ID: 964666388

View in Genome Browser
Species Human (GRCh38)
Location 3:159178780-159178802
Sequence CAGTTGTAGGAGAAAACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964666380_964666388 22 Left 964666380 3:159178735-159178757 CCCTCAAACAGCTCTATACAGTG 0: 1
1: 0
2: 1
3: 10
4: 159
Right 964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG 0: 1
1: 0
2: 1
3: 22
4: 305
964666381_964666388 21 Left 964666381 3:159178736-159178758 CCTCAAACAGCTCTATACAGTGG 0: 1
1: 0
2: 0
3: 18
4: 152
Right 964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG 0: 1
1: 0
2: 1
3: 22
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964666388 Original CRISPR CAGTTGTAGGAGAAAACAGG AGG Intronic
901260091 1:7864943-7864965 CAGCTGTGGGAGGACACAGGGGG - Intergenic
903337818 1:22636677-22636699 CAGTTGGAGTTGACAACAGGAGG + Exonic
903460297 1:23516230-23516252 CAGCTGCTGGATAAAACAGGAGG + Intronic
904793522 1:33041848-33041870 CATTTGAAAGAGAAAAAAGGAGG - Intronic
906299705 1:44673174-44673196 CAGTTCTAGGGAAAAACAGCTGG + Intronic
906810440 1:48821507-48821529 CATTTGTAAGTGAAAACATGTGG - Intronic
907761110 1:57361419-57361441 CAGTTCTAGGAGCAACCAGATGG + Intronic
907918943 1:58895472-58895494 CAGCTGTAGGGAAGAACAGGAGG + Intergenic
907948637 1:59159149-59159171 CAGTAGTAGGAGATAGGAGGGGG + Intergenic
910965734 1:92806364-92806386 CAGTTTGAGGAGCAAACAGAAGG + Intergenic
912138722 1:106695189-106695211 CATTTGTAAGTGAAAACATGTGG + Intergenic
914786301 1:150834891-150834913 AAGTAGTAGTAGAAAACAAGAGG + Intronic
914938325 1:152000211-152000233 CACCTGTAGGAGAAGACAGGTGG - Intergenic
915734763 1:158077793-158077815 CAGCTGGAGGAGCAGACAGGAGG - Intronic
916734517 1:167595937-167595959 CAGTTATAAGAAAGAACAGGAGG + Intergenic
917292256 1:173482762-173482784 CATGTGTAGGAGAAAAAAGAAGG + Intronic
917606149 1:176631929-176631951 CAGGTGGAGGAGAGAAGAGGGGG + Intronic
917697581 1:177542354-177542376 CACTTATAAGAGAAAACATGTGG - Intergenic
918099603 1:181362150-181362172 AAGTTGCTGGAGAAAACAGCTGG - Intergenic
918454987 1:184701554-184701576 CAGTGGTAGCACAAAATAGGGGG + Intronic
918789855 1:188812748-188812770 CACTTGTAAGAGAGAACATGCGG - Intergenic
919074144 1:192793819-192793841 CAGGAGTAGTAGTAAACAGGTGG - Intergenic
919356111 1:196523960-196523982 CAGGTGCAAGAGAAAAAAGGAGG - Intronic
919777610 1:201204518-201204540 AAGTTGGGGGAGAAAAAAGGGGG + Intronic
921394608 1:214655385-214655407 CAGGAGAAGCAGAAAACAGGTGG + Exonic
922174072 1:223181395-223181417 CAGTCTTAGAAGAAAACAAGGGG + Intergenic
922597473 1:226825022-226825044 CAGTTGTAGGTAAAGAAAGGCGG + Intergenic
924526693 1:244858147-244858169 CAGTTGTGGCAGAGAACATGCGG + Exonic
1063920219 10:10925455-10925477 TGGTTGTGGGAGAAAACAGACGG + Intergenic
1064856602 10:19775394-19775416 CATTTGTAGGAGGAAACTGATGG + Intronic
1064968291 10:21037159-21037181 CATTTTTAGGAGCAAAGAGGAGG - Intronic
1064980306 10:21159979-21160001 CCCTAGCAGGAGAAAACAGGTGG - Intronic
1065991683 10:31016579-31016601 GAGTGGTAAGAGAAAACAGGAGG - Intronic
