ID: 964670065

View in Genome Browser
Species Human (GRCh38)
Location 3:159215156-159215178
Sequence ATGCTGGGCTTGATGAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 7, 3: 22, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964670064_964670065 -10 Left 964670064 3:159215143-159215165 CCTGAGTGTGTTTATGCTGGGCT 0: 1
1: 0
2: 0
3: 10
4: 144
Right 964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG 0: 1
1: 0
2: 7
3: 22
4: 204
964670060_964670065 28 Left 964670060 3:159215105-159215127 CCTTCACAAGGAAATGAAGACTC 0: 2
1: 8
2: 56
3: 143
4: 379
Right 964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG 0: 1
1: 0
2: 7
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964670065 Original CRISPR ATGCTGGGCTTGATGAAAAA TGG Intronic
902132316 1:14273070-14273092 TTGTTGGGCTGGATGAAACACGG + Intergenic
904482374 1:30802014-30802036 ATGCGGAGCTTTATGAAAATCGG - Intergenic
907552338 1:55314912-55314934 ATGCTGGTTTTGATGACATAAGG - Intergenic
907629859 1:56069598-56069620 CTGGTGGGCTTGATGAGAGATGG + Intergenic
908931452 1:69320892-69320914 GTGGTGTGCTTGAAGAAAAAGGG + Intergenic
910050480 1:82968033-82968055 ATACAGGCCTTGATGGAAAACGG - Intergenic
911907920 1:103593398-103593420 ATGCTCAGCTTGATTAAAAGTGG - Intergenic
911913452 1:103665877-103665899 GTGCTGAGCTTGATTAAAAGTGG - Intronic
911915000 1:103686070-103686092 GTGCTGAGCTTGATTAAAAGTGG + Intronic
911920867 1:103760015-103760037 GTGCTGAGCTTGATTAAAAGTGG - Intergenic
913237343 1:116796377-116796399 ATGCTAGGTTTGATGAAGCACGG + Intergenic
913361609 1:117987084-117987106 ATGCTAGGTTTGATGAAGAATGG - Intronic
914707441 1:150182022-150182044 ATGCTGGGGTAGAAGAAATAAGG - Intergenic
916471987 1:165132924-165132946 ATGCTGGGATGGAAGAAAAAAGG + Intergenic
916607920 1:166361297-166361319 ATGCTGGACTCTATGCAAAAGGG + Intergenic
916627704 1:166576462-166576484 ATGGTGGGGTTGAGGAAAGATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917825474 1:178815698-178815720 ATGAAGGGCTTTATGAGAAATGG - Intronic
918267129 1:182854058-182854080 ATGCTGGGCTTCATGGAAACTGG + Exonic
918985339 1:191617725-191617747 AGGCTGGGCTTGATGAACAGTGG + Intergenic
920927603 1:210357501-210357523 ATGCTAGGTTTGATGAAGATTGG - Intronic
922034890 1:221838787-221838809 ATGCTTGGGTTGATGAAGAGTGG + Intergenic
922629641 1:227093043-227093065 ATCCTGGGCTTCATAAGAAAAGG - Intronic
924152948 1:241147154-241147176 AAGGTGGCCTTGATGAAAAATGG - Intronic
924622012 1:245670188-245670210 AACCTGGGCATGAAGAAAAAAGG + Intronic
1063560340 10:7120456-7120478 ATGCTGGCCATGAGGAAAGATGG + Intergenic
1065100520 10:22326122-22326144 CTGCTGGGCTGGAGGACAAATGG + Intronic
1065286167 10:24189685-24189707 ATGTTTGGTTTGATGAAGAATGG + Intronic
1068966245 10:62914846-62914868 ATGCTAGGCTTGCCAAAAAATGG + Intronic
