ID: 964685280

View in Genome Browser
Species Human (GRCh38)
Location 3:159388618-159388640
Sequence GTGAAAAAGAGGAACATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 433}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964685280 Original CRISPR GTGAAAAAGAGGAACATTGA GGG Intronic
902191201 1:14764409-14764431 GGGAAAAAAAGGAACAGGGAAGG - Intronic
904933925 1:34113042-34113064 GAGAAAAAGAAGGACATGGATGG + Intronic
906769151 1:48468687-48468709 GGAAAAAAAAGGAACATTGTGGG + Intronic
907562296 1:55402174-55402196 GTGAAAAAGAAGAACTTGCAGGG - Intergenic
907833703 1:58089623-58089645 GAGACAAAGAGAAACATTGCAGG + Intronic
908322372 1:62990971-62990993 GTGAAATAGAGAAACAGAGATGG - Intergenic
908688269 1:66748204-66748226 CTGACAAAAAGGAACATTAATGG - Exonic
909201994 1:72701453-72701475 TTGAAAAAGAGATCCATTGAGGG - Intergenic
909913795 1:81292958-81292980 CTGAAAAAGATGGACATTGTGGG - Intergenic
910419903 1:87047887-87047909 TTGAAAAATAAGAAAATTGAAGG - Intronic
910487559 1:87732194-87732216 GTAAAAATGAGGAACCTTAAAGG - Intergenic
910858228 1:91717817-91717839 GAGAAAAAAAGGAACTTTAAGGG + Intronic
911404765 1:97422764-97422786 GTGGAGAAGAGAAACATTCAAGG + Intronic
912556648 1:110520991-110521013 GTGACAAAGAGGAACCTAGGAGG - Intergenic
912603078 1:110958636-110958658 GTGAAATAGAGGAAAAGAGAGGG - Intronic
913557969 1:119988073-119988095 GTGAGAGAGAGGAACCTTAAGGG - Intronic
914007209 1:143742829-143742851 GGGAAAAAGAGAAAAATTGAGGG + Intergenic
914397633 1:147286070-147286092 CTTAAAAACAGGAACATTCAGGG + Intronic
914646026 1:149653323-149653345 GGGAAAAAGAGAAAAATTGAGGG + Intergenic
915142250 1:153775031-153775053 GGGAAAACGAGAAATATTGAGGG + Intronic
915272361 1:154763082-154763104 TTGAAAGAGAAGACCATTGAGGG - Intronic
915859087 1:159422812-159422834 GTGAAAATGAGGACCACTGGGGG + Intergenic
917218675 1:172704448-172704470 ATGAAGAGAAGGAACATTGAAGG + Intergenic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
917662426 1:177190378-177190400 GTGGAAGAGAGAAAGATTGAGGG - Intronic
917857194 1:179110326-179110348 GAGAACAAGGAGAACATTGAAGG - Exonic
918597749 1:186311716-186311738 GTGAAAAAAATCAATATTGAGGG + Exonic
918980677 1:191554612-191554634 ATGAAAAAGAAATACATTGATGG - Intergenic
919126547 1:193401318-193401340 GTAGAAAACAGGAACAGTGATGG + Intergenic
919370354 1:196716696-196716718 GTGAAAAAGAGTGAGATTAAGGG + Intronic
919701983 1:200640000-200640022 GTGGATTAGAGGAATATTGAGGG + Intronic
920702433 1:208227983-208228005 GAAAAAAGGAGGAACAATGAGGG + Intronic
920894321 1:210029701-210029723 CTGAAAAAGAGAAACATAGCTGG - Intronic
921052286 1:211519357-211519379 CTGAAAAAGAGTAACAGTGGAGG - Intergenic
921219257 1:212961601-212961623 GTCAAAAAGAAGGACAGTGAAGG - Intronic
921810676 1:219510046-219510068 TTGAAAAAGAACAACATTAAAGG + Intergenic
922014866 1:221635024-221635046 GTTAAAAAGATGATCATTCAAGG - Intergenic
922306215 1:224347135-224347157 TTGAAAAAGAGCAAAGTTGAAGG - Intergenic
922812076 1:228422280-228422302 GTGAAAACAAGGAACATATAAGG + Intergenic
922861017 1:228816520-228816542 ATGAAAAAGTGCCACATTGATGG + Intergenic
1063400420 10:5738708-5738730 ATGATAAAGAGGAACATAGTTGG + Intronic
1064810339 10:19190493-19190515 CTGAAAAAGAGGAACAAAGTTGG + Intronic
1065603132 10:27390055-27390077 GTGAAAGAGACAAAAATTGAGGG - Intergenic
1065795561 10:29304411-29304433 GGGAAAGAGATGAACATCGAGGG + Intronic
1066001299 10:31106225-31106247 GTGAAAAACAGGAGTGTTGAAGG + Intergenic
1066173378 10:32876995-32877017 GGGAAAAATAGGAAAATTTAAGG - Intronic
1066335131 10:34469071-34469093 GTGACAAAAAGGAACAATAAGGG + Intronic
1068319073 10:55386930-55386952 GTGTAAAAGAGAAACATGGCTGG + Intronic
1068540331 10:58286221-58286243 GTAAAAAAAAGAAACAATGAAGG + Intronic
1068602267 10:58968458-58968480 GTGAAAAAAAGAAACAGGGATGG + Intergenic
1070021813 10:72594064-72594086 TTGAAAAAGAGAAACAATAAGGG + Intronic
1070495955 10:77022732-77022754 GTGAAAAAAAGGAAAACTTATGG - Intronic
1071209017 10:83316865-83316887 GTGAAAAGCAGGTACTTTGAGGG - Intergenic
1073824681 10:107306700-107306722 GTGAATAAGAGTAACATTTACGG + Intergenic