1068466856 10:57404710-57404732 AAGTTTTAGGAGAAAAAAGTTGG + Intergenic
1070755988 10:78993651-78993673 CAGTTGTAGGGGGAAACGTGAGG - Intergenic
1071183793 10:83017783-83017805 CAGGTGGGGGAGAATACAGGTGG + Intergenic
1071901913 10:90129633-90129655 CAACTGAAGGAGAAAAAAGGGGG - Intergenic
1072076674 10:91982074-91982096 CCTCTGTAGGAAAAAACAGGTGG + Exonic
1072478570 10:95787185-95787207 GAGTTGAGGGAGAAAAAAGGGGG + Intronic
1073702458 10:105943795-105943817 CACTTGTAAGTGAAAACATGCGG + Intergenic
1074395848 10:113097347-113097369 CAGTTGTAGAAGAACCCATGAGG + Intronic
1075099902 10:119498866-119498888 CACTTTTGGGAGAAAAGAGGGGG - Intergenic
1075510758 10:123070961-123070983 CACTTGTAAGTGAAAACATGTGG + Intergenic
1075571099 10:123546349-123546371 GTGTTGTGGGAGGAAACAGGTGG + Intergenic
1075769093 10:124917748-124917770 CATTTGTAGGAAAATAAAGGTGG + Intergenic
1075931210 10:126297780-126297802 CAGATGGAGAAGAAAACAGAAGG + Intronic
1077449817 11:2633469-2633491 CAGTACTAGAAGAAAACAGAAGG - Intronic
1078387946 11:10909460-10909482 TAGTTCAAGGAGAAAACAGAGGG + Intergenic
1080767089 11:35307143-35307165 CAGGTAGAGGGGAAAACAGGTGG - Intronic
1081354735 11:42098563-42098585 AAGTTGAAGGAGAATCCAGGTGG - Intergenic
1081389224 11:42509295-42509317 CACTTGTAAGTGAAAACATGTGG + Intergenic
1082989063 11:59191819-59191841 CCGTTGAAGGACAAAACAGAAGG + Intronic
1083202895 11:61131114-61131136 CAGTGGTTGGAGAACCCAGGGGG - Exonic
1084900522 11:72306724-72306746 GGGCTGTAGGAGAAAACAAGTGG - Intronic
1086432275 11:86747424-86747446 CAGTTGTAGGAGAGACCCTGGGG + Intergenic
1087090213 11:94262632-94262654 AGGTGGTAGGAGAAAACTGGAGG - Intergenic
1089469997 11:118713085-118713107 TAGTTACAGGATAAAACAGGAGG - Intergenic
1089582118 11:119488020-119488042 CATGTCAAGGAGAAAACAGGTGG - Intergenic
1090517393 11:127443706-127443728 TATTTTTAGGAGAAAATAGGAGG + Intergenic
1090630481 11:128643192-128643214 CACTTGTAAGTGAAAACATGTGG - Intergenic
1092652903 12:10653938-10653960 TAGTTATAGGATGAAACAGGAGG + Intronic
1092748295 12:11693914-11693936 CACTTCTTGGAGAAAACAGCTGG + Intronic
1092934542 12:13348373-13348395 AAGTTTTAGTAGAAAACAGGGGG + Intergenic
1093322715 12:17734017-17734039 CAGTGGTAGCAGAGAAGAGGAGG - Intergenic
1094203678 12:27818178-27818200 CAGTTGTAGAAGAAAGCATCGGG + Intergenic
1094337755 12:29380139-29380161 CAGTTCTAGTGGAAAACATGAGG - Intronic
1094736471 12:33240428-33240450 CAGTGGCAGGAGAGAACAAGGGG - Intergenic
1097720633 12:63016596-63016618 CAGTTGAAGGAGAAAAGAAAAGG + Intergenic
1098209318 12:68146843-68146865 TATTTGTAGAAGAAAACAGAAGG - Intergenic
1098979293 12:76937647-76937669 CACTTGTAAGAGAGAACATGAGG + Intergenic
1099528470 12:83744138-83744160 CTTTTGAAGCAGAAAACAGGTGG - Intergenic
1099754014 12:86817440-86817462 CAGATGTAGAAGAATACACGTGG - Intronic
1101323673 12:103696247-103696269 CAGTGGTGGGAGAAAAGAGTGGG + Intronic
1102670915 12:114618134-114618156 CACTTGTAAGAGAGAACATGGGG - Intergenic
1104404482 12:128506201-128506223 CAGATGCAGGAGAAAGCAGTGGG + Intronic
1105716623 13:23071976-23071998 CACTTGTAAGAGAGAACATGTGG + Intergenic
1106558371 13:30829085-30829107 CAGGTTTAGAAGAAAGCAGGAGG - Intergenic
1107331651 13:39307540-39307562 CAATTGGAGAAGAAAACGGGAGG - Intergenic
1107669655 13:42731770-42731792 TAGTTGGAGGAAAAATCAGGTGG - Intergenic
1108298155 13:49045834-49045856 CTTTTGAAGGAGAAAACTGGAGG + Intronic
1108829626 13:54461330-54461352 GTGTTGTAAGAGAAAACAGGTGG + Intergenic
1109637516 13:65141905-65141927 CAGATGGATGATAAAACAGGTGG + Intergenic
1109688296 13:65849557-65849579 AAGTGGTAGGAAAAAACTGGAGG - Intergenic
1112086372 13:96036318-96036340 CACTTGTAAGTGAAAACATGCGG - Intronic
1113123434 13:106949476-106949498 CAGTTGTAACAGACACCAGGGGG - Intergenic
1113667910 13:112153698-112153720 CTGTGGCAGGAGAAAAGAGGAGG + Intergenic
1114395703 14:22358367-22358389 CACTTGTAGGTGAGAACATGTGG + Intergenic
1114587082 14:23825145-23825167 CAGGTGTAAGAGGAAGCAGGAGG + Intergenic
1114908940 14:27167476-27167498 ATGTTGTGGGAGAAACCAGGTGG - Intergenic
1115037067 14:28870856-28870878 CACTGGTTGGAGAAATCAGGAGG + Intergenic
1115807484 14:37067982-37068004 CTGTTGTAGGACAAAACAGATGG - Intronic
1118222022 14:63863347-63863369 CCAAAGTAGGAGAAAACAGGTGG - Intronic
1120612054 14:86654088-86654110 CTGTTGTATGAGAAATTAGGAGG - Intergenic
1120754547 14:88230230-88230252 CAGTCCCAGGAGAAAACAGGCGG + Intronic
1121066780 14:90974666-90974688 CATATGGAGGAGAAAAGAGGTGG + Intronic
1121291878 14:92782694-92782716 CTGTGGGAGGAGAATACAGGAGG - Intergenic
1121920108 14:97872662-97872684 CACCTGCAGGAGAAAACAGATGG + Intergenic
1123865455 15:24514881-24514903 AAGTAATAGGAGAAAACAGAAGG - Intergenic
1124396289 15:29304793-29304815 CAGTTCTAAGAGCAACCAGGAGG - Intronic
1125069825 15:35540560-35540582 TTGTTGTAGAAGAAAACAGATGG - Intronic
1125685930 15:41563215-41563237 CAGTTGTTTGAGAAAACGTGTGG - Intronic
1126856835 15:52847153-52847175 CAGTTGTAAGAGAAGAGAAGGGG + Intergenic
1126908735 15:53396485-53396507 CAGTAGCAGGAGATAAAAGGAGG - Intergenic
1128425039 15:67534442-67534464 TTATTGTATGAGAAAACAGGTGG - Intergenic
1130340291 15:82995439-82995461 CATTTGCAGGATGAAACAGGAGG + Intronic
1130438918 15:83931057-83931079 CAGTTATAGGATAGATCAGGGGG - Intronic
1132177575 15:99727705-99727727 CAGTTGTGTGAAAAAACAGCTGG - Exonic
1132288664 15:100684226-100684248 CACTTGTAGGTGAGAACATGTGG + Intergenic
1134507560 16:14820701-14820723 AAGTTGTATGTGGAAACAGGAGG + Intronic
1134695258 16:16219463-16219485 AAGTTGTATGTGGAAACAGGAGG + Intronic
1134976574 16:18575223-18575245 AAGTTGTATGTGGAAACAGGAGG - Intergenic
1138580410 16:57937377-57937399 GAGTTGGAGGAGACAATAGGTGG + Intronic
1140394492 16:74615081-74615103 CAGTTGTAGGAAAAATGAGGTGG + Intergenic
1140758827 16:78092709-78092731 CAGTTGTAGGTAAAGAAAGGCGG + Intergenic
1140874074 16:79134311-79134333 CAGTTGTAGGTAAAGAAAGGTGG + Intronic
1140994730 16:80247637-80247659 CACTTATAAGAGAGAACAGGTGG + Intergenic
1141287023 16:82681984-82682006 AAGGTGAAGGAGAAACCAGGAGG - Intronic
1142137525 16:88458473-88458495 CAGTTGGAGAAGAAAGGAGGAGG + Intronic
1142920007 17:3176513-3176535 CAGAAGTAAGGGAAAACAGGGGG + Intergenic
1146704451 17:34990705-34990727 TACTTGCAGGAGAAGACAGGAGG - Intronic
1149082451 17:52675396-52675418 CAGTTGCATCAGATAACAGGTGG - Intergenic
1153747567 18:8195653-8195675 CACTTGTAAGTGAGAACAGGTGG - Intronic
1154972070 18:21419929-21419951 AACTTGTAGAAGAAAACATGGGG + Intronic
1155333169 18:24738312-24738334 GAGCTGGAGGAGAAAGCAGGTGG + Intergenic
1156404349 18:36770274-36770296 CACTTTTGGGAGAAAACAGGAGG - Intronic
1157154830 18:45255235-45255257 CAGTAGGAAGAGAAAACAGCAGG - Intronic
1157996828 18:52567577-52567599 CATTTGTAAGTGAAAACATGTGG - Intronic
1159131255 18:64282188-64282210 CTGTTGTGGGAGAGAACTGGTGG + Intergenic
1159385046 18:67712227-67712249 CACTTGTAAGAGAGAACACGCGG - Intergenic
1160574615 18:79845434-79845456 CAGTTGTAAGAGAAAATACACGG - Intergenic
1162962567 19:14136561-14136583 CAGTTCTCGGAGAGAAGAGGCGG - Exonic
1163104922 19:15117808-15117830 CAGCTGCAGCAGAAACCAGGAGG + Intronic
1163498484 19:17661363-17661385 CAGTTGAAGGAGAGAGAAGGAGG + Intronic
1164531501 19:29051739-29051761 CACTTATAAGAGAAAACATGTGG + Intergenic
1164577708 19:29415720-29415742 CAGTTGCAGGAGAAACCAGAAGG + Intergenic
1164849497 19:31469693-31469715 CACTTGTAAGTGAAAACATGTGG + Intergenic
1164861188 19:31563503-31563525 CAATTGCAGGAGAAAACAGCGGG + Intergenic
1166891855 19:45998944-45998966 TAGTTCTGGGAGGAAACAGGAGG + Intronic
926034172 2:9621951-9621973 CACTTGTAAGTGAAAACATGCGG - Intronic
926595227 2:14782871-14782893 CACTTGTAAGTGAAAACATGTGG - Intergenic
926792568 2:16589516-16589538 CAGAGGTAGTAGAAAACAGCTGG - Intronic
926816495 2:16802938-16802960 AAGTTCTAGAAGAAAACATGCGG - Intergenic
926963575 2:18386081-18386103 CAGTTATAAGTGAAAACACGTGG - Intergenic
927246798 2:20963093-20963115 ACATTGGAGGAGAAAACAGGTGG - Intergenic
927272680 2:21230016-21230038 GAGATGTAGGAGGAAACAAGGGG - Intergenic
928812170 2:35241332-35241354 CACTTGTAGGTGAGAACATGTGG - Intergenic
928933926 2:36654992-36655014 AAGTTGTAGGAGGACACAGTTGG + Intergenic
931467170 2:62500351-62500373 GAGATGAAGAAGAAAACAGGTGG - Exonic
931634665 2:64330532-64330554 CAGTGGCAGGACAAAAAAGGAGG + Intergenic
933360404 2:81275399-81275421 AACTTTTAGGAGAAAACATGGGG + Intergenic
933731426 2:85459194-85459216 CAGCTGCAGGAAAAAACAAGTGG + Intergenic
935097942 2:99964902-99964924 CAGTTGTAAGAAAAAACACAAGG - Intronic
935649736 2:105372031-105372053 CAGCTGTAAGGGAAAACAGCTGG - Intronic
936755421 2:115703867-115703889 TATTTGTAGGAAAGAACAGGTGG - Intronic
936782064 2:116045526-116045548 CACTTGTAAGTGAAAACATGTGG - Intergenic
937081578 2:119144100-119144122 CACTTATAGGTGAGAACAGGAGG - Intergenic
937331045 2:121030287-121030309 CACTTGTAGGAGAAGAAATGAGG - Intergenic
938335441 2:130491519-130491541 CTATTGTTGCAGAAAACAGGAGG - Intronic
938430807 2:131235931-131235953 CTATTGTTGCAGAAAACAGGAGG + Intronic
