ID: 964686664

View in Genome Browser
Species Human (GRCh38)
Location 3:159403487-159403509
Sequence AGAGAGAGTGCAGTGATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 4, 2: 33, 3: 99, 4: 501}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964686659_964686664 27 Left 964686659 3:159403437-159403459 CCTTTGGCAGTGGCTGTATGGCA 0: 1
1: 1
2: 10
3: 32
4: 164
Right 964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG 0: 1
1: 4
2: 33
3: 99
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964686664 Original CRISPR AGAGAGAGTGCAGTGATTGA GGG Intronic
900622132 1:3592326-3592348 AGAGAGGGAGCAGTGAGTCAGGG - Intronic
902280078 1:15367892-15367914 AGACAGAGTGCAGGGGCTGAGGG - Intronic
903614075 1:24639342-24639364 AGACAGAGTGAGGGGATTGAGGG + Intronic
904245678 1:29186176-29186198 AGACTGAATGCAGTGGTTGAAGG - Intergenic
904917020 1:33977471-33977493 AGAGAGAGTGCCCTGATGGAAGG - Intronic
905070547 1:35221292-35221314 AGAGAGAGGGAAGAGGTTGAGGG - Intergenic
905120882 1:35681008-35681030 AGACAGATTGCAGTGATTTGGGG - Intergenic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
905909247 1:41642478-41642500 AGAGAGAGTAGAGTCATGGAGGG - Intronic
906691014 1:47792810-47792832 CCAGAGAGTGCAGTCAGTGAAGG - Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907375498 1:54034784-54034806 AAAGAAAGTTCAGTGGTTGATGG + Intronic
907383747 1:54111964-54111986 AGAGAAAGTGAAGAGATTAAGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910163313 1:84297703-84297725 AGAGAGAGTGGAGAGAAAGAGGG - Intergenic
910611678 1:89150654-89150676 CAAGAGACTGTAGTGATTGATGG - Intronic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
911298203 1:96143004-96143026 AGAGAGAATGGAGTAATTGGTGG - Intergenic
911908722 1:103603055-103603077 AAAGAGAGTGAATAGATTGAAGG - Intergenic
911914195 1:103676406-103676428 AAAGAGAGTGAATAGATTGAAGG + Intronic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912873241 1:113328863-113328885 AGGGAGAATGCAGTAATTGTGGG - Intergenic
913158852 1:116127623-116127645 AGAGAGAGTGGAGTGCATCAAGG + Exonic
913686272 1:121234978-121235000 AGAGAGAGTGAAGGAAGTGAGGG - Intronic
913694126 1:121307826-121307848 AGAGAGAGTGAAGGAACTGAAGG + Intronic
914038123 1:144022600-144022622 AGAGAGAGTGAAGGAAGTGATGG - Intergenic
914143437 1:144972240-144972262 AGAGAGAGTGAAGGAACTGAAGG - Intronic
914151331 1:145045340-145045362 AGAGAGAGTGAAGGAAGTGAGGG + Intronic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915895440 1:159808114-159808136 AGAGGGAGAGAAGTGACTGATGG + Intronic
915920840 1:159974106-159974128 AGAGGGAGAGAAGTGACTGATGG - Intergenic
916510357 1:165467738-165467760 GGAGAGAGTGCACTGAGGGAAGG - Intergenic
917041101 1:170807296-170807318 AGAGAGAGAACAGTGATCCAAGG + Intergenic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918689782 1:187466150-187466172 AGGGAGAGTGCAGTTCATGAAGG - Intergenic
918739149 1:188104784-188104806 AGAGATAGTGCAGTGGGTAAGGG + Intergenic
919047384 1:192470421-192470443 AGGGAAAGTGAAGTGATTGTGGG - Intergenic
919354390 1:196502583-196502605 AGAGTCAATGCAGTTATTGAGGG - Intronic
919372158 1:196741378-196741400 GGAGAGAGAGGAGTGAGTGAAGG + Intronic
920473594 1:206253525-206253547 AGAGAGAGTGAAGGAAGTGAGGG - Intronic
920481453 1:206326213-206326235 AGAGAGAGTGAAGGAACTGAAGG + Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
922922562 1:229318854-229318876 AAAGAGAGTGCAGTGCTGGCCGG - Intergenic
923276953 1:232404838-232404860 AGAGAGACTCCAGGGAATGAGGG - Intronic
924250901 1:242132173-242132195 AAAGAGAATGCAGTGATTGCGGG + Intronic
924490926 1:244536562-244536584 AGACAGAGTGCAGTGATTGTGGG - Intronic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1064000489 10:11660037-11660059 AGAGAGACTAGAGTGATGGAAGG + Intergenic
1064112012 10:12547644-12547666 AGAGAGAGTGCAGGGTTGGGGGG - Intronic
1064537576 10:16373749-16373771 AGAGAAAGTGCAGTAACAGAGGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065394157 10:25216395-25216417 AGAGAGACTGGATAGATTGATGG - Intronic
1065395946 10:25237967-25237989 AGAGACAGTGAAGTAAGTGAAGG - Intronic
1065913222 10:30328876-30328898 AGAGAGAGAGCAATAAATGAAGG + Intronic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1069076441 10:64042319-64042341 AGGGAGAGTGGAGTGAGTGCAGG - Intergenic
