ID: 964671273

View in Genome Browser
Species Human (GRCh38)
Location 3:159228992-159229014
Sequence TATAATATGCAGGGGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964671273 Original CRISPR TATAATATGCAGGGGGTAAA TGG Intronic
900280533 1:1864782-1864804 TCTAAGATGCAGTGAGTAAAAGG - Intronic
902492896 1:16798163-16798185 TGTAATACACAGGTGGTAAAGGG + Intronic
906672923 1:47670601-47670623 TATAATATGCAGGGAGGGAGGGG - Intergenic
908408997 1:63843938-63843960 GATAATAGGCAGGCAGTAAATGG - Intronic
910051975 1:82985466-82985488 TAAAATGTGCTTGGGGTAAAGGG + Intergenic
910198463 1:84671773-84671795 TATAATCTGGAGGGAGTATATGG - Intronic
910464059 1:87477812-87477834 TATAATATGGAGGGATTGAAGGG - Intergenic
910608952 1:89119106-89119128 TATAATATTTAGAGGCTAAAAGG + Intronic
920547850 1:206833509-206833531 TAAAATTTCCAGGGGGTAATTGG - Intronic
923527553 1:234784367-234784389 TGTAATACACAGGTGGTAAAGGG - Intergenic
923610933 1:235493055-235493077 AATAAAATGTAGGGGGTCAAAGG + Intronic
924860108 1:247911600-247911622 TGTAATATCCACGGGGGAAAAGG + Intergenic
1062772919 10:118253-118275 TAAAATATTTAGGGGGAAAATGG - Intergenic
1064549764 10:16487602-16487624 AATAATATGTAGGGATTAAATGG - Intronic
1066278654 10:33892792-33892814 TATAATATGCAGGAGTGATATGG - Intergenic
1068110147 10:52670774-52670796 AATAGAATGCAGGGGATAAAAGG + Intergenic
1069478177 10:68755607-68755629 TAAAATAAGCCGGGGGGAAAAGG - Intronic
1071879320 10:89877832-89877854 TATAATTGGGAGGGGTTAAAGGG + Intergenic
1073980058 10:109144082-109144104 TATTATGTGCGGGGAGTAAATGG - Intergenic
1074713624 10:116198532-116198554 TAAGATATGCAGGAGATAAATGG + Intronic
1074765572 10:116697487-116697509 TATAGTAAGCACTGGGTAAATGG - Intronic
1079552512 11:21717125-21717147 TCTAATATGCAGGGCCTAAAAGG + Intergenic
1081448919 11:43154500-43154522 TTTAATATCCAGGGGGTGAGAGG + Intergenic
1081876619 11:46412792-46412814 TACATTATGCAAGAGGTAAATGG + Intronic
1082936560 11:58662407-58662429 TTTAATATTCTGGGGGTAAGAGG - Intronic
1082937570 11:58670518-58670540 CATAATATCCAGGGGGGACAGGG - Intronic
1082937590 11:58670595-58670617 CGTAATATCCAGGGGGTAGAGGG - Intronic
1084349308 11:68583635-68583657 GATTATAAGCAGGTGGTAAAGGG - Intronic
1084603749 11:70161144-70161166 TGCAATCTGCAGGGGGGAAAGGG - Exonic
1086444700 11:86860388-86860410 TTTAATATCCAGGGGGTGAGAGG + Intronic
1089701905 11:120249965-120249987 GATAATATGCAGGGAGTTAATGG - Intronic
1091313273 11:134590846-134590868 TAAAATATGCAGTTGGTCAATGG - Intergenic
1095697005 12:45154840-45154862 CATAATATCCAGGGGGAAAGAGG + Intergenic
1095697530 12:45158003-45158025 TCTAATATCCAGGGGGTGAGAGG + Intergenic
1097355368 12:58594811-58594833 GACAATATGCAGGGAGCAAAGGG + Intronic
1097434492 12:59541812-59541834 TCTAATATCCAGGGGGTGACAGG + Intergenic