938628101 2:133133918-133133940 CAGTAGTAGGGGAAAAAAGTGGG - Intronic
939018694 2:136932835-136932857 GAGTTGGGGGAGAAATCAGGTGG + Intronic
939475436 2:142680701-142680723 CAGTTGCAGGAGAAAGGAAGGGG - Intergenic
943375475 2:187071520-187071542 CAGTTTCATGAGAAAAAAGGGGG - Intergenic
943444790 2:187971158-187971180 CATTTGTAGGTGAGAACATGTGG + Intergenic
943982871 2:194577356-194577378 CAGTTGAAGGTGAACACAGAAGG + Intergenic
944479442 2:200141334-200141356 CACTTTTAGAAGAAAACAGGAGG + Intergenic
945119106 2:206440577-206440599 CAGTCGTAGGTGAAGGCAGGTGG - Intergenic
946069968 2:217025871-217025893 CAGTCTTAGGTGAACACAGGAGG + Intergenic
946274767 2:218622874-218622896 CAGTGGTAAGAGAAATCAGGTGG + Exonic
946706693 2:222465323-222465345 CCCTTGAAGGAGAAAACAGAAGG - Intronic
948693930 2:239723256-239723278 CAGTTCTAGGACAGAGCAGGAGG - Intergenic
1169876752 20:10306204-10306226 CATTTGGAGGAGAACACGGGTGG - Exonic
1170053605 20:12174502-12174524 CAGTTCTAAGAGGAAGCAGGAGG - Intergenic
1170270287 20:14519978-14520000 CACTTATAGGTGAAAACATGTGG - Intronic
1170562247 20:17568442-17568464 CAGCTGCAGGAGGATACAGGGGG + Intronic
1170662964 20:18360630-18360652 CTGTTGTAGGAATAAAGAGGAGG + Intergenic
1172254863 20:33508654-33508676 CACTTGTAAGTGAAAACATGCGG + Intronic
1172360248 20:34307670-34307692 CAGTTGTAAGAAAACACAGGGGG - Intronic
1174562013 20:51437976-51437998 CAGTTGTCTGAGAAAACAGGGGG - Intronic
1175012155 20:55749073-55749095 CAGTTATAAGAGAGAACATGTGG - Intergenic
1175080716 20:56418161-56418183 CAGAAAGAGGAGAAAACAGGGGG + Intronic
1175498474 20:59432102-59432124 CAGTTTTAGGTGAAAACAAGAGG - Intergenic
1175888436 20:62305191-62305213 CATCTGTAGGTGAAAACTGGTGG + Intronic
1176818198 21:13627579-13627601 CTATTGTTGCAGAAAACAGGAGG + Intronic
1177604821 21:23364191-23364213 CAGCTGGAGGGAAAAACAGGAGG + Intergenic
1181405192 22:22679507-22679529 CAGCTGTGGGAGAAAGGAGGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1184247202 22:43241729-43241751 CAGTTGCAGGAGGACACTGGTGG - Intronic
1184547802 22:45183949-45183971 CAGTAGTGGTAGAGAACAGGGGG + Intronic
951138553 3:19133627-19133649 CAGATGTGAGAGAAAACAGATGG - Intergenic
951202804 3:19893365-19893387 AAGTTCTAGGTGAAAATAGGAGG + Intronic
951242667 3:20305244-20305266 CTGTTGTAGGAGAGACCTGGTGG - Intergenic
952114582 3:30163331-30163353 CAGTTGGGGGAGAAGACTGGGGG + Intergenic
953559033 3:43970799-43970821 CATGAGTGGGAGAAAACAGGAGG + Intergenic
954150106 3:48653054-48653076 GAGTTGCAGGAGGAACCAGGTGG - Exonic
955363614 3:58293385-58293407 GAGTTGCAGAATAAAACAGGAGG + Intronic
956309997 3:67868658-67868680 CATCTGGAGGAGAAAACAGAAGG - Intergenic
957170151 3:76728234-76728256 CACTAGTAGGGGAAAACAAGGGG - Intronic
959015081 3:101124642-101124664 CAGTTATAGGAGAAAATGGAGGG + Intergenic
960347404 3:116550993-116551015 CACTTGTAAGAGAGAACATGTGG + Intronic
961571496 3:127802440-127802462 CACCTGTAGGAGATTACAGGAGG - Intronic
963038855 3:141054015-141054037 CAGTTGTATGAAAAACTAGGAGG - Intronic