1069193570 10:65520302-65520324 AGGGAGAGAGCAGTGATAGTGGG - Intergenic
1069716712 10:70525890-70525912 AGAGGGTGTGCAGTGAAGGAGGG - Intronic
1070765785 10:79055463-79055485 AAAAAAAGTGCAGTGAGTGAAGG + Intergenic
1070940036 10:80336491-80336513 GGAGAGAGTGCAGTGTGTGAAGG - Intronic
1071729180 10:88231050-88231072 GGAGAAATTGCAGTAATTGAGGG - Intergenic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072158409 10:92744393-92744415 AGAGAGACTGCAGTAAATGGTGG - Intergenic
1072266147 10:93729810-93729832 AGAGAGTCTGCAGTGGTTAAGGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072774023 10:98171084-98171106 AGAGAGAGTGAAGGCAATGAGGG - Intronic
1074164605 10:110864010-110864032 AGACAGAGTCCAGTGATGGTGGG + Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075857051 10:125638403-125638425 AGAGAGATGGCAGTGAGAGAAGG + Intronic
1076183700 10:128430636-128430658 AGAGAGAGAGCAGGGACAGAGGG - Intergenic
1078022576 11:7668133-7668155 AGAAAGAGAGCAGTCTTTGAAGG - Intronic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1078919858 11:15819712-15819734 ATAGAGAGTGGAGTGCTCGAGGG - Intergenic
1079473998 11:20808797-20808819 AGAGGGAGTACAATGATTGTGGG - Intronic
1079539691 11:21557935-21557957 AGAGAGAGTGAGCTCATTGAGGG - Intronic
1079760146 11:24319148-24319170 AGAGAGAGTGCAAGGATTGTGGG - Intergenic
1080002702 11:27368393-27368415 ATAGAGATTGCAGTGATCAATGG + Exonic
1080118812 11:28650723-28650745 AGAGAGACTGCTGAGTTTGATGG - Intergenic
1080966640 11:37220567-37220589 AGAGAGAATGCAGTGATCGTGGG - Intergenic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1083702826 11:64490924-64490946 AGAGAGGGTGCAGTGGGTGCAGG - Intergenic
1084087225 11:66860180-66860202 AGAGAGTGTGGTGTGATGGACGG + Exonic
1084359579 11:68660816-68660838 AGAGAAAGTGCAGAGGTGGACGG + Intergenic
1084771705 11:71347147-71347169 TGACTGAGTGCAGTGAGTGAAGG + Intergenic
1084921199 11:72471445-72471467 AGAGATAGAGAAATGATTGAGGG - Intergenic
1085320282 11:75569878-75569900 AGAGGCAGTGCAGTGACCGAGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085716254 11:78876180-78876202 ATAGAGAGTGCATTGACTGCTGG + Intronic
1085730774 11:78996779-78996801 GTAGACAGTGCAGTGATTAAGGG + Intronic
1085762825 11:79257042-79257064 AGAGACAGAGCAGTGAATGAAGG + Intronic
1086055028 11:82636381-82636403 AGAGGGAGTGCAGGTTTTGAGGG - Intergenic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087834538 11:102859382-102859404 AGAGATGGTGGTGTGATTGATGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1089503584 11:118947904-118947926 AGACAGACTGCAGTGATTTTAGG - Intronic
1089791239 11:120945769-120945791 AGAGAGAGAGCAGTGAGTTCAGG - Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090777168 11:129975707-129975729 GGAGAGAGTGCAGTGGTGGCAGG - Intronic
1090780957 11:130005996-130006018 AGAAAGAGTGTAGTGATACAAGG + Intergenic
1092184676 12:6470282-6470304 GGAGAGGGTGCAATGATTGTGGG + Intronic
1093531900 12:20175252-20175274 AGAGAGAGTCCAGTGACTGTGGG - Intergenic
1093585231 12:20827973-20827995 AGAGAGAGTGGTGTGCTAGAGGG + Intronic
1093656917 12:21705596-21705618 AGAGTGTGTGCAGGGGTTGAGGG - Intronic
1093914764 12:24789012-24789034 GGAGAGAATACAGTGAGTGAGGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1094717413 12:33026879-33026901 AAAGAGAGTTCAGTAATTCAGGG + Intergenic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1098106706 12:67075164-67075186 AGAGAGAGTGGAGAGTTTCAGGG - Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098976765 12:76910560-76910582 AGAGAAAGTACAGAGAGTGAAGG - Intergenic
1099263729 12:80417433-80417455 AGAAATAGTGGAGTGCTTGAAGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099523213 12:83689423-83689445 AAAGACAGTGCGGTGATTGTGGG + Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099966707 12:89454552-89454574 AGAGTGGGAGCAGTGATAGATGG - Intronic
1100909295 12:99339328-99339350 AGGAAGAATGCAGTGATTGCTGG - Intronic
1101358103 12:103999704-103999726 AGAAAGAGTTACGTGATTGAGGG - Intronic
1101747881 12:107557973-107557995 AGAAAGAGTGCAGTGTCAGAAGG + Intronic
1103151999 12:118648850-118648872 GCAGATAGTGCAGTGATTGAGGG - Intergenic
1103470946 12:121180634-121180656 AAAGAGAGGGTAGTGATTGGAGG - Intronic
1104889099 12:132131480-132131502 CGACAAAGTGCAGTGATTGTCGG - Intronic
1105977878 13:25489289-25489311 AGGGAAAGTGCCGTGATTAAAGG - Intronic
