ID: 964684519

View in Genome Browser
Species Human (GRCh38)
Location 3:159380421-159380443
Sequence TGTCATGTCTAGAATTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964684519 Original CRISPR TGTCATGTCTAGAATTTGGG TGG (reversed) Intronic
901085684 1:6610920-6610942 TGTAAACTCTACAATTTGGGAGG + Intronic
901482523 1:9535338-9535360 TGTAATGTCAACATTTTGGGAGG + Intergenic
902326940 1:15707163-15707185 TGTAATCCCTAGAATTTGAGAGG + Intronic
902819365 1:18934326-18934348 TGTCATCTCAATACTTTGGGAGG - Intronic
903458895 1:23507259-23507281 TGTCATCTCAACACTTTGGGAGG + Exonic
903808019 1:26019266-26019288 TGTCATCTCAGCAATTTGGGAGG - Intergenic
905943654 1:41884220-41884242 TGTAATCTCAAGACTTTGGGAGG - Intronic
906577808 1:46906473-46906495 TGCCTTGTTTAGAATTTAGGTGG - Intergenic
907750148 1:57255403-57255425 TGTAATGCCAACAATTTGGGAGG + Intronic
907829078 1:58047033-58047055 TGTCATGGTAAGAATTTGGAGGG - Intronic
908226688 1:62062751-62062773 TGTCATCTCTGCACTTTGGGAGG - Intronic
908499127 1:64725333-64725355 TGTAATGTCAACACTTTGGGAGG - Intergenic
908633410 1:66135878-66135900 TTTCATGTCCAAAGTTTGGGAGG - Intronic
910257298 1:85260429-85260451 GGTCGGGTCTAGAGTTTGGGTGG - Intergenic
910815160 1:91284507-91284529 TGTAATCTCAACAATTTGGGAGG - Intronic
910913675 1:92265517-92265539 TGTCATCTCAACACTTTGGGAGG + Intronic
912842529 1:113051639-113051661 TGTAATCTCAAGACTTTGGGAGG + Intergenic
912868513 1:113281347-113281369 TGTCATTTCTATTGTTTGGGTGG + Intergenic
914205671 1:145525633-145525655 TGTAATCTCAACAATTTGGGAGG - Intergenic
916176666 1:162045805-162045827 TGCCATGTTTAGAATTTGAATGG + Intergenic
916398378 1:164417394-164417416 TGTAATGTCTAGAATTTTAGAGG - Intergenic
916709116 1:167386440-167386462 TGTCATCTCAACACTTTGGGAGG - Intronic
916803688 1:168238397-168238419 TGTAATGCCAAGACTTTGGGAGG + Intronic
916810252 1:168299174-168299196 TGTCATCTCAGCAATTTGGGAGG - Intronic
917517958 1:175723613-175723635 TGTAATCTCAACAATTTGGGAGG + Intronic
918000390 1:180488835-180488857 TGTAATTCCTATAATTTGGGAGG - Intronic
918063276 1:181080764-181080786 AGTGATGTGCAGAATTTGGGCGG + Intergenic
918324517 1:183396583-183396605 TGGCCTGACTAGCATTTGGGAGG - Intronic
921058461 1:211562741-211562763 TGTCATCTCAACAGTTTGGGAGG + Intergenic
921620834 1:217324533-217324555 TGTCATGACTAGGGTTTGGAAGG + Intergenic
923610029 1:235482863-235482885 TTTTATGTCTAGTATTTTGGGGG - Intronic
1064055113 10:12090741-12090763 TGTAATATCTACACTTTGGGAGG - Intronic
1064687899 10:17883383-17883405 TGTAATCTCAACAATTTGGGAGG - Intronic
1064778163 10:18803572-18803594 TGTAATCTCTGTAATTTGGGAGG - Intergenic
1065933312 10:30498484-30498506 TGTCATCTCAATACTTTGGGAGG - Intergenic
1066114491 10:32227507-32227529 GGTAATGTCTAGAGTTGGGGTGG + Intergenic
1068357510 10:55928738-55928760 TGTAATTTCGACAATTTGGGAGG - Intergenic
1069049262 10:63775435-63775457 TGTCATTTCAGGTATTTGGGAGG - Intergenic
1069230451 10:66002789-66002811 TCTCATTTCTGGAATATGGGTGG - Intronic
1069449573 10:68505515-68505537 TGTAATCCCAAGAATTTGGGAGG + Intronic
1072131280 10:92496527-92496549 TGTAATCTCAACAATTTGGGAGG + Intronic
1073928661 10:108547444-108547466 TGTAATCTCAACAATTTGGGGGG - Intergenic
1074988444 10:118679470-118679492 TGTAATGTCAATACTTTGGGAGG - Exonic
1075033010 10:119039412-119039434 TGTAATCTCAGGAATTTGGGAGG + Intronic
1075607438 10:123822870-123822892 TGTCATCTCTGGAAATTGTGAGG - Intronic
1076472679 10:130729718-130729740 TGTAATGTCAACACTTTGGGAGG - Intergenic
1076946392 10:133654258-133654280 TGTAATGTAAACAATTTGGGAGG + Intergenic
