ID: 964670639

View in Genome Browser
Species Human (GRCh38)
Location 3:159221437-159221459
Sequence CTGCAGTCCTAGAATTCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964670639 Original CRISPR CTGCAGTCCTAGAATTCTGA AGG Intronic
901268356 1:7930223-7930245 CTGTAATCCTAGCATTCTGGGGG - Intronic
903044860 1:20557036-20557058 CTCCTGTCCTAGACTTCTCAGGG + Intergenic
903096071 1:20975039-20975061 TTGCAGTACCAGAATTCTGTAGG + Intronic
907931199 1:59002424-59002446 CTGCAATCCTAGCATTTTGGGGG - Intergenic
908114534 1:60927867-60927889 CTGCAGTCCTTTAATTCTCCAGG - Intronic
913005002 1:114621164-114621186 CTGCAGTCCCGGAACTCTGGGGG + Intronic
914927665 1:151902727-151902749 CTGCAGTCCCAGAACTTTGGGGG + Intronic
917033904 1:170725469-170725491 CAGCACTTCTAGAATGCTGAAGG - Intronic
922638449 1:227201398-227201420 CTGTAGTCCTAGCACTTTGAGGG - Intronic
1063050079 10:2437403-2437425 CTGCCTTCTTAGATTTCTGAGGG + Intergenic
1064030697 10:11880785-11880807 CAGCTCTCCTAGAACTCTGATGG + Intergenic
1065974796 10:30833017-30833039 TTGCAGTCCTTGAACTCTCAAGG - Intronic
1066434531 10:35384837-35384859 CTGCCGTCTGAGAATTCTGTTGG + Intronic
1066494728 10:35932066-35932088 AAGCAGTCCTAGACTTTTGAGGG + Intergenic
1068299866 10:55124942-55124964 CTAAAGTCCTAGAGTCCTGATGG - Intronic
1069229529 10:65991770-65991792 CTTCAGTACTAGAATCCTGAAGG + Intronic
1072157379 10:92736250-92736272 CTGGAGCACTAGAACTCTGAAGG - Intergenic
1075467219 10:122660825-122660847 CTGGAGTCCTAGAGAGCTGAGGG + Intergenic
1076453469 10:130573170-130573192 CTGGTGTCCTGGAATTCTCAGGG + Intergenic
1077917596 11:6621607-6621629 CTGTGGTCCTAGTACTCTGAGGG + Exonic
1080003705 11:27381435-27381457 CTGTAATCCCAGCATTCTGAGGG + Intronic
1083950220 11:65950514-65950536 CTGCAGTCCTAGAGCTCAGGAGG - Intronic
1086426113 11:86683953-86683975 CTGCATTACTAGAATTTTGATGG - Intergenic
1090730134 11:129565450-129565472 CTGCAGTACTTGCATTCTGGGGG - Intergenic
1091475892 12:771938-771960 CTGCAGTCCTTAAATTAAGAGGG - Intronic
1091768714 12:3138064-3138086 ATGCAGTCCTAGGCTCCTGAAGG - Intronic
1094386103 12:29895672-29895694 CTACAGTTCTGGAATTCTGGAGG + Intergenic
1096961589 12:55583795-55583817 CTCCAGTCTTGGATTTCTGATGG + Intergenic
1097540662 12:60937993-60938015 CCTCAGTCCTAAAACTCTGAGGG + Intergenic
1097957803 12:65504429-65504451 CAGCAGTTCCAGAACTCTGAAGG - Intergenic
1098343652 12:69477131-69477153 CTGCATTCCTAGACTTCTGAGGG - Intronic
1098427342 12:70379667-70379689 CTGTAATCCCAGCATTCTGAAGG - Intronic
1099973660 12:89525238-89525260 CCGCAGACCTCGAATTCTGGCGG + Intronic
1100267073 12:92987833-92987855 CTGCAATCCAAGCACTCTGAGGG - Intergenic
1102564821 12:113789486-113789508 GTGCAGTCCTTGATTTCGGATGG + Intergenic
1107427903 13:40312766-40312788 CTGCAGCCCTAGATTTGTGTAGG - Intergenic
1110207716 13:72936155-72936177 CTGCAGTCCTAGTATTTGGGAGG - Intronic
1110688684 13:78405513-78405535 CTGAAGTCCTGGAAAACTGAAGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1117785884 14:59284367-59284389 CTGCAGTTCTATAATACTCATGG - Intronic
1117787071 14:59297147-59297169 CTTCAGTCCTAGAATCATGGGGG - Intronic
1118909643 14:70050456-70050478 CGGGAGTCCTAGAAGCCTGAGGG - Intronic
1121373015 14:93377799-93377821 CTGCAGTGGGAGCATTCTGATGG - Intronic
1121638169 14:95467682-95467704 CTCCAGTCCTGGGATTCTGGGGG - Intronic
1122196188 14:100087808-100087830 ATGCAGTCCCAGCATTCTGCGGG - Intronic
1125322867 15:38507462-38507484 AAACAGTCCTAGAAGTCTGAAGG + Intronic
1130989483 15:88867615-88867637 CTGCAGCCCAAGAACTCTGATGG + Intronic
1133447256 16:5872471-5872493 CTGTAGTCCTAGCATTTTGGAGG + Intergenic
1135203994 16:20466749-20466771 CTTCAGACCTTGCATTCTGATGG - Intronic
1135215008 16:20558174-20558196 CTTCAGACCTTGCATTCTGATGG + Intronic
1135971342 16:27074148-27074170 CTGCAGTGCTTGATTTCTGTTGG + Intergenic
1136173017 16:28499598-28499620 CTCCAGTCCTAAAGTTCTAAAGG + Exonic
1141962792 16:87420765-87420787 CTGCAGTAGCAGAATTCTGCTGG - Intronic
1142338247 16:89504280-89504302 CTGCAGTCCAAGAGCTCTGGAGG + Intronic
1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG + Intronic
1144380598 17:14693704-14693726 TGGCAGTCCTGGAGTTCTGATGG - Intergenic
1146586874 17:34090369-34090391 CTGCAGACCTGGTGTTCTGATGG + Intronic
1148354820 17:46968806-46968828 CTGCAGTCATTGAATGCAGAAGG + Intronic
1149038067 17:52157493-52157515 GTGCAGTCCTAGAAGGGTGAAGG - Intronic
1150073122 17:62169369-62169391 CTGCAGTCCAGGAATGATGAGGG + Intergenic
1151036305 17:70804564-70804586 CAGCAGTCTCAGAATTCTGAAGG + Intergenic
1153379070 18:4414918-4414940 CTTCAGTCCTTAATTTCTGAAGG + Intronic
1154103065 18:11494644-11494666 CTGCAGCCCTCCAATTCTCATGG - Intergenic
1154395411 18:13983175-13983197 CTGCATTCCTTGAATTCTATAGG + Intergenic
1156660323 18:39338930-39338952 CAGCAGTTCTGGGATTCTGAGGG - Intergenic
1157168080 18:45376796-45376818 CTGCAGATCTTGATTTCTGATGG + Intronic
1158505424 18:58043394-58043416 TTGCAGTCCTATAAATCGGAAGG + Intergenic
1159011744 18:63064552-63064574 CTGCAGGCATAGGACTCTGAAGG - Intergenic
1160059560 18:75516743-75516765 CTGCATACCTAGAATTCTGTGGG - Intergenic
1161085341 19:2332636-2332658 CTGCAGCCCCAGAAGGCTGAGGG + Intronic
1161651103 19:5485634-5485656 TTGCAGTCCTAGCACTTTGAGGG + Intergenic
1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG + Intergenic
1162246385 19:9405142-9405164 CTTCAGTCCCCCAATTCTGAGGG - Intergenic
1162933770 19:13970334-13970356 GTGCAGTTCTAGAGTTCTGTGGG - Intronic
1164842354 19:31402024-31402046 ATCCTGTCCGAGAATTCTGAGGG - Intergenic
1165443490 19:35844138-35844160 CTGCACTGCCAGAACTCTGAGGG - Exonic
1166085083 19:40469179-40469201 CTGCCTTCCTAGAATTCAGTGGG + Intronic