1097697903 12:62792274-62792296 TATAATACCAAGGGGTTAAATGG - Intronic
1098266097 12:68721543-68721565 TATAATATGTAGGGAGTAGTGGG - Intronic
1099070439 12:78039569-78039591 TGTAATATGGATGGGGTAGAGGG + Intronic
1099182448 12:79483940-79483962 TATATTGTCCAGGGGGTAAGAGG - Intergenic
1099338208 12:81392563-81392585 TATAATATGGCAGGGGTGAAAGG - Intronic
1100668174 12:96778689-96778711 GATAATTTTCAGGGGGTAAAAGG + Intronic
1101392044 12:104310045-104310067 TATCAGATGTAGGGGGTGAAAGG - Intronic
1103670065 12:122606832-122606854 TAAAATATTCAGGGGGTAAGGGG - Intronic
1109355788 13:61229230-61229252 TCTAATATCCAGGGGGGAAGTGG - Intergenic
1109657680 13:65415485-65415507 TATGATATGCAAGAGGTAAAGGG - Intergenic
1110247227 13:73340624-73340646 TATCAGGTGCTGGGGGTAAAGGG - Intergenic
1111754796 13:92379653-92379675 ACTAATATGCAGGGGGCACAGGG - Intronic
1112216486 13:97435060-97435082 TAAAACTTGCAGGGGGGAAAGGG + Intronic
1112483779 13:99801256-99801278 AAGAATAGGCAGGGGGAAAAGGG - Intronic
1112602623 13:100871654-100871676 GATAATTTGCAGGGGGTACATGG - Intergenic
1114436328 14:22710439-22710461 CATAATATCCAGGGGGAAAGAGG - Intergenic
1116517169 14:45817064-45817086 CCTAATATGCAGGGGGAAATAGG + Intergenic
1116518746 14:45827094-45827116 TTTAATATCCAGGGGGTGAAAGG + Intergenic
1116519756 14:45833703-45833725 CATAATATTTAGGGGGGAAAAGG - Intergenic
1116519893 14:45834704-45834726 TCTAATATCCAGGGTGGAAAAGG - Intergenic
1116519981 14:45835245-45835267 CATAATATCCTGGGGGTAAGAGG - Intergenic
1117848767 14:59943677-59943699 CATAATATGCATGGGGAAAGAGG + Intronic
1119225765 14:72943578-72943600 CATCATTTGCAGGGGGTGAAAGG + Intronic
1120097552 14:80405039-80405061 TATAATTTGATGGGGGAAAAGGG + Intergenic
1120829356 14:88984451-88984473 TAAAATATGCATGGCATAAAAGG + Intergenic
1125445881 15:39755604-39755626 TCTGATATGCAGAGGGTAGAGGG - Intronic
1125488828 15:40131503-40131525 TTTAATATCTAGGGGGCAAAGGG + Intergenic
1125863632 15:43021685-43021707 GAAAATATTCAGGGGGAAAAAGG - Intronic
1127106705 15:55624166-55624188 TAAAATATTTAGGGGGAAAAAGG - Intronic
1129103234 15:73285902-73285924 AATGAGATTCAGGGGGTAAAGGG - Intronic
1129649151 15:77468698-77468720 TGAAATATCCTGGGGGTAAAGGG - Intronic
1129662593 15:77561349-77561371 TATAATATCCAGGGGGGCAGAGG + Intergenic
1129662609 15:77561424-77561446 TGTAATATCCAGGGGGGAGATGG + Intergenic
1133476730 16:6129797-6129819 TATAAAATGCAGGGGATGAATGG + Intronic
1133616003 16:7477496-7477518 AATAATATTCAGGGGGCAGAAGG - Intronic
1133990924 16:10707150-10707172 CATAATATCCAGGGGGTGAGTGG - Intergenic
1133991455 16:10710656-10710678 TCTAATATCCAGGGAGGAAAGGG - Intergenic
1133992074 16:10716473-10716495 CATAATATCCAGGGGGTGAGTGG - Intergenic
1133992268 16:10717698-10717720 TGTAATATACAGGGGGGAAGGGG - Intergenic