1076498680 10:130917047-130917069 ATTCTGGGCTTGAAGACTAAAGG + Intergenic
1077944760 11:6884146-6884168 ATGCAGGACTTGAAGAGAAAAGG + Intergenic
1078672877 11:13380564-13380586 AGGCAGTGGTTGATGAAAAATGG - Intronic
1079967856 11:27000958-27000980 ATTCTAGGATTGATGATAAATGG + Intergenic
1083907015 11:65679410-65679432 ATATTGGGCTTGATTAAAGAAGG + Intergenic
1084570552 11:69957093-69957115 ATGCTGGGCTGGATGAAGGAAGG - Intergenic
1087943715 11:104132716-104132738 ATTCTGGGTTAGATGAGAAAAGG - Intronic
1090516471 11:127433483-127433505 AGGCAGGGGTTGATGAAGAAAGG - Intergenic
1093934997 12:24990958-24990980 GTGATGGGCATGATGAAAATAGG + Intergenic
1095251533 12:39984737-39984759 ATGTCCGTCTTGATGAAAAATGG + Intronic
1095390420 12:41699518-41699540 ATGCTGGAATTCATAAAAAAAGG + Intergenic
1096499025 12:52054410-52054432 ATGGTGGGCTTGATGAACTCAGG - Exonic
1097557462 12:61156941-61156963 ATGGTTGGCTTTAGGAAAAATGG + Intergenic
1097845210 12:64359270-64359292 ATGCTTGGTTTGATGAAGAGAGG - Intronic
1100675351 12:96860344-96860366 ATCCTGGGCAGGCTGAAAAATGG - Intronic
1101220606 12:102635305-102635327 TTGGAGGGCTTGATGAAAGAAGG + Intergenic
1102263866 12:111464466-111464488 AGGCTGGAGTTAATGAAAAATGG - Intronic
1106595543 13:31132378-31132400 ATTTTGGGATTGATGCAAAATGG - Intergenic
1107683586 13:42873896-42873918 ATGCTGGGTTTGATGAAGAGAGG - Intergenic
1109215408 13:59584154-59584176 CTTCTGGGCTTGCTGAGAAAAGG - Intergenic
1110352847 13:74529844-74529866 ATGGAGGTCTTCATGAAAAATGG + Intergenic
1110569096 13:76985359-76985381 ATGCTGGGCTTCATGGAAACTGG + Intergenic
1111757937 13:92422130-92422152 AAGCAGGGCTTGAAAAAAAATGG - Intronic
1113441725 13:110334288-110334310 CTGCTGTGCTTGATAAACAAAGG - Intronic
1113534485 13:111053727-111053749 ATGCTGGTGTGGATGTAAAAGGG - Intergenic
1116636584 14:47403987-47404009 ATGCTGAGTTTGATGAAGAGTGG - Intronic
1117346989 14:54842462-54842484 ATACTGGGCTAGATTTAAAAAGG + Exonic
1118026352 14:61772788-61772810 AAGTTGGGGTTGATGAACAAAGG + Intronic
1118399172 14:65363764-65363786 ATGCTAGGTTTGATGAAGAGTGG - Intergenic
1119446652 14:74670158-74670180 GAACTGGGCTTGAAGAAAAATGG - Intronic
1119643399 14:76330772-76330794 ATCCTGGGCTTGAGGACAAAGGG + Intronic
1119884305 14:78127500-78127522 GTGCTGTGCTTGATCACAAAGGG + Intergenic
1121684861 14:95828161-95828183 ATGCTGGGGTGGAGGAAAGAAGG + Intergenic
1122723629 14:103736169-103736191 AAGCTGGGTGTGATGAACAAAGG - Exonic
1124239642 15:28018939-28018961 ATGCTAGGTTTGATGAAGAGTGG - Intronic
1124907580 15:33885779-33885801 ATTCTAGGCTTTATGAGAAAAGG + Intronic
1126323986 15:47455274-47455296 ATGCTGGGATTGTGGAAAGAGGG - Intronic
1126421052 15:48472500-48472522 TTGCTGGGCTTGATGAGATTAGG - Intronic
1131584846 15:93682274-93682296 ATGCTGGTCTTGATGTGAAAAGG + Intergenic
1131951024 15:97682146-97682168 AAGATGGTCTTGATGAAGAATGG + Intergenic