1166633090 19:44425194-44425216 CTGCAGTCCTTGAGGTCTCACGG - Intronic
1167654975 19:50757877-50757899 CTGCAATCCTAGCATTTTGGAGG + Intergenic
926263850 2:11295088-11295110 CTGCATTACTAGATTTCTTATGG + Intronic
926311691 2:11680103-11680125 CAGCAGTCCAGGAATGCTGAGGG + Intronic
926387002 2:12345584-12345606 CTGTAGTCCTAGCAATTTGATGG - Intergenic
926700865 2:15802437-15802459 CTGTAATCCCAGAATTTTGAGGG + Intergenic
927428309 2:23005423-23005445 ATTCAGACCTGGAATTCTGAAGG + Intergenic
928226749 2:29455909-29455931 CTGCACTCCTAGCATTGTGGGGG + Intronic
928635924 2:33246742-33246764 CTGCAGTCAAGGAATTCTGGGGG - Intronic
929237793 2:39624952-39624974 CTGTAGTCCCAGCACTCTGAGGG + Intergenic
929474168 2:42228521-42228543 CTGTAGTCTTATAATTCAGAAGG + Intronic
932280009 2:70482507-70482529 CAGCAGTCCTGGAATGCTGTTGG + Intronic
932841917 2:75091167-75091189 CTGCAGTCCTCAATTTCTTATGG + Intronic
933454044 2:82499003-82499025 CTGTAATCCTAGCACTCTGAGGG + Intergenic
933538128 2:83603034-83603056 CTGCGGGACTAGAATTGTGAAGG - Intergenic
936751460 2:115647267-115647289 CTGAAATTCTAGAATTCAGAAGG - Intronic
937820650 2:126306909-126306931 CTGCAGTCTTGGAATAATGAAGG - Intergenic
938559159 2:132455436-132455458 CTGGAGTCATTGAATTTTGAAGG + Intronic
944841281 2:203626167-203626189 CTGTAGTCCCAGAACTTTGAGGG + Intergenic
946518346 2:220438170-220438192 GTTCAGTCTTACAATTCTGAAGG + Intergenic
946639236 2:221765661-221765683 CTGCAGTCCCTCAATGCTGATGG + Intergenic
1168870009 20:1119660-1119682 CAGCAGTCCTAGAACTCTGTGGG - Intronic
1169423735 20:5480256-5480278 CTGTAGTCCTAGCAACCTGAGGG + Intergenic
1169708064 20:8529655-8529677 CTGCAGTCACAAAATTCAGAAGG + Intronic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1172409558 20:34711166-34711188 CTGCAGGCCCTGAAATCTGAAGG + Exonic
1173224521 20:41154477-41154499 CTGCTGTCCTTGAACTCTGCCGG + Intronic
1174403268 20:50287709-50287731 CTGCACTCCTGGAGTCCTGATGG + Intergenic
1176067405 20:63205414-63205436 CTCCCATCCTAGAATACTGAGGG + Intronic
1177796505 21:25784364-25784386 CTAGTGTCCTAGAAATCTGAAGG + Intergenic
1179131888 21:38644897-38644919 CTGTAATCCTAGCATTTTGAGGG + Intronic
1184151534 22:42642368-42642390 CTGCAATCCTAGAACTTGGAAGG - Intronic
1185115838 22:48937365-48937387 AGGCAGTCCTAGAATCCTGCCGG + Intergenic
950531043 3:13552539-13552561 CTGCAGCCCCAGCATTCAGAAGG - Intronic
950634758 3:14307126-14307148 CTGCCGTCCTCAAATTCGGAGGG + Intergenic
952569127 3:34693270-34693292 CTTCCTTACTAGAATTCTGAAGG - Intergenic
952790126 3:37193764-37193786 CTGTAGTCCTAGAAACCTGGGGG - Intergenic
955679030 3:61481030-61481052 CTGCAGTCTTGGCATTTTGAAGG + Intergenic
956395262 3:68819147-68819169 CTGCAGTCCCAGCTATCTGAAGG + Intronic
958182979 3:90083856-90083878 CTGCAGTCCAGGAATAGTGAGGG - Intergenic
958614863 3:96480517-96480539 TTTCAGTCTCAGAATTCTGAGGG - Intergenic
961185994 3:124915572-124915594 CTGCAACCCTAGAATTCTATGGG - Intronic
961198234 3:125021918-125021940 CTGGAGTCCTTGATCTCTGAGGG - Intronic
962072558 3:132046657-132046679 GTGAAGTCCTATCATTCTGAGGG + Intronic
964670639 3:159221437-159221459 CTGCAGTCCTAGAATTCTGAAGG + Intronic
965605120 3:170490872-170490894 CTGCAGTCCTATAATACAGTAGG + Intronic
966330673 3:178809250-178809272 CAGCTGTCCTGAAATTCTGAAGG + Intronic
970523166 4:16905896-16905918 CTGCAGTCTTAGAATTGTCTTGG + Intergenic
970550110 4:17171685-17171707 CTTCTGTCCCAGAATTCTCAGGG - Intergenic
970557187 4:17246089-17246111 CTGCATTCCTTGAATCCTGATGG - Intergenic
970758988 4:19460445-19460467 CTGTAATCCTAGCATTTTGAGGG - Intergenic
971476769 4:27080069-27080091 CTTCCCTCCTAGAACTCTGAAGG - Intergenic
972580394 4:40390503-40390525 CTGTATCCCTAGAATTTTGATGG - Intergenic
977447342 4:97147766-97147788 CTGAAGGCAGAGAATTCTGAAGG - Intergenic
977467158 4:97397129-97397151 CAGCACTCCTAGAATTCATATGG - Intronic
978178879 4:105769305-105769327 CTGCAGACCTAGCCTTATGATGG - Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
978668446 4:111215234-111215256 CTGCAGTCTTAAAATCCTGAAGG + Intergenic
979065645 4:116129248-116129270 CTGTAGTCCTAACATTCAGAAGG - Intergenic
979296245 4:119035331-119035353 CTGCCCTCCTAGAAGACTGAGGG - Intronic
979347718 4:119608247-119608269 CTGCAGTCCAAGAAAACTGAAGG + Intronic
980144616 4:128966666-128966688 CTGCATTCAAAAAATTCTGAAGG - Intronic
982135874 4:152273520-152273542 CAGCAGTCCAAGAAGTCTGTGGG + Intergenic
984015534 4:174421563-174421585 CTGCAGTCCTAGAGCTCTCATGG - Intergenic
985372529 4:189301561-189301583 CAGCAGTCCTTGTATTTTGAAGG - Intergenic
985810118 5:2076556-2076578 TTTCAGTCCTAAAACTCTGATGG - Intergenic
986046148 5:4040187-4040209 CTGCAGACCTGGGGTTCTGATGG - Intergenic
988434435 5:31157238-31157260 TTGCAGTTGTAGAAGTCTGAAGG + Intergenic
988770433 5:34427499-34427521 CTGCAGGAGTAGAATTCTCATGG - Intergenic
988786749 5:34572179-34572201 CTGTAATCCTAGCACTCTGAAGG + Intergenic
989772145 5:45157655-45157677 CTTCACTCATAGAATTCAGATGG - Intergenic
990172627 5:53070998-53071020 CTTCAAACCTAGATTTCTGATGG - Intronic
990596056 5:57313611-57313633 CTGCAGCCCTAGGAATCTAATGG + Intergenic
991098159 5:62761629-62761651 ATGCAGTTCTAAAATTTTGACGG - Intergenic
992146717 5:73857958-73857980 GTGCAGTCCTTATATTCTGATGG + Intronic
996727739 5:126687268-126687290 CTGCAATCCTAGCATTTTGGAGG + Intergenic
997490986 5:134275797-134275819 CTGCAGTGCTAGCATTCTTAGGG + Intergenic
998197745 5:140090041-140090063 CTGCAATCCTAGCATTTTGTGGG - Intergenic
999048618 5:148496968-148496990 CTGCAAACCTGGAGTTCTGATGG + Intronic
1005034737 6:21545267-21545289 CTCCAATCCTGGAATTCTCAGGG - Intergenic
1006024956 6:31140787-31140809 CTGCAGTCCAAGTACGCTGATGG + Intergenic