1107641525 13:42448214-42448236 AGAGAGAGAGGGGTGAGTGAAGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107765752 13:43732797-43732819 AGAGAAAATGCAGTGAGTGTTGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108078799 13:46710957-46710979 AGAGACAGTGAAGAAATTGAGGG - Intronic
1108961281 13:56234293-56234315 AGAGGAAGGACAGTGATTGAAGG + Intergenic
1109225449 13:59689049-59689071 AGAAAGAAAGCAATGATTGAGGG + Intronic
1110079046 13:71287473-71287495 AGAGAAAGCGCAGTGACTGTGGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1114392299 14:22322923-22322945 AGAAAGAGTGCTGAGATTGGAGG + Intergenic
1114413897 14:22526123-22526145 AGAAAGAGTGCAGCGACAGATGG - Intergenic
1114424694 14:22611962-22611984 AGAGAAACTGCAGAGACTGATGG - Exonic
1114820428 14:26011235-26011257 AGAGAGAGTAAAGAGATTGGAGG + Intergenic
1114994289 14:28328467-28328489 AGAGAGAGTGAAGTGATCCTGGG - Intergenic
1115186364 14:30692453-30692475 AGGGAGAGAGTAGGGATTGAAGG + Intronic
1116114876 14:40635389-40635411 AGAGAGAATGTAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116686437 14:48045156-48045178 AGAGAGAGTGCAGATAGTGATGG + Intergenic
1116789183 14:49321481-49321503 AGAGAGAGTGCTGTGAGACAAGG + Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1119378488 14:74213994-74214016 AGAGAGTGGGCAGGGAGTGAGGG - Intergenic
1119648559 14:76366911-76366933 ACAGTGAGTACAGTGATTGATGG - Intronic
1119753158 14:77095031-77095053 AAAGAGAGTAAAGTGAGTGAAGG + Intergenic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1122410738 14:101524983-101525005 AGTGAGCCTGCAGTGAGTGACGG + Intergenic
1122628971 14:103098842-103098864 AGAGACAGTCAAGTGATTGATGG - Intergenic
1122632558 14:103113717-103113739 AGAGGGTGTGCTGTGAGTGACGG + Intergenic
1122916436 14:104861174-104861196 AGACAGAGGGTAGTGATGGATGG - Intergenic
1122916458 14:104861291-104861313 AGATAGAGGGTAGTGATGGACGG - Intergenic
1122916495 14:104861473-104861495 AGATAGAGGGTAGTGATAGACGG - Intergenic
1122916675 14:104862392-104862414 AGATAGAGAGTAGTGATGGATGG - Intergenic
1124503337 15:30250033-30250055 AGAGAGAGAGAAATGAATGATGG + Intergenic
1124740218 15:32288606-32288628 AGAGAGAGAGAAATGAATGATGG - Intergenic
1124947202 15:34280016-34280038 AGACAGAGTGAAATGATTGTGGG + Intronic
1126660829 15:51031470-51031492 AGAGGGACTGCAGTGATTGTGGG - Intergenic
1126979948 15:54229156-54229178 AGAGAGAATGCAGTAATTGCAGG - Intronic
1127000123 15:54493387-54493409 AGAGAGAGAGGAGAGAGTGAGGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1127619756 15:60722377-60722399 AGAAATAGTGCAGTGAGTGATGG - Intronic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128668421 15:69555781-69555803 AGAGAGATTGGAGTGGTTGGGGG - Intergenic
1128714935 15:69901099-69901121 AGAGAGAGTGCAGGAGTTGGAGG - Intergenic
1129198890 15:73986905-73986927 AGAGAGAGTGCATGGAGTGGAGG + Intronic
1129556456 15:76515286-76515308 AGGGTGAGTGCAGTAACTGAAGG + Intronic
1131134246 15:89921220-89921242 ACACAGAGTCCATTGATTGAAGG + Intergenic
1131427595 15:92359621-92359643 GGAAAGAGTTCAGTGACTGAAGG + Intergenic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1133834304 16:9352328-9352350 AGACAGAGTGCAGTGATTGTGGG - Intergenic
1136241527 16:28947570-28947592 AGAGAGAGTTTAATGATTGCAGG + Intergenic
1136591282 16:31219262-31219284 AGGGATGGGGCAGTGATTGAAGG - Intronic
1136636715 16:31528991-31529013 AGAGAGAGTGCAGAGCTGCAGGG + Intergenic
1137859975 16:51836832-51836854 ATAGAGTGTGCAGAGATTGGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1138929147 16:61631205-61631227 AGAGAGAGAGAAGGGATGGAGGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1140729110 16:77840127-77840149 AGAGAGCCTGCAGTGAGTGGTGG + Intronic
1140776178 16:78250667-78250689 GGAGAGAGTCCAGTGATGGCGGG + Intronic
1142919139 17:3169345-3169367 AGAGAGAATGCAGTGAGTGTGGG + Intergenic
1143141200 17:4742693-4742715 TGAGAGCGTGCAGGGATTGGGGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143703359 17:8678713-8678735 AGTTAGAGTGCAGGGTTTGATGG - Intergenic
1143766412 17:9140657-9140679 ATTGAGAGTGCAGTGCTTTAGGG - Intronic
1144070766 17:11669420-11669442 GGAGAGAGTCCAGAGAATGATGG + Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145265668 17:21378517-21378539 TGAGAGAGAGCAGGGAGTGAGGG + Intronic
1146395710 17:32464491-32464513 AGAGAAAAGGCATTGATTGAAGG - Intronic