1133609317 16:7418143-7418165 ATGCTGAGCTTGAGGATAAGAGG + Intronic
1133695843 16:8261689-8261711 ATGCTGGGGTTGAAGAAGATTGG - Intergenic
1135878463 16:26228106-26228128 ATGCTTGGATTGAGGAACAAGGG + Intergenic
1137323284 16:47408418-47408440 ATGCTTGGCTTGACCAATAAAGG + Intronic
1137570333 16:49561781-49561803 ATGCAGCACTTGCTGAAAAATGG + Intronic
1137913867 16:52407004-52407026 TTGCTAGGCATGGTGAAAAAGGG - Intergenic
1140503334 16:75453701-75453723 ATGTTTGGCTTGAAGACAAATGG + Intronic
1140659132 16:77170615-77170637 ATGGCGGGCATGATGGAAAATGG - Intergenic
1140791190 16:78392797-78392819 GTGCTGGGCCTGAAGAAAACTGG - Intronic
1144090049 17:11848011-11848033 ACTCTGGGCTTGAGGAGAAAAGG - Intronic
1144221465 17:13103655-13103677 ATGCTAGGTTTGATGAAGAATGG + Intergenic
1144284001 17:13755191-13755213 GAGCTAGGCTTGATGAAGAACGG + Intergenic
1144642583 17:16945749-16945771 AGGCTGTGCTAGATTAAAAATGG + Intronic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1151972052 17:77462959-77462981 ATGCTGGGTTTGATGAAGAGTGG + Intronic
1153101221 18:1471794-1471816 ATACTGAGTTTGATGAAGAATGG + Intergenic
1154092261 18:11376615-11376637 ATGCTGGAATTGAAGAAAACTGG - Intergenic
1155781466 18:29841981-29842003 TTGCTGGTGTGGATGAAAAATGG - Intergenic
1155836800 18:30595361-30595383 ATGCTGGATTTGAAGAAAAGAGG + Intergenic
1156627383 18:38925302-38925324 ATCATGGGCATGATGCAAAAGGG + Intergenic
1158348240 18:56537650-56537672 ATGCTGGGCTTAAGAAAAAAGGG + Intergenic
1158872288 18:61699638-61699660 GTGCTGGGCTTGCTGAGAACAGG - Intergenic
1159361825 18:67414995-67415017 ATGACTGGCTTGTTGAAAAATGG - Intergenic
1159919692 18:74216364-74216386 ATCCTGGGCTAGAAGGAAAAAGG + Intergenic
1163259031 19:16175689-16175711 TTGCTGGTGTTGATGCAAAATGG + Intergenic
1164823549 19:31267798-31267820 ATGCTGAGCTTGTTGAGAATGGG + Intergenic
1167714703 19:51135023-51135045 ATGCTGGACTCTATGCAAAAGGG + Intronic
1168580446 19:57551517-57551539 ATGCTGGGTTTGATGAAGGTAGG + Intronic
927085249 2:19668863-19668885 ATGCTGTGGTTGGAGAAAAAAGG + Intergenic
928671002 2:33603385-33603407 TTGCTGGTCTTGATGAAGGAGGG - Intergenic
929730303 2:44483742-44483764 AAACTGGGCTTAATCAAAAAAGG + Intronic
930411802 2:51033196-51033218 TTGCTGGGTTTGGTGAGAAAGGG + Intergenic
930770256 2:55123910-55123932 ATGCTGGACTTCATTACAAAGGG - Intergenic
931062326 2:58545247-58545269 ATGCTAGGTTTGATGAAGAGTGG + Intergenic
933677641 2:85071109-85071131 TTGCTGGGATTAATGTAAAATGG - Intergenic
934151973 2:89155649-89155671 ATGCTGGGCTTGCTGAGCGATGG + Intergenic
934163544 2:89274147-89274169 ATGCTGGGCTCCCTGAACAATGG + Intergenic
934203729 2:89908377-89908399 ATGCTGGGCTCCCTGAACAATGG - Intergenic
934215284 2:90026258-90026280 ATGCTGGGCTTGCTGAGCGATGG - Intergenic
935126098 2:100224208-100224230 ATGCTGGAGGTGGTGAAAAATGG - Intergenic