963242057 3:143015467-143015489 CAGTAGTAGAGGAAAACATGAGG - Intronic
963344817 3:144082669-144082691 CAGTTATAAGTGAAAACATGTGG - Intergenic
963767384 3:149351823-149351845 CAGTTTTAGGAGCAGAGAGGAGG - Intergenic
964540269 3:157771968-157771990 CAGTTGTCGTATAAAGCAGGCGG + Intergenic
964666388 3:159178780-159178802 CAGTTGTAGGAGAAAACAGGAGG + Intronic
965405816 3:168267322-168267344 CACTTGTAAGTGAAAACATGTGG - Intergenic
965725938 3:171715996-171716018 CAGTTATAAGTGAGAACAGGTGG + Intronic
967640443 3:191856425-191856447 CACTTGTAAGAGAAAACATGTGG + Intergenic
967834195 3:193947138-193947160 CAGGTGTAGGAGAGAAGAGGAGG - Intergenic
968783295 4:2599521-2599543 CAGTTGTAGGAGAATATTGGTGG + Intronic
969246123 4:5934015-5934037 CAGTTTTAGAAGAAAAGAGTAGG - Intronic
970642950 4:18088032-18088054 CACTTGTAAGTGAAAACATGTGG - Intergenic
970697466 4:18695207-18695229 AAGTGGTAGGAGAAAAAATGTGG + Intergenic
971114643 4:23630548-23630570 CAGGAGTAAGAGAAACCAGGAGG + Intergenic
971628367 4:28954849-28954871 CAGTTGTAAGTGAGAACATGTGG + Intergenic
972083337 4:35182135-35182157 CAGTGGGAGGAGTACACAGGAGG - Intergenic
973747074 4:53974175-53974197 CAGTTATAAGTGAGAACAGGAGG + Intronic
975374412 4:73626986-73627008 CACTTTTAGAAGAAAACAGGGGG - Intergenic
977160986 4:93634905-93634927 AAGAAGTAGGAGAAAAGAGGGGG - Intronic
977213506 4:94248857-94248879 CAGTTGTTGGATAATAAAGGAGG + Intronic
978802411 4:112767983-112768005 CAGGTGAAGGAGAAAACAAAGGG + Intergenic
979025185 4:115562668-115562690 CAGCTGAAGGAGAAAAAATGTGG + Intergenic
979209639 4:118084012-118084034 CATTTTTAGAAGAATACAGGTGG - Intronic
979228849 4:118323186-118323208 GAGTTGAAGGACAAAACAGGAGG + Intronic
979399856 4:120236122-120236144 CAGCTGAAGGAGAAATCAAGGGG - Intergenic
979695297 4:123606485-123606507 CACTTGTAAGTGAAAACATGTGG - Intergenic
981288552 4:143047363-143047385 CAGTTGTGTGAAAAAACAGTTGG + Intergenic
981785574 4:148475393-148475415 AAGTGCTAGAAGAAAACAGGAGG + Intergenic
983693774 4:170503809-170503831 CTGTTGTGGGAGAAACCTGGTGG - Intergenic
983899524 4:173119100-173119122 CACTTGTAAGTGAAAACATGTGG - Intergenic
985166303 4:187098655-187098677 CACTTGTAAGAGAGAACATGTGG + Intergenic
987495110 5:18633052-18633074 AAGTTGTAGGAGCAGATAGGTGG + Intergenic
987596740 5:20011057-20011079 CAGTTGTTTGAGATAAAAGGTGG - Intronic
989212927 5:38874716-38874738 CAGTTGGAGGACAGTACAGGGGG + Intronic
989699195 5:44241178-44241200 CAGTCTTAGGTGAAAACAGTTGG + Intergenic
991521938 5:67509707-67509729 CATTTATAGGTGAAAACATGTGG - Intergenic
992342058 5:75834474-75834496 CACTTATAGGTGAAAACATGAGG - Intergenic
993936374 5:94009309-94009331 CAGTCTTTGGAGAAAGCAGGTGG - Intronic
994108862 5:95977878-95977900 CACTTCTAAGTGAAAACAGGTGG + Intergenic
994559954 5:101355917-101355939 CATTTCTAGGAGAAACCAGCAGG + Intergenic
996024201 5:118625665-118625687 CAGTTGTAAGAAAAAACTGTTGG - Intergenic
997060554 5:130496525-130496547 CAGATGTAGTAGACACCAGGAGG - Intergenic
997274489 5:132573469-132573491 GTGTTGTGGGAGAAACCAGGTGG - Intronic
998384417 5:141748260-141748282 CAGATGCAGGAGAGAACGGGGGG - Intergenic
999694582 5:154177864-154177886 CAGTAGTATGAGAAAAAAAGAGG + Intronic
1002667824 5:180839525-180839547 CACTTGTAAGTGAAAACATGCGG - Intergenic
1003197311 6:3926251-3926273 CAGGAGGAGGAGAAAGCAGGAGG + Intergenic
1003318507 6:5032898-5032920 CAGGAGGAGGAGAAAGCAGGAGG - Intergenic
1007601490 6:43084769-43084791 GAGATGTAGGAGCAAATAGGGGG + Intronic
1009497395 6:64368169-64368191 CACTTGTAAGTGAAAACATGTGG + Intronic
1012825045 6:104137251-104137273 CACTTGTAAGTGAAAACATGTGG + Intergenic
1014411824 6:121134190-121134212 GAGTAGAAGAAGAAAACAGGAGG - Intronic
1015865618 6:137723620-137723642 CAGTTGTGGGGGAAAAAAAGGGG - Intergenic
1016594239 6:145781441-145781463 AAGTTGGAGGAGAGAACTGGAGG + Intergenic
1018184055 6:161250106-161250128 CACTTGTAAGTGAAAACACGTGG - Intronic
1019081741 6:169435941-169435963 CTGGTGTATGAGAAAACAGTTGG - Intergenic
1019799297 7:3076502-3076524 CAGGTGTAGGAGATAAGATGAGG - Intergenic
1021012830 7:15492880-15492902 AAGATGTAGGAGAAGACAGAGGG - Intronic
1021154501 7:17193683-17193705 CACTTGTAAGAAAAAACATGTGG - Intergenic
1022190563 7:28013365-28013387 CAGTGGGAGGAAAAAATAGGAGG + Intronic
1023056258 7:36292301-36292323 CGGTTCTAAGAGAAAACAGCTGG - Intronic
1024081371 7:45858791-45858813 AAGTCGCAGGATAAAACAGGAGG - Intergenic
1024943402 7:54785000-54785022 CAATTGCAGCATAAAACAGGAGG + Intergenic
1025226033 7:57164288-57164310 CAATTGTAGAAAAAAACATGTGG - Intergenic
1025557279 7:62324607-62324629 ATGTTGTAGGAGGGAACAGGTGG + Intergenic
1030520889 7:110596556-110596578 CAGATGTAATAGAAAATAGGAGG + Intergenic
1032520731 7:132542283-132542305 CAGTTGGAGGTAAAGACAGGAGG + Intronic
1032609303 7:133393960-133393982 CTGGTCTAGGAGAAAGCAGGAGG - Intronic
1033535427 7:142307935-142307957 CAGATTTATGAGGAAACAGGAGG - Intergenic
1033847202 7:145448090-145448112 TAGTAATAGAAGAAAACAGGTGG - Intergenic
1034255448 7:149722399-149722421 CTGTTGCAGGAGAAGACAAGAGG - Intronic
1034277599 7:149830504-149830526 CTGTTGTGGGAGGACACAGGAGG - Intergenic
1034277646 7:149830650-149830672 CTGTTGTGGGAGGACACAGGAGG - Intergenic
1034852597 7:154509025-154509047 AATTTTTAGGAGAAAACAGAGGG + Intronic
1035083498 7:156236747-156236769 CAGATGTTGGAGAGAGCAGGTGG + Intergenic
1037489168 8:19380471-19380493 CACTTTTAGAAGAAAACAGAGGG - Intronic
1037532724 8:19793564-19793586 CACCTGTGGGAGAAAATAGGTGG + Intergenic
1039138419 8:34354752-34354774 CACTTGTAAGTGAAAACATGTGG + Intergenic
1039792451 8:40886702-40886724 GAGTTGTTGGAGAACCCAGGAGG - Intronic
1040710219 8:50178938-50178960 AATTTGTAGAAGAAAACATGGGG - Intronic
1041646210 8:60255161-60255183 CAGTTGAAACAGAATACAGGAGG - Intronic
1043093131 8:75929594-75929616 CACTTGTGGGAGAAACCCGGTGG - Intergenic
1043329953 8:79103526-79103548 CAGTTGTAAGTGAGAACATGTGG - Intergenic
1046105099 8:109655647-109655669 AAGTGGTAGAAGAAAGCAGGAGG - Intronic
1046720372 8:117612263-117612285 CAGTTATAAGAGGAAACTGGGGG + Intergenic