1079713736 11:23718447-23718469 TGTCATCTCAACACTTTGGGAGG + Intergenic
1080764585 11:35283413-35283435 TGTGGTGTCTACAATTTAGGAGG + Intronic
1081919873 11:46764092-46764114 TGTCATCCCAACAATTTGGGAGG - Intronic
1082263246 11:50093901-50093923 TGTAATCTCTACATTTTGGGAGG + Intergenic
1083941451 11:65898439-65898461 TGTCATCTCAACACTTTGGGAGG - Intronic
1084798326 11:71524312-71524334 TGTCATCTCAACACTTTGGGAGG + Intergenic
1084804331 11:71568447-71568469 TGTCATCCCTGCAATTTGGGAGG + Intronic
1084806104 11:71580063-71580085 TGTCATCCCTGCAATTTGGGAGG - Intronic
1085002056 11:73046837-73046859 TGTAATCTCAAGATTTTGGGAGG - Intronic
1086162553 11:83738694-83738716 TATGATGCCTAGGATTTGGGTGG - Intronic
1086788854 11:91008819-91008841 TGTCATATATAGATTTTGTGAGG - Intergenic
1087290404 11:96314678-96314700 ACTCAGGGCTAGAATTTGGGAGG - Intronic
1087582059 11:100069409-100069431 TGTCATATCAGGAATTTGAGAGG - Intronic
1088618599 11:111659319-111659341 AGCCATGTCTAGAACATGGGAGG - Intronic
1089068670 11:115681695-115681717 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1089656785 11:119953429-119953451 TTTCATTTCTAGAATTTGGGGGG - Intergenic
1089898077 11:121952128-121952150 AGTCAGGTCTAGAAGTTAGGAGG + Intergenic
1090060378 11:123459509-123459531 TGTAATCTCAACAATTTGGGAGG - Intergenic
1091531748 12:1363810-1363832 TGTAATGGCAACAATTTGGGAGG - Intronic
1092300630 12:7246557-7246579 TGTCAACTGTAGAATTTAGGTGG + Intergenic
1094145160 12:27221028-27221050 TGTAATGCCAACAATTTGGGAGG - Intergenic
1095085677 12:38055710-38055732 TGTCATGCCAGCAATTTGGGAGG + Intergenic
1095161755 12:38925824-38925846 TATCAAGTCTGGAATTTAGGCGG + Intergenic
1095205054 12:39430307-39430329 TGTCATGCCAACACTTTGGGAGG + Intronic
1095498449 12:42810270-42810292 TGTCATGTCATGAATTTGCAAGG + Intergenic
1095728815 12:45482204-45482226 TGTAATGTCGGCAATTTGGGAGG + Intergenic
1095890137 12:47228282-47228304 TGTAATCTCTACACTTTGGGAGG - Intronic
1096109312 12:49019835-49019857 TGTTTTGTTTTGAATTTGGGGGG - Exonic
1097256402 12:57678783-57678805 GCTCATGCCTATAATTTGGGAGG + Intergenic
1097296708 12:57973067-57973089 TGTAATCTCTACACTTTGGGAGG + Intergenic
1097440640 12:59603743-59603765 TGTCATCTTTAGCATTTTGGTGG + Intronic
1097712023 12:62927401-62927423 TGTCATCCCTACATTTTGGGAGG + Intronic
1099123874 12:78727874-78727896 TGTCATCTCAACACTTTGGGAGG - Intergenic
1100173580 12:92004829-92004851 TGTAATCTCAGGAATTTGGGAGG - Intronic
1100481194 12:94981171-94981193 TGTAATGTCAACACTTTGGGAGG + Intronic
1102239958 12:111319055-111319077 TGTAATCTCTACACTTTGGGAGG + Intronic
1102666021 12:114573612-114573634 TGTCATGTCAGCACTTTGGGAGG + Intergenic
1102743121 12:115225524-115225546 TGTCATCTCTAATATTTGGTTGG - Intergenic
1103832487 12:123790866-123790888 TGTCATGCCAACACTTTGGGAGG + Intronic
1104056721 12:125236411-125236433 TGTAATCCCAAGAATTTGGGAGG - Intronic
1104077610 12:125404211-125404233 TGACATGTCCAGAATTTGTCAGG + Intronic
1106902723 13:34371149-34371171 TGTGATGTCTTTAATGTGGGTGG + Intergenic
1107466234 13:40653221-40653243 TGTAATGTCAGCAATTTGGGAGG - Intronic
1108367456 13:49730274-49730296 TGTAATGTCTGCACTTTGGGAGG + Intronic
1110493759 13:76140222-76140244 TGTAATCCCGAGAATTTGGGAGG - Intergenic
1111439005 13:88253504-88253526 TATAATCCCTAGAATTTGGGAGG - Intergenic
1111796337 13:92925111-92925133 TGACATGTCTAGAATTTTTGTGG + Intergenic
1112139087 13:96618355-96618377 TGTAATCTCTAGTCTTTGGGAGG - Intronic
1112316500 13:98367403-98367425 TGTCATGCCAGCAATTTGGGAGG - Intronic
1112539550 13:100294536-100294558 TGTCAAGTCTTCATTTTGGGGGG - Intronic