1074142998 10:110692207-110692229 TTGAAAAAGAGGAACAAAGTTGG - Intronic
1074783500 10:116819076-116819098 GTGAAGAAGAGGAAAAGTCAAGG - Intergenic
1075434162 10:122420163-122420185 GTGAAAAATATGGACATTGGTGG + Intronic
1077258368 11:1600480-1600502 GTTAAAAAGAAGAACAATGTTGG - Intergenic
1077793998 11:5471933-5471955 GTGATAAAGAGGGACATTGAGGG + Intronic
1078116380 11:8456052-8456074 ATGAAAAAGAAGAACAATGGAGG - Intronic
1078437619 11:11338481-11338503 TTGAGAGAGAGGAAGATTGAAGG + Intronic
1079161872 11:18002517-18002539 GTGCAAAAGAAGAACATTCTAGG - Intronic
1079869181 11:25775013-25775035 AAGAAACAGAGGAACAGTGATGG + Intergenic
1080274448 11:30487824-30487846 GGGGAAAATAGGATCATTGAGGG - Intronic
1080566408 11:33513549-33513571 GTGAAAATGAGGAAATTTGGAGG - Intergenic
1080690593 11:34554576-34554598 GTGATAAAGTGGAAGATGGAAGG - Intergenic
1080979691 11:37386395-37386417 GTGCAAAATGGGTACATTGAGGG - Intergenic
1081642407 11:44765176-44765198 GAGAAAATGAGGACCAATGAGGG - Intronic
1081961049 11:47137808-47137830 ATGAAAAAAAGGAGCATTTAGGG + Intronic
1084060179 11:66667400-66667422 GTTGAAGAGAGGAACATTTAAGG - Intronic
1085005536 11:73085506-73085528 GGGAAAAAGAGAAAAATTAAGGG - Intronic
1086207202 11:84273661-84273683 GTGAAAAGTAGTAACATTGAAGG + Intronic
1086259993 11:84928000-84928022 AAGAAAGAGAGGAAAATTGATGG + Intronic
1086482431 11:87256834-87256856 GAGGAAAAGAGGAAGAGTGAGGG - Intronic
1086970769 11:93078143-93078165 GTCAAAAACAGTAACATAGAGGG + Intergenic
1087084214 11:94199970-94199992 GTGAAAAAAAGCAACAAGGAGGG + Intergenic
1087746135 11:101949513-101949535 GTGAAGAACAGCAACATTTAAGG + Intronic
1087904969 11:103684942-103684964 GTGAGAAAGAGGCAAATTTAAGG - Intergenic
1090241643 11:125187153-125187175 TTGAAAAAGAGGAACAAAGTTGG - Intronic
1090710766 11:129382884-129382906 GAGAAGAAGAGAAGCATTGAGGG + Intronic
1091203366 11:133800079-133800101 GTGAGCAAGAGGACCATGGAGGG + Intergenic
1091264535 11:134260421-134260443 GTGAGAAAGAGGTACACTTAGGG - Intronic
1091382017 12:67772-67794 GTAGAAAAGAGAACCATTGAAGG + Intronic
1091509426 12:1107155-1107177 GAGAAGAAGAGGAACAAAGAAGG - Intronic
1093112000 12:15163792-15163814 GTGGGAAAGACGATCATTGAAGG + Intronic
1093779888 12:23122848-23122870 GTGAAATTGAAAAACATTGATGG + Intergenic
1094299677 12:28948693-28948715 GTGAAACAGATGTTCATTGAAGG - Intergenic
1095399420 12:41797282-41797304 ATGAAAAACATGAACATTGCGGG - Intergenic
1095621540 12:44261626-44261648 TTGAATAATAGGAACATAGATGG + Intronic
1096737782 12:53669344-53669366 GTGAAAAAGAGGCAGGTAGAAGG + Intronic
1097258624 12:57699797-57699819 GTGAAAAAGTGGAACTCTGCTGG + Intronic
1100317927 12:93462554-93462576 GTGAAAGAAAGGGAGATTGAAGG + Intergenic
1101062296 12:100984755-100984777 GTGAAAAAGAGGAAGCAAGAAGG - Intronic
1101644047 12:106612045-106612067 TTGAAAAAGAAGAACATGAAAGG - Intronic
1101917335 12:108905932-108905954 TTGAAAAAGAGGAACAAAGTTGG - Intergenic
1102993638 12:117332157-117332179 GGGAAACATAGGAACATTGTAGG + Intronic
1104262559 12:127197849-127197871 GTGAAAGAGATGAAGATGGATGG - Intergenic
1106283527 13:28298569-28298591 GTGGAAAAGGGGAAAATTGATGG + Intergenic
1106644910 13:31623484-31623506 GTGAAAAAAAGTGACATTGGAGG - Intergenic
1108318206 13:49259370-49259392 GTGAAAAACATGAAAATTGTTGG + Exonic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108533827 13:51352049-51352071 TTGAAAAAGAAGAAAGTTGAAGG - Intronic
1108948213 13:56050702-56050724 CTGAGAAAGAGATACATTGAGGG + Intergenic
1109197887 13:59398754-59398776 TTGAAAAAAAGGAAAATAGAAGG - Intergenic
1109220125 13:59633254-59633276 GTGAAAAAAGGGAAGATTCACGG - Intergenic
1109579414 13:64307250-64307272 GTAAGAAAGAGGAACATAGAAGG + Intergenic
1109663821 13:65502943-65502965 GTGAAGAAGAGGGGCAATGATGG - Intergenic
1109866927 13:68276676-68276698 GGGAAAAAGAGGAAAATCTAGGG + Intergenic
1109881106 13:68477582-68477604 TTGAGCAATAGGAACATTGAAGG + Intergenic
1110119910 13:71867133-71867155 GTGAAAAGGAGGAGGTTTGAAGG + Intronic
1110243967 13:73300510-73300532 CTGAAAACCAGGAACACTGATGG - Intergenic
1110889528 13:80680650-80680672 GAGAAAGAGAGGCACATGGATGG - Intergenic
1111516085 13:89333653-89333675 GGGAAAAAAGAGAACATTGATGG - Intergenic
1111519343 13:89379879-89379901 GAAAAAGAGAGGAACATTAATGG - Intergenic
1112035189 13:95491000-95491022 GAGACAAAGAGGGACATTAATGG - Intronic
1112243440 13:97705172-97705194 GTGAAAGAGAAAAACATTAAAGG - Intergenic
1113715687 13:112505158-112505180 GTGAGAAAGAGGAGCCTCGAGGG + Intronic
1114520749 14:23333576-23333598 TTGAAAAAGAGCAAAATTGGCGG - Intergenic
1115181929 14:30637439-30637461 GTTAAAATGTGAAACATTGAGGG - Intronic
1115347764 14:32361506-32361528 GTGAATCAGGGGAACATTAAAGG + Intronic
1116993011 14:51295012-51295034 GAGAAAAAGAGACAGATTGAGGG + Intergenic
1118682276 14:68255029-68255051 GTGAAAAAGAGGAAAAGGGGAGG - Intronic
1120223862 14:81767787-81767809 GCCAAAAACAGGAACTTTGAGGG - Intergenic
1120301030 14:82707097-82707119 TTGAAAAAGAAGAACATAGTTGG + Intergenic
1121889775 14:97578716-97578738 AAGAAAAACAAGAACATTGATGG - Intergenic
1121948462 14:98146563-98146585 GTGGAAAAGTGGCACATTGTAGG - Intergenic
1122257737 14:100491322-100491344 GTGAACAAGAGGATCTGTGAGGG - Intronic
1124339623 15:28881864-28881886 GGGAAAAAGAAGAACAAGGAAGG - Intergenic
1124394467 15:29289426-29289448 GGGAAAAACAGGAACATTGGTGG + Intronic
1124613923 15:31228143-31228165 ATGAAAAAGAGGAAGCTAGAGGG + Intergenic
1124804110 15:32863679-32863701 GTAGAAAAGATGAACATGGAAGG - Intronic
1124928855 15:34099599-34099621 AGGAAAAAAAGAAACATTGATGG - Intronic
1124971453 15:34494196-34494218 GTGAAAAAGATGAACAACTAGGG - Intergenic
1125034063 15:35103602-35103624 GGGAAAAAGAGAAAGAATGAAGG - Intergenic
1125250179 15:37692540-37692562 ATGAAAAATAAGAACATTAAAGG + Intergenic
1125994795 15:44148127-44148149 GGGAAAAAGAGAAAAATTAAGGG - Intronic
1126491697 15:49244023-49244045 GAGAAAAACAGGAAAATTTATGG + Intronic
1126903780 15:53342681-53342703 CAGAAAAAGAGAAACCTTGAGGG - Intergenic
1126973994 15:54152860-54152882 AAAAAAAAGAGGAACACTGAGGG + Intronic
1127260093 15:57321043-57321065 GTTTAAAAGAGGAACTGTGACGG + Intergenic
1127502152 15:59564059-59564081 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
1128382026 15:67120220-67120242 GGGAAAAAGAGGAACAGTGTGGG + Intronic
1128873357 15:71181573-71181595 GGCAAAAAGTGGAACATAGAAGG + Intronic
1129415730 15:75377688-75377710 GTTAAAAAGATGTAAATTGAGGG - Intronic
1130206387 15:81879499-81879521 GTTAAAAAGAGAAGCATTCAAGG - Intergenic
1130682006 15:86005218-86005240 GTGAAAAAAAGCAATTTTGAAGG + Intergenic
1131098765 15:89672132-89672154 GTTAAAAAGAAGAGCATGGACGG - Intronic
1131826536 15:96326126-96326148 GGGAAAAAGAGGAAAGGTGAAGG - Intronic
1137280341 16:46971814-46971836 TTGAAAAAGAGGAATGTTGCAGG - Intronic
1137852517 16:51760573-51760595 GTGAAAAATAGCAACTTTTAAGG - Intergenic
1137947556 16:52749430-52749452 GTGGGAAAGAGGGAAATTGAGGG + Intergenic
1138322378 16:56126871-56126893 GTGAAAAAGAGAAACAATGAGGG + Intergenic
1138856895 16:60705110-60705132 GAAAAAAAGAGGGACATTGTTGG + Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1140447474 16:75042670-75042692 TTGAAAAAGAGGAACAAAAATGG - Intronic
1140594682 16:76395021-76395043 CTGAAAAAGAGGAATGTTTAAGG - Intronic
1141063830 16:80898312-80898334 GTGAATAACAGTAACATTGAGGG - Intergenic
1141666851 16:85470110-85470132 GATAAAAAGCGGAACATGGATGG - Intergenic
1143311436 17:5993479-5993501 TTTAAAAAGAGCAACATTGGAGG - Intronic
1143462066 17:7110157-7110179 GTGAAAAAGATGAAGAGTTATGG - Intronic
1143497177 17:7318925-7318947 GTGTAAAAGGGGAACAGTAATGG - Intronic
1144203457 17:12962124-12962146 TTTAAAAAGAAGAAAATTGAGGG + Intronic
1144260447 17:13514273-13514295 GTCATAAAGAAAAACATTGATGG - Intronic
1145084450 17:19924877-19924899 GGGTAAAAGATGAATATTGAGGG - Intronic
1146359612 17:32163291-32163313 GGGAAATAGGGGAACAGTGAGGG + Intronic
1146416266 17:32636049-32636071 GGGAAAAAGAGAATCACTGAAGG - Intronic
1146984133 17:37197522-37197544 GTGAAAAAGAGGAAGCTTTCTGG - Intronic
1147417860 17:40306724-40306746 GTTAAAAAGAGGGACATCAAAGG - Intergenic
1147986543 17:44310379-44310401 GAGAAAAAGAGGAACCTAGCAGG - Intronic