1048381719 8:133871284-133871306 CACTTGTAAGTGAAAACATGCGG + Intergenic
1048480775 8:134790606-134790628 GAGTTTAAGGAGAAAACAGAAGG - Intergenic
1048765232 8:137836626-137836648 CAGTTGTAGGGAAAGACATGGGG - Intergenic
1049085967 8:140478890-140478912 ATGTTGTAGGAGGAAACTGGTGG - Intergenic
1050634545 9:7597476-7597498 CAATTGTAAGTGAAAACATGTGG - Intergenic
1050961715 9:11741986-11742008 AAGTTGAAAGAGAAAACAGCAGG + Intergenic
1052300238 9:26945751-26945773 CAGCTGGAGGAGCAAACAGGAGG - Intronic
1055064092 9:72101206-72101228 TAGTTGTAGCAGAAACCATGTGG + Intergenic
1055344219 9:75317549-75317571 CATATGTAGGGGAAAAAAGGGGG - Intergenic
1057124267 9:92603784-92603806 AAGATGTGGGAGAAAGCAGGGGG - Intronic
1057957231 9:99420440-99420462 CACTTGCAGGAGAAATCAAGGGG - Intergenic
1057999549 9:99850916-99850938 CAGTGGCATGAGGAAACAGGTGG + Intronic
1058760383 9:108125202-108125224 CAGTAGAAGGAGGAAAAAGGGGG + Intergenic
1059248727 9:112869196-112869218 CAGTTGTGGGAGAGAACCCGGGG + Exonic
1059761179 9:117339145-117339167 CAGTTGTGAGAGAAAATTGGGGG - Intronic
1059784032 9:117561271-117561293 CACTTATAAGAGAAAACATGTGG - Intergenic
1059907777 9:119007445-119007467 GTGTTGTGGGAGAAAACTGGTGG - Intergenic
1061200386 9:129134938-129134960 CAGTTTGAGGAGGAAACAGATGG - Intronic
1061546081 9:131305052-131305074 CAGTTGCTGGGGAAAACAGTGGG + Intronic
1062468289 9:136691138-136691160 CAGATGTAGGAGCCAACAGGAGG + Intergenic
1203529161 Un_GL000213v1:121924-121946 CTATTGTTGCAGAAAACAGGAGG - Intergenic
1186033093 X:5391238-5391260 CAGGTATAGGTGAAAACTGGGGG + Intergenic
1186133011 X:6489916-6489938 CGTTTGTGGGAGAAAACATGTGG + Intergenic
1187428094 X:19196810-19196832 CACTTGAAGGTGAAAAGAGGAGG + Intergenic
1187584646 X:20646782-20646804 CAGTTATAGGTGAAAACATGTGG - Intergenic
1187703567 X:21987808-21987830 CGGCTGTAGTAGACAACAGGTGG - Intronic
1188538453 X:31222554-31222576 CAGATGTATGATAAAAAAGGAGG + Intronic
1189552659 X:42109660-42109682 CAGGTAGAAGAGAAAACAGGAGG - Intergenic
1190437040 X:50435814-50435836 CAGTGGTAGGTGAGAGCAGGAGG + Intronic
1190445075 X:50515696-50515718 CAGTTGAAGCAGAAAAGAGAAGG + Intergenic
1190473719 X:50808048-50808070 GAGTGGGAGGAGGAAACAGGAGG + Intronic
1192204491 X:69087058-69087080 TAGTTGTATGACAAAAGAGGCGG + Intergenic
1192995912 X:76513144-76513166 TAGGTCTAGGAGCAAACAGGAGG - Intergenic
1193205575 X:78744055-78744077 CAGTTGTTTGAGAAAACACTAGG + Intergenic
1195250768 X:103044374-103044396 TAGTTGCAGGAGAATGCAGGGGG - Intergenic
1196568007 X:117231032-117231054 GTGTTGTAGGAGGAAACTGGTGG - Intergenic
1197124754 X:122931125-122931147 TAGTTGGAGGAGAAAACTGAAGG - Intergenic
1198794134 X:140377861-140377883 CAGTTGTAAGTGAGAACATGTGG - Intergenic
1199478435 X:148272217-148272239 ATGATGTAGGAGACAACAGGAGG - Intergenic
1200672760 Y:6113377-6113399 CTGTTGTTGGAGAAACCCGGTGG + Intergenic
1201864760 Y:18637886-18637908 CAGTTATAGGAGAAGGCTGGAGG - Intergenic
1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG + Intergenic