1138979668 16:62251934-62251956 TATAGTATGCAGGGCTTAGAAGG - Intergenic
1141732935 16:85834439-85834461 TTTAATATGATGGGGGGAAATGG - Intergenic
1142809582 17:2389077-2389099 GATAAGATCTAGGGGGTAAAGGG - Intronic
1144454377 17:15406883-15406905 CATAGTATGGAGGGGGAAAAAGG + Intergenic
1149123694 17:53201781-53201803 CATAATATGTAGAGGGAAAATGG + Intergenic
1149890795 17:60389127-60389149 TATAAAATGAATGGGGGAAAGGG - Intronic
1156930057 18:42630735-42630757 GAAAATCTGCAAGGGGTAAAGGG - Intergenic
1158616944 18:58996642-58996664 TATAATATGTCGCGGGTAAATGG - Intergenic
1164466898 19:28494792-28494814 TGTAATTTGTAGGGGGAAAATGG - Intergenic
1166238038 19:41470663-41470685 TCTAATATCAAGGGGGAAAAAGG - Intergenic
1166238450 19:41473334-41473356 TGTAATATCCAGGGGGTTAGAGG - Intergenic
1166243615 19:41510515-41510537 TATAATATCCAGGGGGGAGAGGG - Intergenic
1166245583 19:41523258-41523280 TCTAATATTCAGGTGGAAAACGG - Intergenic
927318954 2:21720456-21720478 TATAGTCTGCAGGGAGAAAAGGG - Intergenic
928864392 2:35900454-35900476 TATATGTTGGAGGGGGTAAATGG - Intergenic
930729645 2:54715462-54715484 TATAAAATGCTAGGGCTAAAGGG - Intergenic
931100847 2:58999149-58999171 TATAATATGCAGAAGCTAAAGGG + Intergenic
937173156 2:119897684-119897706 TATAACATGCAGTGGCTATATGG - Intronic
937651331 2:124322491-124322513 TGTAATATAAAGGGGGTAAGAGG + Intronic
940033716 2:149291463-149291485 TTTAAAATGCAAGGGGGAAAAGG - Intergenic
940562064 2:155311255-155311277 TAGCATATGCAGGACGTAAAGGG - Intergenic
942804113 2:179909748-179909770 GAGAATATGAAGGGGGGAAAGGG + Intergenic
942813213 2:180021754-180021776 TGTAATATCCAGGGGGGAGAGGG - Intergenic
943259277 2:185637989-185638011 TATAAAATGCAGCAGGTAGAAGG - Intergenic
944321876 2:198355393-198355415 GATAATCTGCAGAAGGTAAATGG + Intronic
948229026 2:236336241-236336263 TATAGCATGCAGGGAGTAGATGG + Intronic
1168992959 20:2110323-2110345 TTTAATGTGAAGGGGGGAAAAGG - Intronic
1169312344 20:4554899-4554921 AATCATATGCAGGAGGAAAAGGG + Intergenic
1172551960 20:35807998-35808020 GATAATATGAAGGGGGAAAAGGG + Intronic
1182967355 22:34534708-34534730 CATATTAGACAGGGGGTAAAAGG + Intergenic
949331229 3:2925139-2925161 TATAATTTGCATTTGGTAAAAGG - Intronic
949719433 3:6971411-6971433 TAAAATATGCAGGGGGTGATGGG - Intronic
950157419 3:10733128-10733150 AATAAAATACAGGGAGTAAAAGG + Intergenic
951408708 3:22334388-22334410 TATAATTTGGAAAGGGTAAATGG - Intronic
951654001 3:24983803-24983825 TATTAAATGCAGGGGGGAGAGGG + Intergenic
956483857 3:69700640-69700662 TAAAATATGGAGGTGATAAATGG + Intergenic
957891117 3:86360562-86360584 TTTAATATTAAGGGGGAAAAGGG - Intergenic
958197459 3:90259433-90259455 AATAATATGCAGTTGCTAAAAGG + Intergenic
958420914 3:93929533-93929555 AATAATATGCAGTTGCTAAAAGG + Intronic
959642254 3:108655205-108655227 CACAATATGCAGGTGATAAATGG - Intronic