1150138680 17:62710855-62710877 GCGAAAAAGAGGAACCTGGCTGG - Intronic
1150183313 17:63151148-63151170 GGGAAAGAGAGAAACATAGAGGG - Intronic
1151026295 17:70681108-70681130 CTGAAAAAAAGGAAAATTCAAGG + Intergenic
1151077402 17:71289163-71289185 CTGAGAAAGAGGCACTTTGAGGG - Intergenic
1151096902 17:71508947-71508969 GAGAAGAAAAGGAATATTGATGG + Intergenic
1151825126 17:76519724-76519746 GTGAAAGAGAGGACAGTTGAGGG - Intergenic
1153530214 18:6038596-6038618 GTAAAAGACAGCAACATTGATGG + Intronic
1154408129 18:14115449-14115471 GTCAAAAAGAGAAATATTGGAGG + Intronic
1155547753 18:26932430-26932452 TTGAAAAAAAACAACATTGATGG - Intronic
1155865179 18:30956163-30956185 GAGAAGAGGAGGAACCTTGAGGG - Intergenic
1157439376 18:47698308-47698330 GTTAAAATGAAGAACAGTGATGG + Intergenic
1158331092 18:56362818-56362840 TTGAAAAAGAGTAACATTTTAGG - Intergenic
1159448943 18:68575747-68575769 GTGAAAAAGAGGAATAATGGAGG - Intergenic
1159499061 18:69245335-69245357 ATGAAGAAGAGGCAGATTGAAGG + Intergenic
1159669393 18:71204264-71204286 AAGAAATAGAGGAACAATGAAGG - Intergenic
1159969782 18:74635211-74635233 GTGAAAAAGAAGAAATCTGAGGG + Exonic
1163141087 19:15349177-15349199 TTGAAAAAGAGGAACAAAGTCGG + Intergenic
1164665133 19:30025658-30025680 TTGAAAAAGAACAAAATTGAAGG - Intergenic
1166827314 19:45617500-45617522 GTGAGCCAGAGGAATATTGAGGG + Intronic
1167444483 19:49529197-49529219 ATAAAAAAGAGGACCTTTGAGGG + Intronic
1167459161 19:49615313-49615335 GAGAAAAAGAGGGACAGAGATGG + Intronic
1168303910 19:55423678-55423700 GTGACAAAGGCGAACACTGAAGG + Intergenic
924962734 2:47819-47841 GTGAAAGAGAGGGACAGAGATGG + Intergenic
925230203 2:2226242-2226264 GTGAAAACTAGGAACATAGCGGG + Intronic
925715876 2:6783903-6783925 GTGAGAAAGAGGAAGCATGAGGG + Intergenic
927295666 2:21450229-21450251 GTGAAAAAGAGGAAAAAGAAGGG - Intergenic
927834379 2:26381042-26381064 GTTAAAAAGAGAAACAATAATGG - Intronic
929201449 2:39241665-39241687 TTGAAAAAGATGAAGATTTAAGG - Intergenic
929298160 2:40271498-40271520 GTGAAAAATAGGTTCAGTGAGGG - Intronic
930001179 2:46862508-46862530 GTCAAAAAGAGGAAGATTAAAGG - Intergenic
931173651 2:59831017-59831039 GAGAAAAAGAGGAACAATTCTGG - Intergenic
932188655 2:69720228-69720250 TTCAAAAAGGGGAAAATTGAAGG - Intronic
932778748 2:74546451-74546473 GTGAAAAAGAAGAAAATGGTAGG - Intronic
933030907 2:77327578-77327600 ATGAAAAGGAGAAAAATTGAGGG + Intronic
933074225 2:77903189-77903211 TTGGAAAAGAGGAACAGTGGAGG - Intergenic
933134044 2:78709409-78709431 TTGAAAAAGAGAAAAGTTGAAGG + Intergenic
934084489 2:88498668-88498690 GTGATCAGGAGGAACAATGAGGG + Intergenic
934505111 2:94884338-94884360 TTGAAAATGAGGAACAGTGTAGG - Intergenic
935475502 2:103516317-103516339 GTCAAAAAGAAGAAATTTGAAGG - Intergenic
936523023 2:113223881-113223903 GTGAAAAAGTGGTAAATGGATGG + Intronic
936619992 2:114085618-114085640 GTGGAAGAGAGGAAGATTGGGGG - Intergenic
937091602 2:119209983-119210005 GTGTAAGTGAGGAACATAGATGG - Intergenic
937525198 2:122760154-122760176 ATGAAAAAGATTATCATTGAAGG - Intergenic
937635205 2:124147799-124147821 TTGGAGAAGAGGAACACTGAAGG - Intronic
938810387 2:134847246-134847268 GTGAAAAAGAGGCAAAAAGATGG + Intronic
939737007 2:145859251-145859273 GTAACATAGAGGAACAGTGAGGG + Intergenic
939761576 2:146188563-146188585 GTGAATAAAAGGCATATTGAGGG + Intergenic
940309201 2:152259326-152259348 ATGACAAAGAGGAAAATTAAAGG + Intergenic
940369270 2:152881901-152881923 GAGAAAAAGAAGAATCTTGAAGG - Intergenic
940803879 2:158163174-158163196 GTGAAAAAGATCAAAGTTGAAGG + Intergenic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
942900440 2:181110607-181110629 GTCAATAAGAGTAATATTGAGGG + Intergenic
943089104 2:183352927-183352949 TTCAAATAGAGGAACATTGGAGG - Intergenic
943608838 2:190007962-190007984 ATAAAAAAGAGAAATATTGAAGG + Intronic
943892879 2:193313112-193313134 GTGAAAAAGAACAAAATTGTGGG - Intergenic
944973603 2:205022497-205022519 GAGAAAAAGAACAATATTGAAGG - Intronic
945103957 2:206290293-206290315 TTGAAAAAGAGGAACAAAGTTGG - Intronic
945422450 2:209656096-209656118 ATAATAAAGATGAACATTGAAGG - Intronic
945613821 2:212041763-212041785 GTGAAAAAGTTAAATATTGAAGG - Intronic
945897094 2:215495947-215495969 ATGAAAAATATGAACATTTAAGG + Intergenic
946262685 2:218508050-218508072 GTAGAAAACAGGAACACTGAAGG + Intronic
946282064 2:218672683-218672705 GTGAAAAAGAGGAAAAGGCAAGG + Intronic
946537247 2:220645210-220645232 GACAAAAAGAAGAACAATGATGG - Intergenic
946797254 2:223368672-223368694 GTAAAAAAGATGAACATTCGAGG + Intergenic
947466868 2:230358710-230358732 GTAAAAAGGAGCAACTTTGAAGG - Intronic
947833334 2:233157484-233157506 TAGAAAAAGAGAAACATTCAGGG + Intronic
1169184520 20:3603116-3603138 GGGAGAATGTGGAACATTGAAGG + Intronic
1169709753 20:8548234-8548256 GTGAAAAAGAGGAAGAGGGGAGG - Intronic
1169738575 20:8865178-8865200 GAGAAAGAGATAAACATTGATGG + Intronic
1170224089 20:13972070-13972092 TTCACAAAGAGGAACATAGAGGG - Intronic
1170472075 20:16677777-16677799 GTGAGAAAGAGGAGAATTAAAGG + Intergenic
1170771229 20:19334499-19334521 GTGAAAAAGATGATCACTTATGG - Intronic
1170949100 20:20919505-20919527 ATGAAAAAGAACAACATTGTAGG + Intergenic
1171042587 20:21779222-21779244 GTGAAAAGGAGGATTATGGAGGG - Intergenic
1173063567 20:39685299-39685321 GGGAAAGAGAAGAACATTCAAGG + Intergenic
1173121018 20:40289254-40289276 GAGAAAAAGATGAACATTTGTGG - Intergenic
1174434873 20:50499065-50499087 GTGGACAAGAGCAACATGGAAGG - Intergenic
1174863987 20:54117932-54117954 TTGACAAATAGGAATATTGAAGG - Intergenic
1175571645 20:60027230-60027252 GTGAAAAAGAAGGACAGTGGTGG + Intronic
1176283184 20:64327061-64327083 GTAGAAAAGAGAACCATTGAAGG - Intergenic
1176334690 21:5585034-5585056 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176393067 21:6235914-6235936 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1176468352 21:7080260-7080282 CTGCAAAAGAGGACCACTGAAGG - Intronic
1176491913 21:7462038-7462060 CTGCAAAAGAGGACCACTGAAGG - Intergenic
1176508729 21:7676345-7676367 CTGCAAAAGAGGACCACTGAAGG + Intergenic
1178205515 21:30459836-30459858 GTGAAAAACAGGAAAGTAGATGG - Intergenic
1178634996 21:34294664-34294686 GGGAAAAAAAACAACATTGAAGG - Intergenic
1178712870 21:34934913-34934935 ATGAAAAAGGGGAAAAATGAAGG - Intronic
1178747216 21:35264723-35264745 GTAAAGAAAAGGAAAATTGAGGG - Intronic
1178808117 21:35856433-35856455 GTTCAAGAGAGGAACAATGAGGG + Intronic
1180028157 21:45180616-45180638 GTTAAAAAGATGAACATTTTGGG - Intronic
1180191184 21:46163775-46163797 TTGAAAAAGGAGAACATTGAGGG - Intronic
1182409013 22:30166024-30166046 ATGAAAAAGAAGAATAATGAGGG - Intronic
1183088406 22:35502969-35502991 GTCAAAAAGAGGCACTTTGTTGG - Intergenic
1183133073 22:35858505-35858527 GTGAGAAATAGGAAGATGGATGG - Intronic
949094834 3:73967-73989 GTGAAAAAGAAGGAACTTGAAGG + Intergenic
949129304 3:482505-482527 GGGAAGACGAGAAACATTGAGGG - Intergenic
950537905 3:13591700-13591722 TTGAAAAAGAAGAACAATGCTGG - Intronic
950655136 3:14431852-14431874 GTTTAAAAGAGGAACAAGGAGGG + Intronic
952621625 3:35350625-35350647 AAGAAAAAAAGGAAAATTGACGG + Intergenic
954642321 3:52108401-52108423 GTGACAAAGAGGAACAGTAGCGG + Intronic
955374887 3:58386593-58386615 GTTAAAAAGATGAATATTGTAGG - Intronic
956562482 3:70595470-70595492 CTGAAAACAAGGAAGATTGAGGG + Intergenic
956731765 3:72203333-72203355 GGGAAAAAGAGGAAGAGAGACGG - Intergenic
961705754 3:128783723-128783745 ATGAGAAAGAGCAAGATTGATGG - Intronic
962751802 3:138439201-138439223 GGGAAACAGAGGAACATAAAGGG - Intronic
962926264 3:139996050-139996072 GTGTACAAGAGGAAGATAGATGG - Intronic
964163104 3:153669761-153669783 GTGATAAAGAGGAAGAATAATGG + Intergenic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964711742 3:159678211-159678233 GTGAAAAATAGGACAATTTATGG - Intronic
965196093 3:165597001-165597023 GAGATGAAGAGGAACATAGAGGG - Intergenic
965350771 3:167609241-167609263 GTGAAAACCAGGTACAATGAGGG - Intronic
966625040 3:182006497-182006519 GTGACAAAGAGGAAAAATGCAGG - Intergenic
967415855 3:189217796-189217818 GTCAAAAAGAGGAGCATTCATGG + Intronic
967472193 3:189874867-189874889 GTGAACAGGAGGAAATTTGAGGG - Intronic
967673649 3:192270022-192270044 CTGAAAAAGAGTAACTTTCATGG + Intronic
967772778 3:193353268-193353290 GAGAGAAAGAGAAAAATTGATGG + Intronic
967925486 3:194642377-194642399 GGGAGAAAGAGGACCAGTGAAGG - Intronic
969848384 4:9937488-9937510 ATGAAACAGAGTAACAGTGAGGG + Intronic
970097771 4:12484769-12484791 ATGAAAGAGAAGAACATTAATGG - Intergenic
973220245 4:47717965-47717987 GTGAGAAGGAGGAACAGAGATGG + Intronic
974287099 4:59883003-59883025 ATGAAGAAGAGGAATATTAAAGG + Intergenic
974446713 4:61993705-61993727 GTGAAAAAGAGCGACAGAGAGGG - Intronic
974651547 4:64759700-64759722 GTGAAGAAGAAGAAGAGTGAAGG - Intergenic
974795036 4:66738048-66738070 GTGAAGAAGTGGGACATGGAAGG + Intergenic
974918869 4:68211716-68211738 GTGAAAAACAGGGATAGTGAAGG + Intergenic
974920404 4:68232088-68232110 GTTAAAATGAGAAAGATTGAAGG - Intronic
975182825 4:71366799-71366821 GTGAAAAAAAGCAACATGAAAGG + Intronic
975376819 4:73655629-73655651 TTGAAAAACAGGAACAAAGATGG + Intergenic
975764105 4:77649197-77649219 GAGAAAGAGAGGTATATTGAGGG + Intergenic
976620308 4:87120541-87120563 GTGAAAAAGAGGAAAGCTCACGG - Intronic
977437185 4:97013037-97013059 GTGAAAAGGAGGAAAACGGAGGG + Intergenic
978549906 4:109914338-109914360 TTTAAAAAGAGGTAGATTGAGGG + Intronic
978757380 4:112317654-112317676 TTGAAAAAAAGGAAAATTGGAGG - Intronic
979981515 4:127261891-127261913 TTGAAAAAGAGGAATATTTAAGG + Intergenic
980155131 4:129095240-129095262 GTGAAAAGGAGGAACATGAGAGG - Intronic
980351281 4:131687602-131687624 TTGAAAAAGTGGAACAGTGTAGG + Intergenic
980709825 4:136550506-136550528 CAGAAAAAGAGGAACAAAGATGG - Intergenic
981044745 4:140254292-140254314 GTGAAGAAGGGGAACAGTGTGGG + Intergenic
981193724 4:141893749-141893771 ATGAAAAAGAGGAATAGTGAGGG - Intergenic
981567655 4:146117491-146117513 GTGAATAAGAGCAACATTTGAGG + Intergenic
981969678 4:150652212-150652234 GGGAGAGAGAGAAACATTGAGGG - Intronic
983450769 4:167908250-167908272 AAGAAAAAGGAGAACATTGAAGG - Intergenic
983607647 4:169608168-169608190 TTGAAAAAGAAGAGCAATGAAGG + Intronic
983679466 4:170335702-170335724 GTGAAATAGATGAACCTAGAGGG - Intergenic
983801778 4:171940237-171940259 AAGAAAAGGAGGGACATTGAAGG + Intronic
984730293 4:183062094-183062116 GTGAAAAAGAAGAACAAAGTTGG - Intergenic
985714887 5:1450563-1450585 TTGAAAAAGAACAACATTGGAGG + Intergenic
985898096 5:2762365-2762387 ATAAAAAAGAGAAAAATTGAAGG + Intergenic
985934582 5:3086655-3086677 TTGAAAAAGAAGAACAAAGATGG + Intergenic
987684399 5:21178699-21178721 GTTAAAAATAGGAATAATGATGG - Intergenic
987977258 5:25030346-25030368 AAGAAAAAGATGAACATTGCTGG - Intergenic
990191284 5:53263021-53263043 GTCAAACAGAGGATGATTGAGGG + Intergenic
990584410 5:57196641-57196663 GTGATAAAGTGGAACAATCAGGG + Intronic
991054891 5:62309491-62309513 GTGAAAAAGGGAAAGCTTGAGGG - Intronic
991209393 5:64087167-64087189 GTGAAAAAAAAAAAAATTGAGGG + Intergenic
991581454 5:68159814-68159836 GTGGACAAGAGCTACATTGAGGG - Intergenic
991638628 5:68731825-68731847 GTGAAAAAGTTGCACATAGATGG - Intergenic
992437770 5:76771803-76771825 GTGAAAAAGAGGAATATAAAGGG - Intergenic
992493429 5:77268176-77268198 ATAAAAAAGAGGAACATGGGAGG - Intronic
994260656 5:97654954-97654976 CTGAAAAAGAGGAGGATTTAGGG - Intergenic
994764789 5:103902327-103902349 GTGAAAAAGAAGAATAATAATGG + Intergenic
994821946 5:104663561-104663583 TTGAAAAACAGCAAAATTGAAGG - Intergenic
994868540 5:105313294-105313316 TTGAAAAAGAAGAAAGTTGAAGG - Intergenic
994945325 5:106380364-106380386 TGGAAAAAGAAAAACATTGAAGG + Intergenic
995055947 5:107758760-107758782 GTGCACAAGAGGAACACAGAAGG + Intergenic
995615931 5:113964394-113964416 GAGGAAAAGGTGAACATTGATGG - Intergenic
995626964 5:114090519-114090541 GAGAAAGAGAGGAAGAGTGAGGG - Intergenic
996023306 5:118615412-118615434 GTGTAAATGAGGAACCTTGATGG - Intergenic
996191091 5:120542527-120542549 CTGAAATAGAAGAACATTAATGG - Intronic
996406382 5:123109315-123109337 GTGAAGGAGAGTAATATTGATGG + Intronic
996605879 5:125321317-125321339 TTGAAAAAGAGGAAGATAGTTGG - Intergenic
996713399 5:126566021-126566043 TTGAAAAAGAAGATAATTGAAGG - Intronic
997135065 5:131316609-131316631 GTGAAAAGGAAGAAAATAGATGG + Intronic
997880710 5:137587092-137587114 GAAAAGAAAAGGAACATTGAAGG + Intronic
998693004 5:144608203-144608225 GTGAAAAAGAGAAACATTTCTGG - Intergenic
998930437 5:147175429-147175451 ATGAAAAAGAGGACCAGAGAAGG - Intergenic
1000301019 5:159955904-159955926 GAGACAAAGAGAAAGATTGAGGG - Intronic
1000758117 5:165185849-165185871 ATGAAAAAGAGGAACAGAGTTGG - Intergenic
1000964763 5:167642863-167642885 GTGAGAAAGGGGAACAGTGCAGG + Intronic
1001635645 5:173208282-173208304 GTGCAAAAGAGAAAAACTGATGG - Intergenic
1002018190 5:176342771-176342793 GTGATAAACAGTAACACTGAGGG - Intronic
1002061141 5:176626769-176626791 GAGAAAAAGCGGCACATTTAAGG + Intronic
1002515478 5:179755025-179755047 GTGAAAGAGAGGCATATTTAAGG + Intronic
1003266574 6:4569992-4570014 GGGATAAAGGGGAACATTTATGG - Intergenic
1003370835 6:5524287-5524309 GTGGGAAAGAGGAACTGTGAGGG + Intronic
1003731154 6:8826121-8826143 ATGAAAAAGAAGCATATTGAAGG - Intergenic
1003848435 6:10197806-10197828 CTGGAACAGAGGAACAATGATGG - Intronic
1004122393 6:12836976-12836998 GTTTTAAAGAGGAACATAGAGGG - Intronic
1007119734 6:39369952-39369974 GGGAAAAAGGGGAACCTTGTGGG - Intronic
1008443663 6:51562094-51562116 GTGAAACAGAGGTGCATAGAAGG + Intergenic
1008970853 6:57366365-57366387 GGGATAAAAAGGAACTTTGATGG + Intronic
1009159815 6:60268167-60268189 GGGATAAAAAGGAACTTTGATGG + Intergenic
1010642429 6:78345187-78345209 GTGAAACAGAGCAACAGTGTAGG - Intergenic
1011217510 6:85020544-85020566 GTGAAACAGAGAAAGATTGGTGG - Intergenic
1011463949 6:87635836-87635858 GAGAAAAAGAGGCTCATTTAAGG - Intronic
1012044359 6:94250871-94250893 GTGAAAAAGTGGAATAAAGATGG - Intergenic
1013945505 6:115717631-115717653 GGGAAAAAGAAGAACAATGGAGG + Intergenic
1015821938 6:137270869-137270891 GTGTAAAACAGGCACATAGAAGG + Intergenic
1016734789 6:147466131-147466153 GAGATAAAGAGGATCTTTGAGGG + Intergenic
1017082626 6:150683846-150683868 GTGAAATATGGGAATATTGAAGG + Intronic
1017608268 6:156156323-156156345 GTGAAGAAGAGGAAGACAGAGGG + Intergenic
1019610215 7:1932808-1932830 CTGAACAACAGGAACATGGAAGG - Intronic
1019825446 7:3280437-3280459 AAGAAAAAGAGGAACATGGCCGG - Intergenic
1021102383 7:16598645-16598667 GTGAAGAAAAGGAGAATTGATGG + Intergenic
1021301197 7:18975133-18975155 GAGAAAGAGAGGAAAATAGAAGG - Intronic
1021579159 7:22133859-22133881 ATAAGAAAGAGGAAGATTGAGGG + Intronic
1021750301 7:23792662-23792684 TTGAAAAAGAACAAAATTGAAGG + Intronic
1022175588 7:27869201-27869223 CTGAAAAACAGGAACAGTCATGG + Intronic
1022289498 7:28987308-28987330 TGGTAAAAGAGGAAAATTGAGGG + Intergenic
1022759195 7:33328665-33328687 ATGCAAAATAGGAACATTGTAGG - Intronic
1024233079 7:47377688-47377710 GGGAAAAAGAGGAAGAGGGAAGG - Intronic
1026226814 7:68449376-68449398 CAGAAAAAGAGGAACAGAGAGGG - Intergenic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1028287983 7:89027867-89027889 TAGAAAAAGCAGAACATTGAGGG - Intronic
1029032531 7:97483883-97483905 CTGAAAAAAAGGAAAATTCAGGG + Intergenic
1030568079 7:111186345-111186367 GCAGAAAAGAGGAACAATGAAGG - Intronic
1031426773 7:121615110-121615132 GAGAAAAAAAGGAACAGAGAAGG + Intergenic
1031575162 7:123407087-123407109 GTGAAATAGAAGGACATTTAAGG + Intergenic
1032269385 7:130389667-130389689 AAAAAAAAGAGGAACATTGATGG + Intergenic
1033026410 7:137777493-137777515 ATGACACAGAGGAACACTGAGGG - Intronic
1034023056 7:147666786-147666808 GTGAATAAGAGGTACAAAGATGG + Intronic
1034125836 7:148670888-148670910 GTTAAAACGAGGAACTATGAAGG + Intergenic
1035519160 8:263177-263199 GTGAAAATGATGAAATTTGAGGG + Intergenic
1037140375 8:15512064-15512086 TTGAAAAAGAGGAACAATGTTGG + Intronic
1037172939 8:15915143-15915165 ATGAGATAAAGGAACATTGATGG + Intergenic
1037583018 8:20256970-20256992 GTGAAAAAGAGCAGCAGAGAAGG + Intronic
1039576942 8:38631290-38631312 GAGAGAAAGAGGAAAATTGCTGG + Intergenic
1039805811 8:40997016-40997038 TTGAAAAAGAAGAACATAGTTGG - Intergenic
1040100680 8:43500475-43500497 GCGTAAAAGAGAAACATTTAAGG + Intergenic
1041241057 8:55849513-55849535 TGGAAATAGAGGAACATGGAGGG - Intergenic
1041698676 8:60763905-60763927 GAGGAAAAGAGGAGCATAGATGG + Intronic