935926292 2:108073292-108073314 ATGCAGGGATGGATGAACAAAGG + Intergenic
938218890 2:129548746-129548768 ATGCTGGGCTGGAGGAAACCAGG - Intergenic
940274262 2:151922521-151922543 ATGTTGGGTTTCATGAGAAATGG - Intronic
940369458 2:152884211-152884233 GTGCTGGGCTGGATGAAGACTGG - Intergenic
942415057 2:175749829-175749851 TTGCTGGGCTAGATGAAGACTGG - Intergenic
944083981 2:195822591-195822613 TTGCTGGGATTGATTAAACAGGG - Intronic
945554034 2:211256935-211256957 ATGCTAGGCTGGATGAAAAATGG - Intergenic
946791915 2:223309524-223309546 ATGGTGGGATTTATGAAAATGGG - Intergenic
947537516 2:230949765-230949787 ATGCTGGGCTTTATGAAAGATGG - Intronic
1169494948 20:6106403-6106425 ATGCTGGTGTAGATGAGAAAGGG + Intronic
1169656066 20:7924465-7924487 ATGCTGGGCTTGATGAGGAAGGG + Intronic
1171307494 20:24118780-24118802 GTGCTGGTCCTGATGAAAGAAGG + Intergenic
1173961687 20:47077643-47077665 ATCCTTGGTTTGATGACAAATGG + Intronic
1174439584 20:50539743-50539765 CTCCTGGGCTTGAGGAACAAAGG + Intronic
1175052129 20:56165490-56165512 ATGCTGGGTTTGAGGAAGAGCGG - Intergenic
1179029124 21:37704502-37704524 ATGGAGGGCTTGATGAGTAATGG - Intronic
1179178681 21:39027072-39027094 ATGCTGGGCTTGTTGAATCCTGG - Intergenic
1179279675 21:39924017-39924039 TTGCTGGGCTTGTTGCAAGATGG - Intronic
1179538570 21:42068441-42068463 ATGCTGGGCTGGATGACTCAAGG + Intronic
1181362856 22:22352255-22352277 AGGGTGGGCATCATGAAAAATGG - Intergenic
1182486169 22:30640470-30640492 ATGCTGGCTCTGATGAAAGAGGG + Intronic
1182955231 22:34418151-34418173 AGGATGGACTTGATGAAAGATGG + Intergenic
1183242745 22:36670188-36670210 ATGCTGGGCTAGATGCAGATGGG + Intronic
949282771 3:2365862-2365884 ATGTTGGGTTTGATGAAAAGAGG + Intronic
949723085 3:7013111-7013133 ATGGTAGGGTTGATGAAGAATGG - Intronic
949792647 3:7809995-7810017 ATGCTAGGCTTGATGAAGAATGG + Intergenic
950813334 3:15672123-15672145 ATATTGGCCTTGATAAAAAAAGG + Intronic
951465995 3:23000968-23000990 ATGCTGGGCCTGACTAAGAAGGG - Intergenic
954521141 3:51227746-51227768 TTGCTGGTCTTGATGAACTAGGG - Intronic
955372725 3:58367618-58367640 ATGCTTGATTTGATGAAGAATGG + Intronic
955637896 3:61050035-61050057 ATGCTAGGTTTGATGAAGAGTGG - Intronic
956427626 3:69153457-69153479 GTGCTGGACTTAATGAAAGAGGG + Intergenic
956705686 3:71996897-71996919 ATGCTAGGTTTGATGAAGAATGG - Intergenic
957025583 3:75178157-75178179 AGGCAGAGCTTGATGAAAGAAGG + Intergenic
958266306 3:91441482-91441504 ATGCTTAGTTTGATGAAAAGTGG - Intergenic
959370478 3:105518601-105518623 ATGCTTGGTTTGATGTTAAAAGG + Intronic
959980217 3:112507698-112507720 ATGCTGGCTTTGAAGATAAAGGG - Intergenic
960057839 3:113288299-113288321 ACGTTGAGCTTGATGGAAAAAGG - Exonic
963181001 3:142355952-142355974 ATGCTGAGCTTTAGAAAAAAAGG - Intronic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
965902997 3:173667382-173667404 ATTTTGGACTTGAAGAAAAATGG + Intronic