960459190 3:117912641-117912663 TACAATAAGCTTGGGGTAAATGG - Intergenic
961272710 3:125700918-125700940 TCTAATATCCAGCGGGTAAGAGG - Intergenic
962452615 3:135533215-135533237 TATAATAGGCAAGTGGTAATTGG - Intergenic
962576743 3:136761915-136761937 TAAAATATTCAGGAGGCAAAAGG - Intergenic
963124539 3:141802935-141802957 TAGAATATGCAGAAGGGAAAAGG - Intronic
964279144 3:155043654-155043676 TATATTATGAAGGTGGCAAATGG - Intronic
964407926 3:156368958-156368980 TATAATTTGTATGTGGTAAAAGG + Intronic
964671273 3:159228992-159229014 TATAATATGCAGGGGGTAAATGG + Intronic
964889837 3:161521156-161521178 CATAATATCCAGGGGGGAGAGGG - Intergenic
965399668 3:168200874-168200896 TCTAATATCCAGGGGAAAAAAGG - Intergenic
966264940 3:178028568-178028590 TATTATATGGAGAGGGTGAAGGG + Intergenic
966585056 3:181614255-181614277 TATAGTATCTAGGTGGTAAATGG + Intergenic
966609723 3:181856446-181856468 TATTTTGTGTAGGGGGTAAAAGG + Intergenic
969451300 4:7275096-7275118 TATAATTTTCTGGGAGTAAACGG + Intronic
970581203 4:17475834-17475856 TTTAAAATGCAGGTGGTAATTGG - Intronic
971144754 4:23964563-23964585 GCTAATATGCAGGTGGTATATGG + Intergenic
977433110 4:96957296-96957318 GAAAATATTCAGAGGGTAAAGGG + Intergenic
978318744 4:107469726-107469748 TATGATATGCATGGCTTAAATGG - Intergenic
979337252 4:119477317-119477339 TATAACATGCAGTGGTTAAAAGG + Intergenic
982442665 4:155455185-155455207 TAGCATATACAGGGAGTAAAGGG + Intergenic
982448812 4:155527425-155527447 TATAATATGCAGGTGGTTATGGG - Intergenic
983151990 4:164295585-164295607 CATAATATTCAGGAGGGAAATGG + Intronic
983537646 4:168875518-168875540 TATAATATGCAGGGACTGGAGGG - Intronic
983623863 4:169785678-169785700 CGTAATATCCAGGGGGTAACAGG + Intergenic
985183660 4:187292829-187292851 TATAATATTCAGGGATCAAAAGG - Intergenic
986238808 5:5938408-5938430 CATATTATGCAGGGAGCAAAGGG - Intergenic
988268528 5:28983938-28983960 TCTAATATGCAGAGCTTAAAAGG - Intergenic
989259059 5:39398827-39398849 TTTAACATGCAGTGGGTAGAAGG + Intronic
989757138 5:44969007-44969029 TAAAATAGGCCAGGGGTAAAAGG - Intergenic
991373923 5:65946031-65946053 GACAAAATGCAGGGGGTAAAGGG - Intronic
994392696 5:99205347-99205369 TGTAATATCCAGGGGGGAAGAGG - Intergenic
994394559 5:99217434-99217456 TGTAATATCCACGGGGGAAAAGG - Intergenic
994394655 5:99217867-99217889 CATAATATCCAGGGGGGAGAGGG - Intergenic
994395409 5:99222575-99222597 TATACTATACAGGGGGAAAGAGG - Intergenic
995906589 5:117131374-117131396 AATAAGATGCAGAGGGAAAATGG - Intergenic
996221709 5:120940834-120940856 TTTAATATACAGGGGATAAAGGG + Intergenic
996577267 5:124989239-124989261 TTGAGTTTGCAGGGGGTAAAAGG + Intergenic
996750182 5:126880170-126880192 TAAAAGAAGCAGGAGGTAAAAGG + Intronic
997682385 5:135765546-135765568 TTTAATATCCAGGGGGAAAAGGG + Intergenic