1146460203 17:33040186-33040208 TCAGGGAGTGCAGTGAGTGATGG + Intronic
1146466888 17:33093443-33093465 AGAGAGAGTGCAGAGAGAAAGGG + Intronic
1146471701 17:33130039-33130061 GGAGAGAGTTCAGTGTGTGACGG - Intronic
1148102719 17:45102523-45102545 AGAGAAAGAGCAGTGAGTGTGGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149578811 17:57733103-57733125 AGAGACAGTGAAGAGATTGGTGG - Intergenic
1150936133 17:69637667-69637689 AGAGAGAGAGAGGTGATTAAGGG + Intergenic
1151001958 17:70387949-70387971 AGAGAGAGTGCTGTGTCTGTTGG + Intergenic
1151066496 17:71156678-71156700 AGAGAGAGGCAAGGGATTGAGGG + Intergenic
1153403893 18:4713340-4713362 AGCCAGAGTGCATTGAATGAAGG - Intergenic
1153446642 18:5180144-5180166 TGTCAGAGTGCTGTGATTGAAGG - Intronic
1154101612 18:11479638-11479660 AGAGACTGTGCAGTGAGGGAAGG - Intergenic
1155223560 18:23707525-23707547 AGAGAGAGAGAAGGAATTGATGG + Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1155767349 18:29652369-29652391 AGGGAGAATGCAGTGAATGTGGG + Intergenic
1155911589 18:31510539-31510561 ACAAAGAGTACATTGATTGATGG + Intronic
1155997757 18:32349325-32349347 AGAGAGATGGCTATGATTGAAGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159106143 18:64003286-64003308 AATGACAATGCAGTGATTGATGG + Intronic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159775443 18:72598856-72598878 AGAGAGAGTGCAGCAATTTTGGG - Intronic
1160358938 18:78253777-78253799 AGAGAGAGTTAGGTGATAGATGG - Intergenic
1161335929 19:3713247-3713269 AGACAGAGAGCAGAGATGGAGGG - Intronic
1164560440 19:29288424-29288446 GGAGAGAGCGCAGTGAGAGAAGG + Intergenic
1165158816 19:33804006-33804028 AGAGAGGATGCAGGGTTTGAGGG - Intronic
1165727002 19:38119861-38119883 GGAGATAGTGCAGAGACTGAAGG + Exonic
925517609 2:4701417-4701439 AGAGAGAGGGAGGTTATTGAAGG - Intergenic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
925721570 2:6833471-6833493 AGAGAGAGTGCACGCATGGAAGG + Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927045163 2:19270940-19270962 ACAGGGAGAGAAGTGATTGAGGG - Intergenic
927291290 2:21407500-21407522 AGAGAAAGTACAGTCATTCATGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930469157 2:51791842-51791864 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932889379 2:75579003-75579025 AGAGAAAGTGCAGTGATTGTGGG + Intergenic
933153763 2:78947730-78947752 AGAGAGAGTTTAATAATTGATGG + Intergenic
933478527 2:82822946-82822968 GGAGTCACTGCAGTGATTGAAGG + Intergenic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935740422 2:106142666-106142688 AGAAAGAGTGAAGAGATGGAGGG + Intronic
936050803 2:109222520-109222542 AGAGGGAGTGCATTGTTGGAGGG + Intronic
936237169 2:110752525-110752547 AGAGAGAAAGTAGTGATTGAGGG + Intronic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936914945 2:117630716-117630738 AGAGAGACTGTTGTGATTGCTGG - Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
937854672 2:126663690-126663712 GGAGAGGGTGCAGTGAATGCTGG - Intronic
938081738 2:128373859-128373881 AGAGAGGGTGGTGTGAGTGAAGG - Intergenic
938190702 2:129277591-129277613 CGAGAGAGTGGAGTGATTGAAGG - Intergenic
938208354 2:129442756-129442778 AGAAAGAGTGTAGTGATCGCAGG - Intergenic
938251033 2:129815941-129815963 AGAAAGAGTGTAATGATTGCAGG + Intergenic
939144423 2:138395703-138395725 AGAGAGACTGCAGTGACTGTGGG + Intergenic
939238310 2:139526072-139526094 AGAGAGAGAAGAGTGAGTGAAGG + Intergenic
939378390 2:141400626-141400648 AGAGAAAGTGAAGTGTCTGAAGG - Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941226601 2:162857358-162857380 AGAGAGAGAGCAGTTTTTAATGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
941894500 2:170615513-170615535 AGACAGAGGGAAGTGAGTGAGGG + Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944005278 2:194897097-194897119 AGAGAGAGTGCAACTATTGTGGG - Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
944855209 2:203760514-203760536 AGAAAGAGTGCAGTGATTGCAGG - Intergenic
945334323 2:208573491-208573513 AGGTAGAGTGAAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
946029787 2:216694817-216694839 AGCGAGAGTGCAGGGATAAAGGG + Exonic
946508175 2:220324102-220324124 TGGGAGAGTGATGTGATTGATGG + Intergenic
946508974 2:220334284-220334306 AGAGAGACTTCATTGTTTGAGGG - Intergenic
947247489 2:228065766-228065788 AGAGACAGTGCATTGATTTGAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168852790 20:988143-988165 GGCCAGAGTGCAGTGACTGAGGG + Intronic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169275282 20:4229653-4229675 GGACAGAATGCAGTGATTGAGGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170485032 20:16807275-16807297 AGAAAGAGTTCAGTGATTGCAGG - Intergenic
1170864221 20:20138508-20138530 AGAGAAAGTGCAGTGACTGTGGG - Intronic
1171116177 20:22526617-22526639 AGAAAGAGAGCAGTGGGTGAGGG + Intergenic
1171882907 20:30631359-30631381 AGAGAGAGTGCAGGGCTGGCAGG + Intergenic
1171942787 20:31347933-31347955 AAAGGGGGTGCAGTGATTGTGGG + Intergenic
1172013692 20:31861108-31861130 AGGGAGAGTGGAGGGTTTGACGG - Exonic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176940060 21:14912637-14912659 AGGGAGAATGCATTGATTGTGGG - Intergenic
1176972189 21:15279680-15279702 AGAGAGAGAACATTGCTTGAAGG - Intergenic
1177295141 21:19163560-19163582 AGAAAGAGTGCAGTGATTGTGGG - Intergenic
1177480778 21:21684546-21684568 AGAGAAAGTTGAGTGATAGAAGG + Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1177849725 21:26332458-26332480 AGAGAGAGTGTAGTGATTCTGGG + Intergenic
1177904282 21:26956572-26956594 AGAGATAGTGAAATGATTGTGGG - Intronic
1178365539 21:31986346-31986368 AGAGAGAGTGCAGGGGTTGGAGG - Intronic
1179652382 21:42820035-42820057 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1180133251 21:45841956-45841978 TGACAAAGGGCAGTGATTGAAGG - Intronic
1181959539 22:26612981-26613003 AGAGGGAGTGCAGAGAGAGAGGG - Intronic
1182722040 22:32410988-32411010 AGGGAGAGCGCAGTGGTTCATGG - Intronic
1183983666 22:41557541-41557563 AGCCAGAGAGCAGTGAATGAAGG - Intergenic
1184849967 22:47114429-47114451 GGAGAGAATGCTGTGAGTGAGGG + Intronic
1185069384 22:48647823-48647845 GGAGAGAGTGCAGGGAGGGAGGG + Intronic
950680472 3:14581671-14581693 AGAAAGAGAGAAGTGAATGATGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951846039 3:27085832-27085854 AGACAGAGAGCAGTGTTTAAGGG + Intergenic
952052862 3:29407161-29407183 AGCAAGTGTGCAGTGATTGTTGG - Intronic
952187211 3:30982947-30982969 AGACAGAGGGAAGTCATTGAGGG + Intergenic
952688486 3:36176245-36176267 AGGAAAAGTGCAGTGATTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952987232 3:38796784-38796806 AGAGAAAGTGCAGAGAGTTATGG - Intergenic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955214077 3:56970580-56970602 AGAGACAGTGCAGGGGTTGGAGG - Intronic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955717748 3:61848226-61848248 AGAGAGAGTGCAAACATGGAGGG - Intronic
956192723 3:66622563-66622585 AGAGAGACTGGAGTGCGTGAAGG - Intergenic
956314230 3:67916162-67916184 AGAAAGTCTGCAGTGCTTGAGGG + Intergenic
956383645 3:68693029-68693051 GGAGTGAGTGCAGTGAGTGCAGG - Intergenic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958065662 3:88542306-88542328 ACAGAGAAAGCAGAGATTGATGG + Intergenic
958682691 3:97352489-97352511 AGAGAGAATGCAGTGACTGTGGG + Intronic
958929248 3:100191339-100191361 AGAGAGGGTGAAGAGAGTGAGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959361493 3:105399319-105399341 AAAGCTAGTGCAGTGATTGTTGG + Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959913841 3:111794297-111794319 AGAGAGGGTGCAGTGACTGCGGG - Intronic
960933236 3:122875875-122875897 AGAGCCATTGCAGTCATTGAGGG + Intronic
961199453 3:125032718-125032740 AGACAGAGAGAAGTGATTGTAGG + Intronic
963254444 3:143130816-143130838 AGAGGGAGGGCAGGGATGGAGGG - Intergenic
963430573 3:145196965-145196987 AGGGAGAGTGTGGTGATTGTGGG + Intergenic
963779796 3:149475778-149475800 AGAGAGAGTCCAGGAGTTGAAGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964276118 3:155010670-155010692 AGAGATAGGGCAGTTAATGAAGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964629426 3:158794107-158794129 ATAGAGAGTGGAATGATAGATGG - Intronic
964630171 3:158801859-158801881 AAAGACAGTGCAGTAATTGGTGG + Exonic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965014673 3:163141148-163141170 AGAGAGAGAGCAGTTATTATTGG - Intergenic
965437685 3:168672422-168672444 TGTGAGTGTGCAGTGAGTGATGG - Intergenic
965640203 3:170822491-170822513 AGAGAGAGTGGAGACATGGAGGG + Intronic
966036789 3:175426868-175426890 AGAGAGAGTGCTGTATTTGTAGG + Intronic
966780204 3:183577947-183577969 AGAGTGAGGGCTGTGATGGAGGG + Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
967878101 3:194280425-194280447 ATAGAGAGTGCAGTCCTTGAAGG - Intergenic
968543298 4:1179234-1179256 AGAGTGAGTGCTGTGTTTGCTGG - Intronic
970066902 4:12105442-12105464 AGCAAGAGTGCATGGATTGAAGG + Intergenic
970102970 4:12546219-12546241 AGAGAGAGAGAAGTGAGAGATGG - Intergenic
970658039 4:18253654-18253676 TTTGAGAGTGCAGTGAATGAAGG + Intergenic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972503777 4:39702124-39702146 CAAGAGAGTGCACTGATTTAAGG - Intronic
972612443 4:40668215-40668237 GCAGAGGGTGTAGTGATTGAAGG - Intergenic
973012331 4:45092646-45092668 AGCAAGAGAGCAGGGATTGAGGG + Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973625937 4:52772909-52772931 AGAAAGGGTATAGTGATTGAAGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974292181 4:59947478-59947500 AGAAAGAGTGTAGTAATTGCGGG + Intergenic
974722419 4:65758241-65758263 AAAGAGAGTGGAGTTATAGAAGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976837848 4:89395932-89395954 ATAAAAAGTGCAGTGTTTGAGGG - Intergenic
977185727 4:93933074-93933096 ACAGTGGGTGCAGTCATTGAAGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977913956 4:102570090-102570112 AGAGAGAGTGTGGTGATTACTGG - Intronic
978379048 4:108107111-108107133 AGAGAGAGTGGATTGTTTAAAGG - Intronic
978415128 4:108466802-108466824 AGAGAGAGTAGAGGGCTTGAGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978947024 4:114512067-114512089 AGAGAGAATGCACTGGTTGGAGG + Intergenic
979184522 4:117772046-117772068 AGGGAGAGTGCAGACATTAAGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979935456 4:126688883-126688905 ACAGAGAGTGCAGTATTTGCAGG + Intergenic
979958243 4:126982121-126982143 AGAGAGAGTGAAGAGATTTGAGG + Intergenic
980646581 4:135651331-135651353 ACAGAGGGTGCAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981286401 4:143024183-143024205 AGGAAGAGTGTAGTGATTGTGGG + Intergenic
981394597 4:144233255-144233277 AGGGACAGTGCATTGATTGAGGG + Intergenic
981465550 4:145067434-145067456 AGAAAGCGTGTAGTGAGTGAGGG - Intronic
982126487 4:152188335-152188357 AGCGAGAGTCAAGTGATTGCAGG - Intergenic
982777493 4:159457065-159457087 AGAGAGAGGGCTGTGAAAGAGGG + Intergenic
983008845 4:162520093-162520115 AAAGACAGTGCTGTGATTGGAGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984352142 4:178608839-178608861 AGAGAGAGAGATGTAATTGAAGG + Intergenic
985142325 4:186854316-186854338 AGACAGTCTGCAGTGATTGGGGG + Intergenic
985208646 4:187568440-187568462 AGAGAGAGAGAAGGGATGGAGGG - Intergenic
985583063 5:710126-710148 AGAGAGAGTGGTGGGGTTGAGGG - Intergenic
985596742 5:795378-795400 AGAGAGAGTGGTGGGGTTGAGGG - Intergenic
985810175 5:2077220-2077242 AGAGAGAGAGAAGAGGTTGAGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986214116 5:5702164-5702186 AGAGAGAGTGCAGGGGGTGAAGG + Intergenic
986293409 5:6418181-6418203 AGAGAGACTGCAGTGCTGTAGGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
987903779 5:24050028-24050050 AGGGAGAGTGGGGTGATTGTGGG + Intronic
988335428 5:29902310-29902332 AAAGAAAGTGCAGTGATTCAAGG + Intergenic
988608644 5:32704159-32704181 AGACAGAGTGCAATGACTGTGGG - Intronic
989987450 5:50717858-50717880 AGGGAGAGAGAAGTGACTGATGG + Intronic
990199542 5:53355794-53355816 ACAGAGAGGGCAGAGATTGGAGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991925617 5:71702698-71702720 ACTGACAGTGCAGTGAGTGATGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993138253 5:83997828-83997850 AGGGAGAATGAAGTGATTGTGGG + Intronic
993230273 5:85226568-85226590 AGGGAGAGTGAAGTGAATGTGGG - Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993940739 5:94055423-94055445 AGAGAGAGGCTAGTGACTGAAGG - Intronic
994292842 5:98050517-98050539 AGAACAAGTGCAGTGATTGCAGG + Intergenic
994320334 5:98387314-98387336 AGGGGAAGTGCAGTGATTGTGGG - Intergenic
994533644 5:100999667-100999689 AGGGAGAGTGAAGTGAGTGTGGG + Intergenic
994584348 5:101686136-101686158 ACAGAGAGGGAAGGGATTGATGG + Intergenic
995001694 5:107139498-107139520 AGACAGTGTACAGTGCTTGAAGG - Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996193030 5:120568532-120568554 AGAGAAAGTGGTGAGATTGAGGG - Intronic
997739086 5:136238021-136238043 AGGCAGAGTGCAATGAGTGAAGG - Intronic
998682601 5:144486997-144487019 AGACAGACTGAAGTGATGGAGGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