1042602164 8:70509845-70509867 GTGAAGAAGAGCAAAGTTGAAGG - Intergenic
1044149591 8:88758980-88759002 CTGAAAAACAGGAGCATTGAGGG - Intergenic
1044578918 8:93802717-93802739 GTGAAAAACAGCAATATTCAAGG - Intronic
1045459816 8:102415662-102415684 GTGTAAAAGTTGAACATAGATGG - Intergenic
1046452638 8:114414320-114414342 GTGATAAAGATGAACATGGGAGG + Intergenic
1046484755 8:114873205-114873227 TTGAAAAAGAAGAACATAGTGGG - Intergenic
1046802897 8:118448705-118448727 TTGAAAAAGAAAAAAATTGAGGG - Intronic
1047264973 8:123298160-123298182 TTGAAAAAGAAGAACACAGAGGG + Intergenic
1049658796 8:143810540-143810562 GTGATGAAGAGGAGCATCGAGGG - Exonic
1050043448 9:1519610-1519632 GTAGAAAAGAGGAACACTGGTGG - Intergenic
1050357453 9:4796228-4796250 TGGAAAAGGAGGAAGATTGAGGG - Intronic
1051017258 9:12493737-12493759 ATTAAAATAAGGAACATTGAAGG + Intergenic
1051102639 9:13539305-13539327 CTGAAAGAGAAGAACAATGAGGG - Intergenic
1051715955 9:19984292-19984314 TTGAAAAAGAAGAATATTGGAGG + Intergenic
1053591172 9:39516090-39516112 CTGAAAAGGAGCAACAGTGAAGG + Intergenic
1054575134 9:66849198-66849220 CTGAAAAGGAGCAACAGTGAAGG - Intergenic
1056054724 9:82809070-82809092 AAGAAAAAGAGGATCAATGAAGG - Intergenic
1056549790 9:87642696-87642718 GTGAAAACGAGGTACATTTCTGG - Intronic
1057000796 9:91507122-91507144 TGGAAAAACATGAACATTGATGG + Intergenic
1057001122 9:91510565-91510587 TGGAAAAACATGAACATTGATGG + Intergenic
1058069630 9:100588770-100588792 GAGAAACAGAGCAACATGGAGGG - Intergenic
1058794464 9:108484387-108484409 GTGAAATAGATGACAATTGAGGG + Intergenic
1059700499 9:116771307-116771329 CTGAAAAATGGGAACATGGAGGG - Intronic
1061648138 9:132023184-132023206 GGGAAAAAGAGAAATATTCAGGG - Intronic
1062090238 9:134673217-134673239 TTGAAAAAGAAGAACATCGGAGG + Intronic
1186455822 X:9709081-9709103 GAGAAAAAGAGGAAACTAGATGG + Intronic
1186944491 X:14550333-14550355 GTGAGATAGAGGATAATTGATGG + Intronic
1187105952 X:16241976-16241998 GTGAAAAAAAGGAAAACTAATGG - Intergenic
1188938835 X:36212339-36212361 GTTAAAAAGAAAAATATTGAAGG - Intergenic
1190160082 X:48025878-48025900 GTGACAAAGAGGAAAAGGGAAGG + Intronic
1190227619 X:48558390-48558412 GTGAAAGAGTGGAAATTTGAAGG - Intronic
1190415588 X:50177356-50177378 GGGAAAAAGAGGAAACTGGAGGG + Intergenic
1191659570 X:63635832-63635854 TGGAAAAAGAGGTACACTGAAGG + Exonic
1191764511 X:64682602-64682624 GTGGGAAAGAACAACATTGAAGG + Intergenic
1192345346 X:70298744-70298766 GTGAATAACAGGTACATAGATGG - Intronic
1192379161 X:70597327-70597349 TTTAAAAAGAAGAACAATGAGGG + Intronic
1192708747 X:73557496-73557518 TTGAAAAAGAGTAAATTTGATGG + Intergenic
1192964917 X:76167052-76167074 GTAAAAGGGAGGGACATTGATGG + Intergenic
1193408132 X:81129023-81129045 GAGAAAAAGAGCCATATTGAAGG + Intronic
1193739110 X:85196512-85196534 TTGAAAAAGAGGAACAAAAATGG + Intergenic
1193815473 X:86100326-86100348 GGTAAAAACAGGAATATTGAAGG - Intergenic
1194701347 X:97118757-97118779 TTGAAAAAGAAGAATCTTGAAGG + Intronic
1194729660 X:97439024-97439046 GTTAAAATGAAGAACATTTATGG + Intronic
1194818336 X:98473198-98473220 CTGTAAAAGGGGAAAATTGACGG + Intergenic
1195138246 X:101932087-101932109 GTTAAAAAGAGGAACAAAGGGGG - Intergenic
1195202928 X:102566880-102566902 GTGAGAAAGAGAAGCATTGAGGG - Intergenic
1196509878 X:116496550-116496572 GCAAAAAAGAAGAACATTGGAGG - Intergenic
1196981616 X:121220659-121220681 GTGAAGAAGATGAAGAATGAGGG - Intergenic
1198294803 X:135276160-135276182 TTGAAAAAGAGGAACAATATTGG + Intronic
1198915887 X:141671257-141671279 GCAAAGAAGAGGAAAATTGATGG - Intronic
1199331796 X:146569516-146569538 GTGAAAAGAAGAAACATTGTTGG + Intergenic
1200218997 X:154381389-154381411 ATGACAAAGAGGACCATGGAGGG - Exonic
1200301376 X:154979958-154979980 GTGAAAATGAGGAACACTAAGGG + Intronic
1200766631 Y:7085729-7085751 GAGAAAAAGAGGAAACTAGACGG + Intronic
1200879053 Y:8193449-8193471 GTAAAAAATAAGAACTTTGAGGG + Intergenic
1201063204 Y:10066902-10066924 ATGACAAAGAGGCACATTCAGGG + Intergenic
1202046420 Y:20740736-20740758 GAGAAAAAGAGGAAACTAGAAGG + Intergenic
1202116152 Y:21470343-21470365 GTGACAAGGAGGCACATTCAGGG - Intergenic