997682510 5:135766192-135766214 TGTAATATTCAGGGGGAAGAGGG + Intergenic
997682566 5:135766482-135766504 CATAATATCCAGGGGGGAGAGGG + Intergenic
997682760 5:135767644-135767666 CACAATATCCAGGGGGAAAAAGG + Intergenic
997687014 5:135795808-135795830 CATAATATCCAGGGGGGAGAGGG + Intergenic
997687203 5:135796775-135796797 CCTAATATCCAGGGGGAAAAAGG + Intergenic
997687239 5:135797002-135797024 TCTAATATCCAGGGGAGAAAAGG + Intergenic
997687414 5:135798267-135798289 TCTAATATCCAGGGGGAAAGAGG + Intergenic
998935335 5:147227479-147227501 TATAATATTCAGAGGGGAAGAGG - Intergenic
1001896613 5:175387771-175387793 TATAATATCTATGGGGAAAAGGG + Intergenic
1004267468 6:14161418-14161440 AATAACATGCATGGAGTAAATGG + Intergenic
1004543926 6:16578648-16578670 TATCTTATGCAGGGGGCAAAAGG + Intronic
1004991887 6:21147391-21147413 TAGAATATGATGGGGGTAATGGG + Intronic
1005031769 6:21515440-21515462 AATAATATGCAGCGACTAAAGGG + Intergenic
1008920034 6:56833787-56833809 TATAATATGCAGTGGCTCAAAGG + Intronic
1009046337 6:58241036-58241058 CCTAATATTCAGGGGGTAAGAGG + Intergenic
1009046572 6:58242547-58242569 GATAATATTCAGGGGGAAAGAGG + Intergenic
1009046886 6:58244565-58244587 TCTAATATTCAAGGGGTAAGAGG + Intergenic
1009049393 6:58259848-58259870 TCTAATATCCAGGGGGTGAGAGG - Intergenic
1009049774 6:58262462-58262484 TATAATAACCAGGGGGGAAGAGG - Intergenic
1009222152 6:60995353-60995375 CCTAATATTCAGGGGGTAAGAGG + Intergenic
1009222695 6:60998868-60998890 CCTAATATCCAAGGGGTAAAAGG + Intergenic
1009223412 6:61003143-61003165 CATAATATGCAGAGGGAAAGAGG + Intergenic
1009224827 6:61012175-61012197 TTTAATATGCAGGGAGAAAAGGG - Intergenic
1009224948 6:61013082-61013104 TCTAATATCCAGGGGGTGAGAGG - Intergenic
1009226060 6:61020986-61021008 CCTAATATCCAGGGGGGAAAAGG - Intergenic
1009226948 6:61028968-61028990 TATAATATTCAGGGGGTAAGAGG - Intergenic
1009337180 6:62506192-62506214 TATAATATCCAGGTGGGAAGGGG + Intergenic
1009362851 6:62836142-62836164 TCTAATATACAGGGGGTAAGAGG + Intergenic
1009363561 6:62840885-62840907 TATAATATCCAGGGGGAGAGAGG + Intergenic
1009364646 6:62848565-62848587 TATAATATGAAGGGAGGAAGAGG + Intergenic
1009366830 6:62862928-62862950 CATAATATCCAGGGGGAAACAGG - Intergenic
1009367231 6:62864962-62864984 TATAATATCCAGGGGGCAAGAGG - Intergenic
1009367576 6:62867732-62867754 TGTAATATCCAGGGGGAAAGAGG - Intergenic
1009369135 6:62879383-62879405 TCTAATATTCAGGGGGGAAGAGG + Intergenic
1010899152 6:81404239-81404261 TACAAAATGCAGGTGGCAAAAGG + Intergenic
1011560641 6:88610600-88610622 TATTATGTTCAGGGGCTAAATGG + Exonic
1012268236 6:97173890-97173912 TAGAATAAGCAAGGGGTGAAAGG + Intronic
1014826317 6:126051976-126051998 TATATCATGCTGGGGGAAAACGG - Intergenic
1015791896 6:136971710-136971732 TAAAATAAGCAGTGGGCAAAGGG - Intergenic