999675309 5:153994923-153994945 AGAAATACTGCAGTGATTAATGG + Exonic
999806048 5:155082330-155082352 AGAGAGAATAAAGGGATTGAAGG + Intergenic
1002367440 5:178724190-178724212 AGAGCGATTGCAGTCATGGAGGG - Intronic
1003420178 6:5950593-5950615 AAAGAGAGTGCAAAGATAGAAGG + Intergenic
1005121217 6:22391033-22391055 AGTGAAAGTGCAGGGATAGACGG - Intergenic
1005387234 6:25297448-25297470 AGAGAGAGTAAAATGATAGAGGG - Intronic
1005839051 6:29728503-29728525 AGAGAGAGGGTAAAGATTGAGGG + Intronic
1005852912 6:29835512-29835534 AAAGAAAGGGCAGAGATTGAGGG + Intergenic
1006205689 6:32340444-32340466 ACTGACAGTTCAGTGATTGACGG - Intronic
1007267166 6:40605378-40605400 AGGGAGAGTGCAGCTATTGATGG - Intergenic
1008304633 6:49886448-49886470 AGAGAGAGTGCATTGATCACGGG - Intergenic
1008532434 6:52476054-52476076 AGACAGTGTGCAGTGAATGGAGG + Intronic
1009321664 6:62298099-62298121 AGAGAGAGAGCAGTGGTGGTGGG + Intergenic
1009596293 6:65740826-65740848 AGGAAGAGTGAAATGATTGATGG + Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1010618186 6:78040681-78040703 AGAGAGAGTGCAGGGGTAGCGGG + Intergenic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1012003509 6:93684305-93684327 AGAAAGAGGGCAGTGATTGGGGG + Intergenic
1012004144 6:93691705-93691727 AGAAAGAGGGCAGTCATTTAAGG + Intergenic
1012047724 6:94300403-94300425 AGGGAAAGTGCAGTTATTGTGGG + Intergenic
1012073796 6:94657774-94657796 AGGGAGAAAGCAGTGACTGATGG - Intergenic
1013655006 6:112237513-112237535 AAAGAGGCTGCTGTGATTGAAGG + Intronic
1014745111 6:125191703-125191725 AGAGAGAGAGCTGGGAGTGAAGG + Intronic
1015309881 6:131754993-131755015 AGCGTGAGTCCACTGATTGAAGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015612495 6:135039615-135039637 AGATAGAGTGCAGAGTTTGAAGG - Exonic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1016511511 6:144848395-144848417 AAAGTGAGTACAGTGATTCAAGG + Intronic
1017616403 6:156251142-156251164 AAAGAGAGGCCAGTCATTGAGGG - Intergenic
1018505025 6:164456821-164456843 ATAGAGATATCAGTGATTGAAGG - Intergenic
1018936599 6:168277731-168277753 ACAGAGAGTGGAGTGACTCAGGG + Intergenic
1019087001 6:169487947-169487969 AGAGAGAGTGCTGTGTCTGTGGG - Intronic
1020470722 7:8531507-8531529 ATAGAGAGTACAGTAACTGAAGG - Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021884984 7:25129436-25129458 AGGGACAGGGCAGTGATTGCAGG - Intergenic
1021899266 7:25267104-25267126 AGAGAGGATGCAGAGATTGCAGG + Intergenic
1022355019 7:29606557-29606579 AGAGAGAGGGCAGTGGATGGAGG - Intergenic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1023973220 7:45007172-45007194 AAAGAGTGTGCTGTGATTTATGG - Intronic
1024176462 7:46845523-46845545 AGAGAGAGTCCAGTGGCAGAGGG - Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1029175887 7:98664193-98664215 AGAGAGAGTTTAATGATTGCAGG - Intergenic
1029741328 7:102493310-102493332 ATAGAGAGCCCAGTGAATGAGGG + Intronic
1029759318 7:102592479-102592501 ATAGAGAGCCCAGTGAATGAGGG + Intronic
1029776687 7:102688389-102688411 ATAGAGAGCCCAGTGAATGAGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031212407 7:118847245-118847267 AGAGAGGGTGCAATTTTTGAGGG - Intergenic
1031257432 7:119472357-119472379 AGAGAAAATTCAGTGAATGAAGG - Intergenic
1031272164 7:119665715-119665737 AGGGAAGGTGCAGTGATTGTGGG + Intergenic
1031371676 7:120975502-120975524 AGATAGAGTGCAGTTCATGAGGG + Exonic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031954661 7:127930081-127930103 ACAGAGACTGCAGTCTTTGAGGG + Intronic
1032532959 7:132637063-132637085 AGAGGGAATGCAGAGATAGATGG + Intronic
1032803719 7:135336300-135336322 AGAAAGAATGCAGTGAAGGAAGG - Intergenic
1033004923 7:137551292-137551314 AGAGAGAGAGCAGTAAGTGTTGG + Intronic
1033011912 7:137632315-137632337 AGACAGAATCCATTGATTGAAGG + Intronic
1033476680 7:141699582-141699604 AGAGAGAGCGCAGTGTGAGAGGG - Intronic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034415544 7:150962644-150962666 AGAGAGAGAGGAGTGACTGCTGG + Intronic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1034925762 7:155120149-155120171 AGAAAGAGTATAGTGATTGCAGG - Intergenic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1035495437 7:159321321-159321343 AGACAGACTGAAGTGTTTGAAGG - Intergenic
1037316436 8:17603900-17603922 AGAAAGAGAGAAGTGTTTGAAGG + Intronic
1037587393 8:20287599-20287621 AGAGAGAGAAGAGTGAGTGAAGG + Intronic