978094389 4:104757981-104758003 ATGCTGGGATTGATAGAAAGAGG - Intergenic
978484713 4:109238834-109238856 ATGCTGGGCTTCATAAATATTGG - Intronic
979317923 4:119288321-119288343 ATGCTTGGCTTCATGTAAGATGG + Intronic
979981480 4:127261325-127261347 AGACTTGACTTGATGAAAAAAGG + Intergenic
982175027 4:152697797-152697819 CTGCAGGGCTTGTTGAAACACGG + Intronic
982270108 4:153577801-153577823 ATGATAGGGTTGATGAATAATGG + Intronic
984690298 4:182718512-182718534 ATGCTGGGCAGGCAGAAAAACGG + Intronic
985810234 5:2077946-2077968 ATGCTGTGATTGATGAAATTTGG + Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989625893 5:43429224-43429246 AAGCTGGACTTGATCCAAAAAGG + Intergenic
991956211 5:71998105-71998127 ATGATGGGCTTGATAAATCAGGG + Intergenic
995886114 5:116895815-116895837 ATGCTAGGTTTGATGAAAAATGG + Intergenic
997288669 5:132706176-132706198 ATTCTTGGCTTTAAGAAAAAAGG + Intronic
1000670357 5:164054708-164054730 ATGCTGGCAGTGATGCAAAATGG - Intergenic
1001286273 5:170426182-170426204 ATGCTGGGCCTGAGGATACAGGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003327192 6:5100875-5100897 ATGATGGACTTGATGAGCAATGG - Intergenic
1004432035 6:15554126-15554148 ATGCTAGGCTTGATGAAGAGTGG - Intronic
1004552739 6:16665031-16665053 ATGCCTGGCTTAATGGAAAATGG + Intronic
1005196125 6:23286398-23286420 ATGCTGGATTTGAGGAAACAAGG - Intergenic
1008670703 6:53765762-53765784 ATGCTGGGGTTGTTTAGAAAGGG - Intergenic
1008778912 6:55077591-55077613 ATGGTGAGCTTGCCGAAAAAAGG + Intergenic
1009897702 6:69773811-69773833 ATGCTAGTGTTGATGAAAAATGG - Intronic
1010011910 6:71057697-71057719 ATGCTAGGCTTGATGAAGAATGG + Intergenic
1010048690 6:71477880-71477902 AAGCTGGGCTGGATGCAATAAGG - Intergenic
1010124658 6:72418225-72418247 GTACTGGGCTTCATGATAAATGG - Intergenic
1010527523 6:76922247-76922269 ATGCTGGGCTTGTTGAGAAAAGG - Intergenic
1011581690 6:88874558-88874580 ATGCTGGCTTGGATAAAAAAGGG - Intronic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1012429860 6:99153055-99153077 CTGCTGGCCTTGAAGAAACAAGG + Intergenic
1015261726 6:131245522-131245544 ATTCTGGGCCTGAAGAAAATCGG - Intronic
1016294542 6:142560834-142560856 ATGATGGGCTTAATGTAAAGTGG + Intergenic
1020863314 7:13522538-13522560 AGGCAGGGCTATATGAAAAAGGG - Intergenic
1021167813 7:17362017-17362039 ATGATGGCCTTGAAGATAAAGGG + Intergenic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1024244791 7:47461058-47461080 ATGCTGGAGTTGAAAAAAAACGG + Intronic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1027377571 7:77568175-77568197 ATGCTAGGCTTTAAGAAAACTGG + Intronic
1027525965 7:79269021-79269043 ATGGTGGAGTTGATGAAAGAGGG + Intronic
1028281274 7:88932118-88932140 ATGCTAGGCTTGATGAAGAGTGG + Intronic
1030084632 7:105805968-105805990 ATGCTGAGCTTGCTGGAACAAGG + Intronic