1006789633 6:36691288-36691310 CTGCAGGCCTAGAAGGCTCAAGG + Intergenic
1007578143 6:42939144-42939166 CTGCAGTCCTAGTACCCTGTTGG - Exonic
1014445365 6:121521083-121521105 CTGCATTCCTTGACTACTGATGG + Intergenic
1014458977 6:121672455-121672477 CTGTAGTCCTAGCTATCTGAGGG + Intergenic
1015640233 6:135324203-135324225 CTGCAGTCCTAGCACTCAGGAGG + Intronic
1017656582 6:156634970-156634992 CAGCAGTCCTGGGCTTCTGAAGG - Intergenic
1017961137 6:159221624-159221646 CTGCAGTCCATGAACTCTCAGGG + Exonic
1019558421 7:1643952-1643974 CTGCAGTCCCAGCACTTTGAGGG - Intergenic
1020865609 7:13557178-13557200 CTGCAGTCCTATCATTCAGATGG - Intergenic
1024995078 7:55267953-55267975 CTCCAGTCCTAACCTTCTGATGG + Intergenic
1026417065 7:70193163-70193185 CTGTGGTCCTTGAACTCTGATGG + Intronic
1027006545 7:74698534-74698556 CTGCAGTCCTAGCTGTCTGGGGG - Intronic
1028060155 7:86302696-86302718 CTGAAGTCATAGAAATCAGAAGG + Intergenic
1030064157 7:105646362-105646384 CTGTAGTCCTAGGATTTTGGGGG + Intronic
1033812346 7:145030771-145030793 CTGCGGTCCTAGGATACAGAAGG - Intergenic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1036501248 8:9316368-9316390 CTGAAGTCCCAGAAATCTAAAGG + Intergenic
1038580424 8:28743942-28743964 CAGAACTTCTAGAATTCTGAGGG - Intronic
1042979694 8:74511839-74511861 CTGCAGTCCTAGAAGATGGATGG + Intergenic
1044211083 8:89552196-89552218 CTGCAGTCCTAACCTTTTGAGGG - Intergenic
1046424186 8:114024921-114024943 CTGAAGTATTAGAACTCTGAGGG + Intergenic
1047310140 8:123685047-123685069 GTGCTGTCCTAGGGTTCTGAAGG + Intronic
1050437169 9:5623242-5623264 TAGCCATCCTAGAATTCTGATGG - Intergenic
1050600149 9:7242460-7242482 CTGCAGTCCTTGATTTTGGATGG + Intergenic
1050919845 9:11187272-11187294 CTGCATTTCCTGAATTCTGAGGG - Intergenic
1051038737 9:12780348-12780370 CTGCACTCATAGAATTCACAAGG + Intronic
1052777849 9:32751460-32751482 TTCCAGGCCAAGAATTCTGAAGG + Intergenic
1053049184 9:34944569-34944591 CTGCAGTCTTAGGGTTCAGAGGG + Intergenic
1053473022 9:38360180-38360202 CTCCAGCCCTGGAATTCTGTGGG + Intergenic
1057043183 9:91862398-91862420 CTGCAATCCTAGCACTTTGAGGG + Intronic
1057287772 9:93774283-93774305 GTTCAGTCCCAGAATTCTGAAGG - Intergenic
1058375675 9:104318309-104318331 CTGCAGTCTTAGCATTATTAAGG - Intergenic
1059487691 9:114639428-114639450 CTGCAGCCCCAGAGTTCTGTTGG + Intronic
1189238751 X:39509192-39509214 GTGAAGTTCTAGAACTCTGATGG - Intergenic
1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG + Intronic
1195372199 X:104187764-104187786 TTACAGTCCTAAATTTCTGAAGG + Intronic
1196737160 X:118989994-118990016 CTGCATTCCTAGAATGGGGATGG - Intronic
1197571025 X:128150809-128150831 CTGGAGTCCTTGAATTTTGAAGG - Intergenic
1199696427 X:150345843-150345865 CTGCAGGCCCTGTATTCTGATGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic