345 TTCTATGTGAGAAAAGTGGAGGG - Intergenic
1011636573 6:89380264-89380286 GTGTTTATTCATAAAGTGGATGG - Exonic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012978588 6:105806320-105806342 TTGTATGTGTGTAAGGAGGAAGG - Intergenic
1014940734 6:127435745-127435767 TTGTATGTGCATACCCTTGATGG - Intergenic
1015861825 6:137689467-137689489 TTATATGTGCAAAATTTGGAAGG + Intergenic
1016797424 6:148132878-148132900 TTGTATCCTCATATAGTGGAAGG + Intergenic
1019152088 6:170013864-170013886 TTGTATTTCCATTACGTGGAAGG - Intergenic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1023344792 7:39260332-39260354 TTGTATGTGTATAGAGTGTGTGG - Intronic
1024758329 7:52563240-52563262 TTGCATGTTGATAAAGTGAAAGG + Intergenic
1027649355 7:80846228-80846250 TTGTAGGTGCATAAAGATCAAGG - Intronic
1028471436 7:91211013-91211035 TTGTATTTGTATTCAGTGGAGGG - Intergenic
1028703490 7:93811531-93811553 TGATATGTGCATAAAGAGGGAGG - Intronic
1031851659 7:126872128-126872150 TTGCATGTGCATAGGATGGAAGG + Intronic
1032955774 7:136970389-136970411 TAGTATTTGAATAAATTGGACGG - Intronic
1038136106 8:24787460-24787482 TTCTATGAGCATAAGGAGGAAGG - Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041174486 8:55180287-55180309 ATGAATGAGCATAAATTGGATGG + Intronic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1045949997 8:107840730-107840752 TTGTGTGGGCACATAGTGGAGGG - Intergenic
1046086982 8:109449973-109449995 GTTAATGTACATAAAGTGGATGG + Intronic
1046503021 8:115102820-115102842 ATGTATGTGGTTAAAGAGGATGG + Intergenic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1049125355 8:140782138-140782160 TTTTATGTGCACAAAGTAGTAGG - Intronic
1051817021 9:21120468-21120490 TTGTGTTTGCATAAAGGAGAAGG + Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055566912 9:77578899-77578921 TTGGATGCCCATCAAGTGGAAGG - Intronic
1059915618 9:119096442-119096464 TTGTAGGTGAATAAACTGAAAGG - Intergenic
1061344009 9:130007364-130007386 TTGGATGTGCAACAAATGGAAGG + Intronic
1186584179 X:10853948-10853970 TTCTATTTGCATGATGTGGAAGG - Intergenic
1187537189 X:20152747-20152769 TTATATGTTCACAAAATGGAAGG - Exonic
1188596011 X:31900967-31900989 TTGTATGTGCATATGGGGAAAGG + Intronic
1193435382 X:81469011-81469033 GTGAATGAGCATTAAGTGGAAGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic