ID: 964682983

View in Genome Browser
Species Human (GRCh38)
Location 3:159362802-159362824
Sequence TACTGCTGTCTCTACACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964682980_964682983 -7 Left 964682980 3:159362786-159362808 CCATTTCCTCTCTATATACTGCT 0: 1
1: 0
2: 4
3: 38
4: 418
Right 964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 111
964682976_964682983 13 Left 964682976 3:159362766-159362788 CCTTTGTGCTTTATCCCCATCCA 0: 1
1: 0
2: 0
3: 12
4: 208
Right 964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 111
964682977_964682983 -1 Left 964682977 3:159362780-159362802 CCCCATCCATTTCCTCTCTATAT 0: 1
1: 0
2: 5
3: 38
4: 377
Right 964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 111
964682979_964682983 -3 Left 964682979 3:159362782-159362804 CCATCCATTTCCTCTCTATATAC 0: 1
1: 0
2: 2
3: 38
4: 421
Right 964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 111
964682978_964682983 -2 Left 964682978 3:159362781-159362803 CCCATCCATTTCCTCTCTATATA 0: 1
1: 0
2: 6
3: 31
4: 341
Right 964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964682983 Original CRISPR TACTGCTGTCTCTACACAGG TGG Intronic
901605943 1:10459311-10459333 TCCTCCTGTCTCCACACAGACGG - Exonic
901730313 1:11274039-11274061 GGCTCCTTTCTCTACACAGGAGG + Exonic
901767791 1:11514935-11514957 TACTCCTGTCTGTATACAGTAGG + Intronic
905887159 1:41497476-41497498 GACTGCTCTATCTTCACAGGAGG + Intergenic
906925925 1:50116607-50116629 TACTGCTGCATCTTCAAAGGGGG - Intronic
908851884 1:68385276-68385298 AACTGCTGTCACTGCACTGGTGG - Intergenic
910211595 1:84799219-84799241 TACTCCTGTCTATACAACGGAGG + Intergenic
914850248 1:151308803-151308825 AAATGCTGTTTCTACAAAGGAGG - Intronic
915831157 1:159131742-159131764 TACTGCTCAATCTACACAGTTGG + Intronic
917629373 1:176877744-176877766 TTCTGCTGTGTCACCACAGGAGG + Intronic
920247436 1:204599149-204599171 CAGTGCAGTGTCTACACAGGAGG - Intergenic
920420182 1:205827840-205827862 TGCTACTGTCTCACCACAGGAGG - Intergenic
920963803 1:210685960-210685982 CACTGAGGTCACTACACAGGTGG + Intronic
921799648 1:219387403-219387425 AACTGCTGTGTTTACACAGATGG + Intergenic
923612518 1:235507356-235507378 TACAGCTGTCTCTACTCATGGGG + Intergenic
924942072 1:248818863-248818885 CCCTGCTGTCTCTGGACAGGAGG + Intronic
1067859819 10:49834389-49834411 TACTGCTGTCTCTAAATAACTGG + Intronic
1070273789 10:74984409-74984431 TACTGATGGCTATAGACAGGAGG - Intronic
1076049092 10:127318478-127318500 TGCTGCTGCCTCTCCCCAGGAGG - Intronic
1089417744 11:118306623-118306645 TACTGAAACCTCTACACAGGGGG - Intronic
1089745685 11:120615351-120615373 TTTTGGTGTCTATACACAGGAGG - Intronic
1090805444 11:130199344-130199366 CACAGCTGTGTCTACACAGCAGG - Intronic
1091526706 12:1309531-1309553 CCATGCTGTCTCTCCACAGGTGG - Intronic
1094200311 12:27788216-27788238 AACTTCTTTCTCTACATAGGGGG + Intronic
1094432959 12:30389805-30389827 TCCTGCTGTCTCTGCATAGAAGG - Intergenic
1098250968 12:68569187-68569209 TAATGCTGTTTCCACAAAGGAGG + Intergenic
1099036298 12:77591484-77591506 TAGTGTTATCTCTACACAGAAGG + Intergenic
1106764804 13:32903158-32903180 TCCTACTGTCCCTACACATGTGG + Intergenic
1109639794 13:65175403-65175425 TGCTCCTGTGACTACACAGGTGG - Intergenic
1111918132 13:94383074-94383096 AACTGCTGTCTCTTGTCAGGAGG - Intronic