1112967066 13:105210361-105210383 TGTAATCTCAACAATTTGGGAGG + Intergenic
1113007070 13:105718306-105718328 TGTAATCTCAACAATTTGGGAGG - Intergenic
1115407731 14:33037386-33037408 TGTCATCTCAGCAATTTGGGAGG + Intronic
1116460224 14:45164199-45164221 TGTAATGTCAACACTTTGGGAGG - Intronic
1117117837 14:52534640-52534662 ATTCATGTCTAGAATGAGGGTGG - Intronic
1118357006 14:65022621-65022643 TGTAATCCCTAGACTTTGGGAGG - Intronic
1118894963 14:69938270-69938292 TGCTATGTTTAGAATTTGTGTGG + Intronic
1119870302 14:78011451-78011473 TGCCATGTTTAGATTCTGGGAGG + Intergenic
1119964515 14:78899266-78899288 TTTCATGTCTTGAATTTTTGGGG - Intronic
1121548955 14:94783615-94783637 TGTCATCTCAGCAATTTGGGAGG + Intergenic
1202843429 14_GL000009v2_random:145148-145170 TGTAATGTCAACACTTTGGGAGG - Intergenic
1202912827 14_GL000194v1_random:135386-135408 TGTAATGTCAACACTTTGGGAGG - Intergenic
1202879816 14_KI270722v1_random:47294-47316 TGTAATGTCAACACTTTGGGAGG + Intergenic
1202924435 14_KI270724v1_random:10763-10785 TGTAATGTAAACAATTTGGGAGG - Intergenic
1123773213 15:23549918-23549940 TGTAATCTCTATAATTTGGAAGG - Intergenic
1124137744 15:27049595-27049617 TGTCATGTTCAGTACTTGGGAGG - Intronic
1125119563 15:36138208-36138230 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1126832900 15:52627142-52627164 TATCAGGTTTAGAATTTGGGTGG - Intronic
1127535402 15:59885528-59885550 TGTAATGCCTACATTTTGGGTGG - Intergenic
1128411599 15:67404424-67404446 TGTCCCGTCTAGAATTTAGTAGG + Intronic
1129218612 15:74117422-74117444 TGTAATCCCTACAATTTGGGAGG + Intronic
1129342468 15:74895229-74895251 TGTCATCTCAGGACTTTGGGAGG - Intronic
1129355593 15:74988770-74988792 TGTCATTTTTAAAAATTGGGGGG - Intronic
1129815588 15:78550437-78550459 TGTGATGTCAACACTTTGGGAGG - Exonic
1132562433 16:602824-602846 TGTCATCTCGACACTTTGGGAGG - Intronic
1133159276 16:3899141-3899163 TGTAATGTCAGGACTTTGGGAGG + Intergenic
1133506998 16:6422176-6422198 TGTAATGTCAACATTTTGGGAGG - Intronic
1133797380 16:9057152-9057174 TGTAATCCCTACAATTTGGGAGG + Intergenic
1133892803 16:9896772-9896794 TGTCCTTCCTAGAAATTGGGTGG - Intronic
1133907801 16:10037873-10037895 TGTAATCTCAACAATTTGGGAGG - Intronic
1134067344 16:11237272-11237294 TGTAATCCCTACAATTTGGGAGG + Intergenic
1134067968 16:11241445-11241467 TGTCATCCCAACAATTTGGGAGG - Intergenic
1135385186 16:22032802-22032824 TGTAATGCCGAGACTTTGGGAGG - Intronic
1135896152 16:26405036-26405058 TGTAATCTCAACAATTTGGGAGG + Intergenic
1137692200 16:50436516-50436538 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1139397066 16:66648713-66648735 TGTCATCTCAACACTTTGGGAGG + Intronic
1140087547 16:71810164-71810186 TGTCATCTCCACACTTTGGGAGG - Intergenic
1140388358 16:74562729-74562751 TGTAATCTCTACACTTTGGGAGG - Intronic
1140627718 16:76814519-76814541 TGTAATCTCTGGACTTTGGGAGG - Intergenic
1140769934 16:78194329-78194351 TGTAATCTCTGCAATTTGGGAGG + Intronic
1141561686 16:84872623-84872645 TGGCATTTCTAGAACTGGGGCGG + Intronic
1142745513 17:1955297-1955319 TGTAATGCCAATAATTTGGGAGG + Intronic
1142770020 17:2089925-2089947 TGTCATGTCAGCACTTTGGGAGG + Intronic
1143714915 17:8760278-8760300 TGTCATCCCTACACTTTGGGAGG + Intergenic
1143721554 17:8814612-8814634 TGTCATTTCTTCAATTTTGGGGG - Intronic
1143853856 17:9834045-9834067 TGTAATGTCTAGAGTTTAGCTGG + Intronic
1146226456 17:31070785-31070807 TGTCATCTCAACACTTTGGGAGG + Intergenic
1147505370 17:41011323-41011345 TGACATGACTAGATTTTGGAAGG + Intronic
1148737452 17:49872892-49872914 TGTGATTTCCAGAATTTGGCAGG - Intergenic
