ID: 964665211

View in Genome Browser
Species Human (GRCh38)
Location 3:159164522-159164544
Sequence CTTTGTAAGGCCAAGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266902
Summary {0: 9, 1: 1202, 2: 25860, 3: 80100, 4: 159731}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964665204_964665211 -8 Left 964665204 3:159164507-159164529 CCTATAATCCCAGCACTTTGTAA 0: 12
1: 1587
2: 43474
3: 344245
4: 249210
Right 964665211 3:159164522-159164544 CTTTGTAAGGCCAAGGTGGGCGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731
964665203_964665211 11 Left 964665203 3:159164488-159164510 CCAGGCGCGGTGGCTAACACCTA 0: 2
1: 368
2: 8811
3: 60272
4: 123399
Right 964665211 3:159164522-159164544 CTTTGTAAGGCCAAGGTGGGCGG 0: 9
1: 1202
2: 25860
3: 80100
4: 159731

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964665211 Original CRISPR CTTTGTAAGGCCAAGGTGGG CGG Intronic
Too many off-targets to display for this crispr