1112467513 13:99656858-99656880 TACTGCTGGCTCTAGGAAGGAGG + Intronic
1119716607 14:76864066-76864088 CACTGCTGTTTCTTCACAGCAGG - Intronic
1121492751 14:94371855-94371877 TCCTGCTGTCCCTCCTCAGGAGG + Intergenic
1121688747 14:95859205-95859227 TCCTGTTGTTGCTACACAGGAGG + Intergenic
1124557066 15:30736136-30736158 TCCTGCAGACTCTCCACAGGCGG + Intronic
1124674192 15:31669608-31669630 TCCTGCAGACTCTCCACAGGCGG - Intronic
1125524798 15:40368115-40368137 TACTGCTGGCGCTGCACCGGCGG + Exonic
1128944472 15:71811505-71811527 TGCTGCTGTCTCCGCACACGCGG - Exonic
1129350837 15:74955251-74955273 GAGAGCTGTCTCTGCACAGGCGG + Exonic
1130542919 15:84834981-84835003 TGGTGCTGCCTCTACACAGTGGG - Intronic
1131267266 15:90923938-90923960 TGCTGCTCTCTCTGCACAAGTGG - Intergenic
1131918794 15:97300968-97300990 TACTCCAGTCTCTATAAAGGAGG + Intergenic
1132176042 15:99715830-99715852 CACTGTTGTGTGTACACAGGTGG + Exonic
1132389755 15:101429642-101429664 AACTGCTGTCTTCACACAGCAGG + Intronic
1136910407 16:34140717-34140739 TACTGCCCTTTCTACGCAGGAGG - Intergenic
1137016092 16:35376997-35377019 AACTGTTGTCTCCACAAAGGAGG + Intergenic
1143075419 17:4338595-4338617 CTCTGCTGTCTATACACAGTTGG - Intronic
1146317201 17:31817210-31817232 TGCTGTTGTCTTTACTCAGGAGG + Intergenic
1146587113 17:34091910-34091932 TACTGTAGTCTCTACAGATGAGG - Intronic
1156301600 18:35841155-35841177 AACTACTGTCTCCACACAGCTGG + Intergenic
1159408282 18:68035138-68035160 TGCTTCTGTATCTACACAGTAGG - Intergenic
1160379923 18:78446412-78446434 TACTGCTGTTACAACTCAGGTGG - Intergenic
1162938023 19:13991432-13991454 CAGGGCTGTGTCTACACAGGCGG + Intronic
1163363482 19:16862714-16862736 CACTGTTGTCTCTGCTCAGGTGG - Intronic
1166262271 19:41648652-41648674 GAGTGCTCTCTCTACAAAGGAGG + Intronic
1166280847 19:41792176-41792198 GAGTGCTCTCTCTACAAAGGAGG - Intergenic
1167522170 19:49961461-49961483 TATTGCTGTATCTCCACAGAGGG + Intergenic
1168031792 19:53685926-53685948 TTCTGTTTTCTCTACACATGAGG + Intergenic
926757066 2:16244797-16244819 TCCATCTGTCTTTACACAGGGGG + Intergenic
929484089 2:42339443-42339465 TACTCCTGCCTCTACAGAGCTGG + Intronic
930406806 2:50968806-50968828 TACTGGTGTCTTTAAACAGAAGG - Intronic
932137170 2:69241804-69241826 TAATGCTGTCTCTCTGCAGGTGG - Intronic
933192322 2:79348765-79348787 GACTGCTGTGTCTAGACAAGGGG - Intronic
936974807 2:118208172-118208194 TCCTGCTTTGTCTACATAGGTGG - Intergenic
938239089 2:129728961-129728983 TGCTGCTGTCTTTACACAGTGGG - Intergenic
945254555 2:207792569-207792591 GACTGCTCTCTTTACACATGAGG + Intergenic
946039599 2:216772386-216772408 CACTGCAGTCTCAACCCAGGAGG - Intergenic
946338754 2:219055470-219055492 GGCAGCTGTCTCTACACACGTGG - Exonic
1171455699 20:25270905-25270927 TACTGCGGTGTTTGCACAGGTGG + Intronic
1175658904 20:60795227-60795249 TCCTGCTTTCTCTAAACTGGTGG - Intergenic
1176368835 21:6050451-6050473 TACTGGTGTCTCTCCAAAGGCGG + Intergenic
1178377259 21:32076867-32076889 TACTGCTTTCTCGCCACACGGGG - Intergenic
1179754684 21:43488091-43488113 TACTGGTGTCTCTCCAAAGGCGG - Intergenic
1179791659 21:43759441-43759463 CACTGCTGCCCCGACACAGGTGG - Exonic
1180865769 22:19118840-19118862 TGCTGCCTTCTCTACACAGATGG + Intronic
1184459081 22:44627029-44627051 GGCTCCTGTCTCTACACAGGAGG - Intergenic