1150331069 17:64294805-64294827 TGTAATCTCTATACTTTGGGAGG - Intergenic
1150910754 17:69384993-69385015 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1151291591 17:73154686-73154708 TGTCAAGTCTTCATTTTGGGGGG + Intergenic
1151760883 17:76102316-76102338 TGTAATACCCAGAATTTGGGAGG + Intronic
1153022919 18:647474-647496 GGTCAGGTCTAGAGTCTGGGAGG + Intronic
1153444359 18:5155140-5155162 TGTCATCTCAATACTTTGGGAGG - Intronic
1153932927 18:9894934-9894956 TGTAATCTCAGGAATTTGGGAGG + Intergenic
1155131222 18:22936614-22936636 AATCATTTTTAGAATTTGGGAGG - Intronic
1155879271 18:31123585-31123607 TGTAATGTCAGCAATTTGGGAGG - Intergenic
1157127309 18:44969075-44969097 TGTGATTACTAGAATTTTGGTGG - Intronic
1158356575 18:56627068-56627090 TGTAATGTCTGCACTTTGGGAGG - Intronic
1158989272 18:62852134-62852156 TGTAATTTCTACACTTTGGGAGG - Intronic
1159422140 18:68235011-68235033 TTTCAAGTCTAATATTTGGGAGG + Intergenic
1160109406 18:76011641-76011663 TGTTATGTGTGTAATTTGGGTGG - Intergenic
1160257692 18:77260978-77261000 TGTCATTTATACAATTTGTGAGG + Intronic
1160277823 18:77454697-77454719 TGTAATGTCTACATTTTGGTTGG - Intergenic
1161193083 19:2970365-2970387 TGTAATGCCAACAATTTGGGAGG + Intergenic
1162086409 19:8251968-8251990 TGTAATGTCAGCAATTTGGGAGG + Intronic
1164262722 19:23582216-23582238 TGTAATGTCAAAACTTTGGGAGG + Intronic
1164718801 19:30416060-30416082 TTTCATGTCAGGAATTTGGCTGG + Intronic
1164957205 19:32396652-32396674 TGTAATATCAACAATTTGGGAGG + Intergenic
1165051591 19:33145104-33145126 TGTAATGTCAACACTTTGGGAGG - Intronic
1165919746 19:39288644-39288666 TGTAATCTCAACAATTTGGGAGG - Intergenic
1166684086 19:44784820-44784842 TGTCATTTCAACACTTTGGGAGG - Intronic
1168715395 19:58524108-58524130 TGTCATCTCAGGACTTTGGGAGG + Intronic
1202655434 1_KI270708v1_random:16313-16335 TGTAATGTCAACACTTTGGGAGG + Intergenic
925532100 2:4875491-4875513 TGTGATGTCCTGATTTTGGGAGG - Intergenic
925540599 2:4962530-4962552 AGACATGTCTAGACTTGGGGCGG - Intergenic
928016963 2:27666386-27666408 TGTAATCTCTACACTTTGGGAGG - Intronic
929976342 2:46639149-46639171 TGTAATCCCAAGAATTTGGGAGG + Intergenic
930707830 2:54521778-54521800 TGTAATCTCAACAATTTGGGAGG - Intronic
931017901 2:58006897-58006919 TGGCTTGTCTAGGAATTGGGAGG - Intronic
931355295 2:61532579-61532601 TGTCATCTCCACACTTTGGGAGG + Intronic
931373324 2:61684568-61684590 TGTCATGTCAGCACTTTGGGAGG - Intergenic
932054527 2:68431366-68431388 TGTAATCTCAAGACTTTGGGAGG - Intergenic
932237020 2:70128883-70128905 TGTAATCTCAACAATTTGGGAGG - Intergenic
932793858 2:74678674-74678696 TGTCACTTCCAGGATTTGGGTGG - Intronic
935288970 2:101592979-101593001 TGTAATCTCTACACTTTGGGAGG - Intergenic
937722090 2:125112365-125112387 TCTCATGTCTAAAATGTAGGTGG + Intergenic
937934782 2:127234542-127234564 TGTCATCCCAACAATTTGGGAGG + Intergenic
939050657 2:137303276-137303298 TGTCATCTCAAAACTTTGGGAGG - Intronic
939668075 2:144975288-144975310 TGTAATGTCTAGAATATGATGGG + Intergenic
941942450 2:171056429-171056451 TTTCATGTGTAGTCTTTGGGAGG - Intronic
942982864 2:182103129-182103151 TATAATGTCTAAAAGTTGGGGGG + Intronic
944132507 2:196362042-196362064 TTTCATTTCTAGAACTTTGGGGG - Intronic
944306432 2:198185075-198185097 TGTCATCTCAACACTTTGGGAGG + Intronic
944771389 2:202917469-202917491 TGTCAATTCTAGGGTTTGGGAGG + Intronic
946202530 2:218079123-218079145 TGTAATCTCTACACTTTGGGAGG - Intronic
946617276 2:221523541-221523563 TGTAATCTCAACAATTTGGGAGG - Intronic
946794658 2:223337363-223337385 AGTCATGTCTTGGATTTGTGAGG + Intergenic
947210626 2:227705342-227705364 TGTCATCTCAACACTTTGGGAGG + Intronic
947620816 2:231589845-231589867 TGTCATGTCAGCACTTTGGGAGG + Intergenic
1169635016 20:7680316-7680338 TGTAATCTCAACAATTTGGGAGG - Intergenic
1170209019 20:13829384-13829406 TGTAATCTCAACAATTTGGGAGG + Intergenic
1170580540 20:17696259-17696281 TGTAATCTCTGTAATTTGGGAGG - Intronic
1171113572 20:22505131-22505153 TGTCATTTTTAGACTGTGGGTGG - Intergenic
1172820112 20:37725161-37725183 TGTAATCTCAACAATTTGGGAGG - Intronic
1172938134 20:38635405-38635427 TGTAATGCCAACAATTTGGGAGG + Intronic
1173121875 20:40300264-40300286 TGTCTGTTCTTGAATTTGGGTGG - Intergenic
1173194968 20:40906582-40906604 TGTAATGTCAACACTTTGGGAGG + Intergenic
1174569609 20:51492316-51492338 TGTCTTTTCTAGAAGCTGGGGGG - Intronic
1175126467 20:56755840-56755862 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1176632186 21:9150059-9150081 TGTAATGTCAACACTTTGGGAGG - Intergenic
1176641121 21:9304757-9304779 TGTAATGTCAACACTTTGGGAGG + Intergenic
1177226233 21:18260554-18260576 TGTAATCCCAAGAATTTGGGAGG + Intronic
1177404985 21:20654981-20655003 TGTCCTTTCTTGAATATGGGAGG - Intergenic
1177874538 21:26615321-26615343 TGTAATCTCAACAATTTGGGAGG + Intergenic
1178344509 21:31813306-31813328 TGTAATCTCAACAATTTGGGAGG - Intergenic
1178560618 21:33636136-33636158 TGTCATCCCAACAATTTGGGAGG + Intronic
1178869309 21:36359482-36359504 GCTCATGCCTATAATTTGGGAGG - Intronic
1179200051 21:39208823-39208845 TGTAATCCCTGGAATTTGGGAGG - Intronic
1179222718 21:39423896-39423918 TGTAATCTCTACACTTTGGGAGG + Intronic
1180350142 22:11794139-11794161 TGTAATGTCAACACTTTGGGAGG + Intergenic
1180388069 22:12198113-12198135 TGTAATGTCAATACTTTGGGAGG - Intergenic
1181020371 22:20098245-20098267 TGTCATCTCAACAATTTGGGAGG - Intronic
1181742097 22:24929375-24929397 TTTCATGCCAAGAATTTGGGAGG + Intergenic
1181979550 22:26756528-26756550 TGTAATCTCAACAATTTGGGAGG - Intergenic
1182549857 22:31094941-31094963 TGTAATGTCAACAGTTTGGGAGG - Intronic
1183360435 22:37380382-37380404 TGTCATGTCTGGGATTTCGGGGG - Intronic
1183424313 22:37730683-37730705 TGTAATGCCAAGACTTTGGGAGG + Intronic
949206436 3:1444542-1444564 TGTCATGTTTAGAATATGCCAGG - Intergenic
950643842 3:14365456-14365478 TCTCTTTTCTTGAATTTGGGTGG - Intergenic
951369673 3:21829865-21829887 TGTCATCTCAACACTTTGGGAGG + Intronic
952142726 3:30497962-30497984 TGTAATCTCTACACTTTGGGAGG - Intergenic
952242538 3:31547399-31547421 TGTCATTTCCACACTTTGGGAGG + Intronic
953172915 3:40524338-40524360 TGTCCTGTGTTGACTTTGGGAGG - Intergenic
953709029 3:45254035-45254057 TGTAATTTCTACACTTTGGGAGG - Intergenic
955114122 3:55980370-55980392 TGTGAAGTCTACATTTTGGGGGG - Intronic
956843742 3:73163464-73163486 TTGCAAGTCTAGAATTTGGCAGG + Intergenic
956853246 3:73251836-73251858 TGTAATCTCTACACTTTGGGAGG - Intergenic
957035128 3:75287249-75287271 TGTAATGTCAGCAATTTGGGAGG - Intergenic
957081087 3:75636203-75636225 TGTAATGTAAACAATTTGGGAGG - Intergenic
959561167 3:107783283-107783305 TTTTATATCTATAATTTGGGGGG + Intronic
959993287 3:112652807-112652829 TGTCATATCAATAAATTGGGTGG - Intergenic
960518826 3:118631777-118631799 TGTAATCTCAAAAATTTGGGAGG + Intergenic
961035696 3:123640126-123640148 TGTCACGTCTAGTATGTGGTAGG + Intronic
961884371 3:130086408-130086430 TGTCATCTCAACACTTTGGGAGG + Intronic
962633463 3:137303456-137303478 TGTGATGTCCACAGTTTGGGGGG - Intergenic
963075101 3:141338852-141338874 TGTCAGGTCTAGAATCTAGAAGG - Intronic
963080465 3:141388379-141388401 TATTATGTATATAATTTGGGGGG + Intronic