1030845722 7:114407907-114407929 AAGCTGTCCTTGATGAAACATGG - Intronic
1030999923 7:116403131-116403153 ATGTTGGGATTGATAAGAAAAGG - Intronic
1031910863 7:127515541-127515563 ATGCTGCATTTGATGAAATAGGG - Intergenic
1032413603 7:131719175-131719197 ATGCTCTGCTTGATGAGAATGGG - Intergenic
1032496684 7:132368160-132368182 ATGCTGGGCGTGATCAAAGGAGG + Intronic
1032984024 7:137317141-137317163 ATGTCAGGCTTGATGAAAATCGG + Intronic
1037263341 8:17032370-17032392 ATTCTGGGCATGAAAAAAAAAGG - Intronic
1037405493 8:18538071-18538093 ATGCTGCACCTGAGGAAAAATGG + Intronic
1037645322 8:20787596-20787618 ATGGTGTGCTTGATGATACAGGG + Intergenic
1038355416 8:26824617-26824639 ATGCTGGCATTGAGCAAAAAGGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1042363672 8:67911620-67911642 ATGCCGGCCCTGATGAGAAAAGG - Intergenic
1044312833 8:90714043-90714065 AAGCTAGGCTAGATGACAAAGGG + Intronic
1044634495 8:94309162-94309184 ATACTGGGGTAGGTGAAAAATGG + Intergenic
1049543452 8:143218823-143218845 CTGCTGGGCTGGATGAGAAAGGG - Intergenic
1049843552 8:144788979-144789001 CTGCTGGGATTGCTGAACAAAGG - Intergenic
1050506242 9:6352297-6352319 ATGCTAGGTTTGATGAAGAATGG - Intergenic
1051351442 9:16201508-16201530 ATGTTGTTCCTGATGAAAAAAGG - Intergenic
1052348876 9:27437968-27437990 CTGCTGGACTAGATGAAAAGGGG + Intronic
1052454783 9:28682150-28682172 ATGCTGCCCTTTATAAAAAATGG + Intergenic
1055078822 9:72246530-72246552 ATGCTAGGTTTGATGAAGAGTGG + Intronic
1055568808 9:77595559-77595581 ATGATGGGCTGGATAAAAACGGG - Intronic
1056467694 9:86874262-86874284 ATTCTGGGTTTCATGAAATATGG + Intergenic
1057128733 9:92638832-92638854 TTGCTGGGCTTGATTTAAGAAGG - Intronic
1057538526 9:95941724-95941746 ATTCTGAGATGGATGAAAAATGG - Intronic
1060845435 9:126833197-126833219 ATGCTGGGCTTGCTGTACATGGG - Exonic
1061719090 9:132540651-132540673 ATGCTGGATTTGGTGAAGAAGGG + Intronic
1185873239 X:3681789-3681811 TTGCTGGGCTTGAGGAAGAGAGG - Intronic
1186332442 X:8549096-8549118 ATTGTGGACTTGATGATAAAGGG - Intronic
1187074198 X:15917632-15917654 TTTCTGGGCTTGCTGAAGAAGGG + Intergenic
1188425898 X:30046413-30046435 ATGCGGGGCTTGATTAAATAAGG + Intergenic
1190456986 X:50636139-50636161 ATGCAGGGCTTGTTGAAACACGG + Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1194810161 X:98379625-98379647 ATGCTCAGCTTAATTAAAAATGG - Intergenic
1196627475 X:117892764-117892786 ATGTAGGGCCTGATCAAAAATGG - Intergenic
1197065476 X:122228444-122228466 ATGCTCAGCTTAATTAAAAATGG + Intergenic
1197204151 X:123775165-123775187 ATGATGGCCTTGATTTAAAAAGG - Intergenic
1197320658 X:125025636-125025658 ATGTTGGGCCTTCTGAAAAAAGG + Intergenic
1198058580 X:133020721-133020743 ATGCTGGCTTTGGGGAAAAAGGG + Intergenic
1199895812 X:152127246-152127268 ATGCTCTGATTGAAGAAAAAGGG - Intergenic
1200791063 Y:7299324-7299346 TTGCTGGGCTTGAGGAAGAGAGG + Intergenic