1185321521 22:50202121-50202143 AAGCGCTGTCTATACACAGGAGG - Intronic
953453108 3:43020457-43020479 TAGTGCTGTCTCTACAAATGGGG - Intronic
955329420 3:58034793-58034815 TTCTGTTGTCTCTCCACAGACGG + Intronic
957207522 3:77216774-77216796 TACTTCTATCTCTAAAGAGGTGG + Intronic
957627172 3:82668224-82668246 CACTGTTGTCTCCACACAGGAGG - Intergenic
959475674 3:106809244-106809266 TACTGCTGTCTCTTCTCAGCGGG - Intergenic
959946733 3:112133228-112133250 TTCTGCTGTCTCTGCACGGGTGG - Exonic
961147980 3:124611229-124611251 TACTTCTCTCTCTACCTAGGCGG - Intronic
962343013 3:134601220-134601242 TACAGCTGTCTTTACAAAGGGGG + Intronic
964682983 3:159362802-159362824 TACTGCTGTCTCTACACAGGTGG + Intronic
965303907 3:167040240-167040262 TACGGTTGTCTATACACAGAAGG - Intergenic
969312588 4:6362563-6362585 TACGGCTGTCTCAACAAAGCTGG + Intronic
972694966 4:41436270-41436292 TCATGCCATCTCTACACAGGCGG - Intronic
986710815 5:10486778-10486800 CTCTGCTGTCTCTTCAGAGGAGG + Intergenic
988638224 5:33011090-33011112 TACTGCTGTTCCTTCACATGTGG - Intergenic
988818221 5:34855084-34855106 TACTGCTGTCTCCACAGACGTGG - Intronic
992365693 5:76086874-76086896 TACTGCTGTCCCTAATTAGGAGG - Intronic
994154677 5:96489776-96489798 CCCTGCTCTCTCTACACAGCTGG + Intergenic
995859400 5:116625838-116625860 TCCTGCTGTCTTGACAAAGGTGG + Intergenic
997943863 5:138182251-138182273 ATCTGCTGGCTCTGCACAGGAGG + Intronic
998879390 5:146631194-146631216 TCCTGCTGTCTCCACCCTGGAGG + Intronic
1000872724 5:166597375-166597397 TCTTTCTGTCTCTAAACAGGAGG - Intergenic
1001911077 5:175518309-175518331 GACTGCTGTGTCTACTCAGTAGG + Intronic
1002332704 5:178455459-178455481 TATTACTCTCTTTACACAGGAGG - Intronic
1003340056 6:5211959-5211981 TACTGTTTTCTCTAGACATGAGG + Intronic
1013163193 6:107565869-107565891 AACTGCTTTCCCTGCACAGGAGG - Intronic
1017507683 6:155083436-155083458 TACTGCTGTGGCCACACAGCTGG + Intronic
1018729537 6:166638055-166638077 TGCTGCTGTTTTCACACAGGCGG - Intronic
1022211923 7:28219242-28219264 TGCTGCTGTTTCTACACAATAGG + Intergenic
1031708739 7:125017150-125017172 TACTGCTGTCTCTTCATGGATGG + Intergenic
1032401544 7:131627744-131627766 GACCTCTGTCCCTACACAGGTGG + Intergenic
1033927098 7:146476018-146476040 GGAAGCTGTCTCTACACAGGTGG + Intronic
1034155486 7:148952982-148953004 TTCTCCTGTATCTACACATGTGG - Intergenic
1035277301 7:157755447-157755469 TACAGCTGTGTCTTCACGGGGGG + Intronic
1036400822 8:8406197-8406219 TATTGCTGTCTGTGCACACGAGG + Intergenic
1037847637 8:22297921-22297943 TACTGCTGTCTATACATATAAGG - Intronic
1048267855 8:133003678-133003700 AGCTGCAGTCTCTGCACAGGCGG - Intronic
1048916657 8:139190540-139190562 TACTTGTGTCTTTACACAAGTGG + Intergenic
1049152162 8:141041933-141041955 TTCTCCTCTCTCTAAACAGGAGG + Intergenic
1049207942 8:141372062-141372084 TCCTGCTGTCTCTGCCCTGGGGG - Intergenic
1051882738 9:21856600-21856622 CACTGCTGGTTCTACAAAGGAGG - Intronic
1051968933 9:22863549-22863571 TACTGGTGTCTCTACTCATCTGG + Intergenic
1057027915 9:91749407-91749429 TACTGGTGTCTTTATACAAGAGG - Intronic
1057262005 9:93590137-93590159 TACTGATTTCTCTACACACTGGG + Intronic
1057793616 9:98140416-98140438 TACAGTGGTCTCTACACAGATGG - Intronic
1185877561 X:3713111-3713133 TCCTGCAGGCTGTACACAGGCGG + Exonic
1198517013 X:137419738-137419760 TACTGCTGTCTCAGAACATGAGG - Intergenic