963322065 3:143819656-143819678 TGTCATTATTATAATTTGGGTGG + Intronic
963465798 3:145680234-145680256 TGTCGTGTATAGAATTTGAGGGG + Intergenic
964256213 3:154777288-154777310 TCTGACGTCCAGAATTTGGGGGG + Intergenic
964684519 3:159380421-159380443 TGTCATGTCTAGAATTTGGGTGG - Intronic
965314295 3:167171960-167171982 TTTCTTGTCAAGAATTTGGCTGG - Intergenic
965840585 3:172901454-172901476 TGTAATCTCAACAATTTGGGAGG - Intronic
966271645 3:178114832-178114854 TGTAATGTCAACACTTTGGGAGG + Intergenic
966331155 3:178815378-178815400 TGTAATCTCTACACTTTGGGAGG - Intronic
967414562 3:189201905-189201927 TGTAATCTCAACAATTTGGGAGG - Intronic
968023960 3:195422774-195422796 TGTCATGTTAAGGATTTTGGAGG - Intronic
968065291 3:195755315-195755337 TGTAATCTCAAGTATTTGGGAGG - Intronic
1202745773 3_GL000221v1_random:100269-100291 TGTAATGTCAACACTTTGGGAGG - Intergenic
970999008 4:22301480-22301502 TGTCATGGCTAGCATTTGGGAGG - Intergenic
971509377 4:27405368-27405390 TTTGTTCTCTAGAATTTGGGTGG + Intergenic
972244677 4:37233316-37233338 GGTCATGTTGACAATTTGGGAGG + Intergenic
972606557 4:40619170-40619192 TGTAATGTCAACATTTTGGGAGG + Intronic
972910471 4:43810321-43810343 TGTAATCTCAACAATTTGGGAGG + Intergenic
973767348 4:54175032-54175054 TCTAATGTCTAGAATCTGTGAGG + Intronic
974005861 4:56556614-56556636 TGTAATCTCAAGACTTTGGGAGG + Intronic
974481017 4:62442917-62442939 TGTAATCTCTACACTTTGGGAGG + Intergenic
975215884 4:71753980-71754002 TGTCATGTGTAGCAAGTGGGTGG - Intronic
975764330 4:77651419-77651441 TGTAATGCCAACAATTTGGGAGG + Intergenic
975820457 4:78265874-78265896 TGACCTGCCTAGAATTTGTGAGG - Intronic
976969284 4:91084186-91084208 TGTAATCTCTACACTTTGGGAGG - Intronic
977377824 4:96229814-96229836 TGTAATGTCAGCAATTTGGGAGG + Intergenic
978045888 4:104126578-104126600 TCTCACCTCTAGAATTTGAGTGG - Intergenic
978935630 4:114371718-114371740 TGTCATCTCAGCAATTTGGGTGG + Intergenic
979679619 4:123445350-123445372 TGTCATTTCAACACTTTGGGAGG + Intergenic
980870955 4:138610143-138610165 AGTCCTTTCTAGAATTTGGAGGG - Intergenic
982386659 4:154812501-154812523 TGTTCTGTCTAGAATCTGGATGG - Intronic
983722906 4:170880060-170880082 TTTCAAGTCTACAATATGGGTGG - Intergenic
985449805 4:190054911-190054933 TGTAATGTAAACAATTTGGGAGG + Intergenic
986050972 5:4089931-4089953 TGTAATGTCAACATTTTGGGAGG - Intergenic
986712794 5:10499915-10499937 TGTAATCACAAGAATTTGGGAGG + Intergenic
987436084 5:17895429-17895451 TGTAATCTCAACAATTTGGGAGG - Intergenic
988570580 5:32361069-32361091 TGTAATCTCAAGACTTTGGGAGG - Intronic
988874381 5:35427844-35427866 TGTAATCTCAACAATTTGGGAGG + Intergenic
990442924 5:55864861-55864883 TGTCATGTGTAAAATGTGTGTGG - Intronic
993292983 5:86099413-86099435 TGTCATAACGATAATTTGGGGGG - Intergenic
993460909 5:88179981-88180003 TAACATGTATGGAATTTGGGGGG + Intergenic
993945753 5:94115540-94115562 TGTCATGGATGGATTTTGGGAGG - Intergenic
994188199 5:96838666-96838688 TGTCATGTGTGGACTTTGGGAGG - Intronic
994655200 5:102584121-102584143 TGTCATGACTAGGTGTTGGGAGG - Intergenic
994837736 5:104877441-104877463 TGTCATGTCTTTATTTTGGTAGG - Intergenic
994994917 5:107048658-107048680 TGTCAGGTGTAGAATTTTAGTGG - Intergenic
995189911 5:109309229-109309251 TGTCATGTTTAGACAGTGGGTGG - Intergenic
995900836 5:117064445-117064467 TGTAATGTCAACACTTTGGGAGG - Intergenic
995985094 5:118161355-118161377 TGTAATCCCTAGACTTTGGGAGG - Intergenic
997782904 5:136677964-136677986 TGTCAGTGCTAGAATTTAGGAGG + Intergenic
998408515 5:141888961-141888983 TGTAATGCCTACACTTTGGGAGG - Intergenic
998777704 5:145620612-145620634 TGTAATGCCAACAATTTGGGAGG + Intronic