1016920347 6:149286789-149286811 TATAATATTAAGGGGAAAAAAGG + Intronic
1018033077 6:159859189-159859211 TAAAATATCCATGGGTTAAAGGG - Intergenic
1020336221 7:7064297-7064319 TCTAATATACAGGGTGGAAAAGG + Intergenic
1021669427 7:23020514-23020536 TATAAGATGGAGGAGGAAAATGG - Intergenic
1022189191 7:28000299-28000321 TATAGTATCTAGGGGGTAGAGGG + Intronic
1026767388 7:73168813-73168835 AATATTATTCAGGGGGGAAAAGG + Intergenic
1027043855 7:74978515-74978537 AATATTATTCAGGGGGGAAAAGG + Intronic
1027079790 7:75223837-75223859 AATATTATTCAGGGGGGAAAAGG - Intergenic
1028926469 7:96361985-96362007 TATGAGAGGCAGGGAGTAAATGG - Intergenic
1029343839 7:99964634-99964656 CATAATATGCAAGGGGGAAGAGG - Intergenic
1030984736 7:116228152-116228174 TAAAATAAGCAGGGGATAAAAGG + Intronic
1031291097 7:119936195-119936217 TGTAAAATGCAGAGGGTAGAAGG + Intergenic
1031714895 7:125096923-125096945 AATAATATGCATGGGGTGATGGG + Intergenic
1032951802 7:136922969-136922991 TATAATAGGAATGGTGTAAAAGG + Intronic
1038638178 8:29303924-29303946 TCTAATATCCAGGGAGAAAAAGG - Intergenic
1043588670 8:81799531-81799553 TAGAAAATGGAGGGGGAAAATGG + Intergenic
1043635482 8:82377535-82377557 CCTAATATCCAGGGGGAAAAAGG + Intergenic
1044146196 8:88717357-88717379 TATAATATTCAGTGGTGAAATGG + Intergenic
1044913400 8:97086277-97086299 TAGAATGCTCAGGGGGTAAAGGG + Intronic
1045924343 8:107568443-107568465 TGTAATATCCAGGGGGGAAGAGG + Intergenic
1045927387 8:107588659-107588681 CATAATATCCAGGGGGAAAGAGG + Intergenic
1045927924 8:107592329-107592351 TTTAATATGCAGAAGGAAAAAGG + Intergenic
1046398217 8:113669505-113669527 TATAACAGGCAAGGGGAAAAGGG + Intergenic
1046406824 8:113784655-113784677 TTTAATATCCATGGGGTAAGTGG - Intergenic
1051232246 9:14965848-14965870 TCTAATATACAGGGGGGGAAAGG - Intergenic
1051232471 9:14967270-14967292 CATAATATCCAGGGGGAAACAGG - Intergenic
1058518615 9:105798792-105798814 TATAATATCCCCGGGGGAAAAGG - Intergenic
1058893591 9:109381694-109381716 GACAATATCCAGTGGGTAAATGG + Exonic
1059078257 9:111218297-111218319 TTAAATATTCAGGGGGAAAATGG + Intergenic
1060155321 9:121315928-121315950 TATCATATGCAAGGATTAAAGGG + Intronic
1186624232 X:11275275-11275297 GATAATACACAGTGGGTAAAGGG + Intronic
1191896498 X:65998687-65998709 AATAATATTCAGTGAGTAAATGG - Intergenic
1193504274 X:82321344-82321366 AATAATATCTAGGGGGAAAATGG - Intergenic
1197085331 X:122467378-122467400 TATAATAAGCAGGCAATAAATGG + Intergenic
1198076092 X:133194613-133194635 AATAATATGCACAGGGTTAAGGG + Intergenic
1198111104 X:133503290-133503312 TATTTTTTGCAGGGGGTAAGGGG + Intergenic
1199373255 X:147076463-147076485 TATTATATGCAGAGGCTCAAAGG - Intergenic
1199466109 X:148139264-148139286 TCTAATATCCAGGGTCTAAAAGG + Intergenic
1201586555 Y:15567494-15567516 TAAAAGATGAAGGGGGTGAAGGG + Intergenic