1002509762 5:179706711-179706733 TGTAATGCCAACAATTTGGGAGG - Intronic
1003073724 6:2964984-2965006 GATAATGTCTAGAATTTGGCCGG - Intronic
1004061327 6:12200852-12200874 TTTTATGTCAAGAATTTGGGGGG - Intergenic
1006259877 6:32858776-32858798 TGTAATGCCAACAATTTGGGAGG + Intronic
1007035429 6:38668671-38668693 TGTAATGTCTAGAAGGTTGGAGG - Intergenic
1007329162 6:41090372-41090394 TGACATCTTTAGAATTTGAGTGG + Intronic
1007685009 6:43661402-43661424 TGTCATCTCAACACTTTGGGAGG + Intronic
1008010472 6:46461840-46461862 TGTAATCTCAACAATTTGGGAGG - Intronic
1008085453 6:47239465-47239487 TGTCATGAATAAAATTTGGAAGG - Intronic
1008282965 6:49618125-49618147 TGTCATGATCAGCATTTGGGTGG + Exonic
1009836108 6:69003681-69003703 TGTCATGTTTACAATAAGGGCGG - Intronic
1011110463 6:83832347-83832369 TGACATGTTTAAATTTTGGGAGG + Intergenic
1011807155 6:91084984-91085006 TGTCATGTTTGGAATTGTGGGGG + Intergenic
1012068525 6:94580846-94580868 GGTAATCTCAAGAATTTGGGAGG + Intergenic
1012826769 6:104155901-104155923 TGTCATTCCTAGTGTTTGGGAGG - Intergenic
1013154236 6:107477833-107477855 TGTAATCTCAACAATTTGGGAGG + Intergenic
1016724275 6:147343135-147343157 TATAGTGTCTAGAATTTAGGAGG - Intronic
1017181387 6:151555987-151556009 TGTAATGTCAACACTTTGGGAGG + Intronic
1021636825 7:22702130-22702152 TGTCATCTCAACAGTTTGGGAGG + Intergenic
1022761169 7:33353333-33353355 TGTCTTGTTTAGAATTTGTAGGG + Intronic
1022848826 7:34239006-34239028 TGTAATGTCAACACTTTGGGAGG + Intergenic
1022942069 7:35250544-35250566 TACGAAGTCTAGAATTTGGGAGG - Intronic
1022968731 7:35497869-35497891 TGTAATGCCTCCAATTTGGGAGG + Intergenic
1024045651 7:45583894-45583916 TGTAATGTCAACACTTTGGGAGG - Intronic
1026241451 7:68579009-68579031 TGTAATGTCAATACTTTGGGAGG + Intergenic
1027649323 7:80845858-80845880 GGTCATGTTTAGTGTTTGGGTGG - Intronic
1027654466 7:80913142-80913164 TGTAATGTCAACAATTTGGGAGG + Intronic
1030073977 7:105721017-105721039 TCTCCTGGCTAGAATTTGTGTGG - Intronic
1031160805 7:118165572-118165594 TGTAATCTCAACAATTTGGGAGG - Intergenic
1031346754 7:120676092-120676114 TGTAATCTCAACAATTTGGGAGG - Intronic
1031866710 7:127044897-127044919 TGTCATTTTTAAATTTTGGGTGG - Intronic
1032039524 7:128547700-128547722 TGTAATGTCAACACTTTGGGAGG - Intergenic
1032867036 7:135936226-135936248 TGTAATGTCAACACTTTGGGAGG + Intronic
1033140936 7:138825928-138825950 TGTAATGTCTGCACTTTGGGAGG + Intronic
1035645115 8:1213028-1213050 TCTCATGATGAGAATTTGGGAGG + Intergenic
1035881680 8:3249902-3249924 TTTCATGTCTATAATTTAGTTGG - Intronic
1037195720 8:16186869-16186891 TGTAATGCCAAAAATTTGGGAGG - Intronic
1038874971 8:31538562-31538584 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1039585732 8:38705523-38705545 TGTAATGTCAACACTTTGGGAGG - Intergenic
1042855544 8:73263254-73263276 TATAATCTCAAGAATTTGGGAGG + Intergenic
1044562967 8:93631351-93631373 TGTAATCTCTACACTTTGGGAGG + Intergenic
1044977043 8:97675064-97675086 TGTAATCTCAACAATTTGGGAGG - Intronic
1045268419 8:100641278-100641300 TGTCATCTCAACACTTTGGGAGG + Intronic
1045275749 8:100703791-100703813 TGTAATTTCAAGACTTTGGGAGG + Intronic
1047172821 8:122510706-122510728 TGTGTTGTTTATAATTTGGGGGG - Intergenic
1048034817 8:130667509-130667531 TGTCAGGGCTGGAATTTAGGGGG - Intergenic
1051624665 9:19087596-19087618 TGTAATGCCTATATTTTGGGAGG + Intronic
1051626705 9:19105698-19105720 TGTAATCTCTACACTTTGGGAGG + Intergenic
1051807117 9:21006881-21006903 TGTTATGTCTAGAGTTTTGGGGG + Exonic
1053327012 9:37162814-37162836 TGTCATCTCAACACTTTGGGAGG + Intronic
1053569704 9:39291356-39291378 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1054091335 9:60850361-60850383 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1054112750 9:61125931-61125953 TGTAATCTCAAGACTTTGGGAGG - Intergenic
1054127444 9:61327657-61327679 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1054337610 9:63820796-63820818 TGTAATGTCTGCATTTTGGGAGG - Intergenic
1054594965 9:67056215-67056237 TGTAATCTCAAGACTTTGGGAGG + Intergenic
1055304661 9:74917118-74917140 TGTGATCCCAAGAATTTGGGAGG + Intergenic
1056253817 9:84778003-84778025 TGTAATGTCAACATTTTGGGAGG + Intronic
1056534195 9:87513688-87513710 AGCCATGTCTGGAAATTGGGTGG + Intronic
1056654908 9:88501305-88501327 TGTAATCTCAACAATTTGGGAGG + Intergenic
1057341790 9:94208889-94208911 TGTCATCTCAACACTTTGGGAGG - Intergenic
1058777836 9:108302689-108302711 TGACAGATCTAGAATTTTGGGGG - Intergenic
1059147169 9:111910578-111910600 TGTCATTCCTAGAACTTGTGTGG + Intronic
1059165942 9:112076576-112076598 GGACATGTGTAGAAGTTGGGTGG + Intronic
1059201927 9:112425995-112426017 TGTAATGCCAACAATTTGGGAGG - Intronic
1059243954 9:112833824-112833846 TTTCTTGTCTAGAATGTGGGAGG + Intronic
1059304660 9:113344337-113344359 TGTAATCTCAACAATTTGGGAGG + Intergenic
1060111307 9:120908814-120908836 TGTAATCTCAACAATTTGGGAGG - Intronic
1061519073 9:131106837-131106859 TGTGATGCCAGGAATTTGGGAGG + Intronic
1061524774 9:131150386-131150408 TGTAATGGCTGGAATTGGGGAGG + Exonic
1203755013 Un_GL000218v1:117685-117707 TGTAATGTCAACACTTTGGGAGG - Intergenic
1203714394 Un_KI270742v1:130225-130247 TGTAATGTCAACACTTTGGGAGG - Intergenic
1185567708 X:1108438-1108460 TGTCATGCCAACACTTTGGGAGG - Intergenic
1185733184 X:2477587-2477609 TGTCATCTCAACACTTTGGGAGG + Intronic
1186239857 X:7554616-7554638 TGTAATCTCTACACTTTGGGAGG - Intergenic
1187050666 X:15692507-15692529 TGTAATGCCAAGACTTTGGGAGG - Intronic
1187244266 X:17539716-17539738 GGTAATGTTTAGAATTTTGGAGG - Intronic
1187690195 X:21858631-21858653 TGTAATGTCAACACTTTGGGAGG + Exonic
1188491099 X:30739709-30739731 TGTCATCTCAACACTTTGGGAGG + Intergenic
1188976477 X:36682115-36682137 TGTAAGGTCTAGATTTGGGGGGG - Intergenic
1192035857 X:67562218-67562240 TGTAATCTCAACAATTTGGGAGG - Intronic
1192640138 X:72854079-72854101 TTTCATCTCTAGAATCTGCGTGG - Intergenic
1192641573 X:72866726-72866748 TTTCATCTCTAGAATCTGCGTGG + Intergenic
1196346994 X:114674545-114674567 TTTCATATTTACAATTTGGGAGG - Intronic
1196699833 X:118656031-118656053 TGTAATGTCAACACTTTGGGAGG + Intronic
1198076016 X:133193954-133193976 TGTCATCACAACAATTTGGGAGG + Intergenic
1198183141 X:134229543-134229565 TGTAATCTCTGGACTTTGGGAGG + Intergenic
1198202831 X:134439016-134439038 TGTCATGTCTACAATTTAACTGG + Intergenic
1200685793 Y:6257797-6257819 TGTAATTTCTACATTTTGGGAGG + Intergenic
1200991325 Y:9349042-9349064 TGTAATTTCTACATTTTGGGAGG + Intergenic
1200993982 Y:9369333-9369355 TGTAATTTCTACATTTTGGGAGG + Intronic
1200996646 Y:9389653-9389675 TGTAATTTCTACATTTTGGGAGG + Intergenic
1200999160 Y:9458206-9458228 TGTAATTTCTACATTTTGGGAGG + Intergenic
1201001813 Y:9478516-9478538 TGTAATTTCTACATTTTGGGAGG + Intronic
1201004480 Y:9498817-9498839 TGTAATTTCTACATTTTGGGAGG + Intergenic
1201007133 Y:9519130-9519152 TGTAATTTCTACATTTTGGGAGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1201551969 Y:15227089-15227111 TGTCATCCCAACAATTTGGGAGG + Intergenic
1201767327 Y:17583951-17583973 TGTAATCTCAACAATTTGGGAGG + Intergenic
1201834226 Y:18322034-18322056 TGTAATCTCAACAATTTGGGAGG - Intergenic