1038040324 8:23718658-23718680 AGATGGAGTGGAGTGAATGAGGG + Intergenic
1038513138 8:28159655-28159677 AGAGAAAGTTCAGTCATGGAGGG - Intronic
1038515639 8:28185575-28185597 AGAGAGAGTGCTGTGAATTCTGG + Intronic
1038630122 8:29234102-29234124 ATTCAGAGTGCAGAGATTGATGG + Intronic
1038941956 8:32314862-32314884 ACAGAGAGGACAGTGTTTGATGG - Intronic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1039212283 8:35231384-35231406 AGAGAAAGGGCAGTGAGAGAAGG + Intergenic
1040292147 8:46131004-46131026 GGTGAGACTGCAGTGATTGCTGG - Intergenic
1040293512 8:46137491-46137513 AGAGAGACTGCAGGGATTGCTGG - Intergenic
1040300072 8:46183398-46183420 AGTGAGACTGCAGTGAATGCTGG - Intergenic
1040317806 8:46274191-46274213 AGAGAGATTGCAGGGAATGCTGG + Intergenic
1040332144 8:46391156-46391178 AGAGAGACTGCAGGGAATGCTGG + Intergenic
1040641646 8:49341168-49341190 AGAGAGTGTGCATAGATTGAGGG + Intergenic
1041415890 8:57608739-57608761 AGACAGAGTGCAATGACTGGGGG + Intergenic
1041550130 8:59091086-59091108 AGAGAGAGAGCAATAGTTGAGGG - Intronic
1041942684 8:63406010-63406032 AGTGAAAGGGCAGTTATTGAAGG - Intergenic
1042729237 8:71913002-71913024 AGAGAGAGAGGAGTGTTTTATGG + Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043314498 8:78903327-78903349 AGAGAAAGAGCAGAGGTTGAGGG - Intergenic
1043641923 8:82464490-82464512 AGAGTGCCTGCAGTGAGTGAAGG - Intergenic
1043871338 8:85437264-85437286 AGAAAGACTGCAGTGGTTAATGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044949830 8:97424964-97424986 AGGGTCAGTGCAGTGATTAAGGG + Intergenic
1045187762 8:99856328-99856350 TGAAAGAAAGCAGTGATTGAAGG + Intronic
1046215617 8:111141604-111141626 AGAGAGAGTGAAGTGATTATAGG - Intergenic
1046754965 8:117963345-117963367 AGAGAGAGTCCAGTGGTGGCTGG - Intronic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047181031 8:122588318-122588340 AGAAAGAGTGTAGTGGTTGCTGG - Intergenic
1047692571 8:127371362-127371384 AGAGGCAGTGCAGTCAATGAAGG + Intergenic
1048061039 8:130919477-130919499 AGAGTGGGTGCAGAGCTTGAGGG + Intronic
1048527438 8:135216050-135216072 AGAGAGAGTGAAGAAAGTGAAGG + Intergenic
1049143912 8:140983645-140983667 AGAGAGAGGGAAGTGAAGGAAGG + Intronic
1049320170 8:141992067-141992089 AGAGTGGGTGGAGTGAGTGAGGG - Intergenic
1049909166 9:248932-248954 TGACAGAGTGAAGTGAGTGAGGG + Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1055056126 9:72025798-72025820 AGAGAGAGAGCTGAGAATGAGGG - Intergenic
1055355762 9:75435601-75435623 AAAGGGACTGCAGTGACTGAGGG - Intergenic
1055623365 9:78148683-78148705 AGAGAGAGTTCAGAAATTCAGGG - Intergenic
1056197521 9:84242438-84242460 AGAGAGAGAGAAGAGAGTGAAGG - Intergenic
1056267807 9:84916853-84916875 AGAGAGATGGCAGTGATTTACGG + Intronic
1056516665 9:87358799-87358821 AGAGAAAGTGCAGTGACTGTGGG + Intergenic
1056522287 9:87412132-87412154 AGAGAGAGTGGAGAAACTGAGGG - Intergenic
1057241226 9:93411776-93411798 AGAGAAAGTGCAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057976803 9:99613218-99613240 AGCCTGAGTGCCGTGATTGAGGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058445797 9:105053802-105053824 AGAAAGAGTTCAATGATTGCAGG - Intergenic
1058631574 9:106993638-106993660 ACAGAGAATGCAGGGAGTGAAGG - Intronic
1058770251 9:108224053-108224075 GGAGACAATGCAGTGATTGTAGG - Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059733136 9:117076124-117076146 TGAGAGAGAGCTGTGATTGGGGG + Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1060756495 9:126218129-126218151 AGTTAGATTGCAGTGAGTGAAGG + Intergenic
1062581909 9:137232489-137232511 AGAGAGGGGGCAGAGAATGAGGG + Intronic
1062640791 9:137517206-137517228 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640825 9:137517409-137517431 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640837 9:137517476-137517498 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640859 9:137517611-137517633 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640883 9:137517746-137517768 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640895 9:137517813-137517835 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640912 9:137517914-137517936 GGACAGAGTGGAGTGAGTGACGG - Intronic
1062640943 9:137518082-137518104 GGACAGAGTGGAGTGAGTGACGG - Intronic
1187209175 X:17212026-17212048 TGAGAGACTGCATTGATTCAAGG + Intergenic
1187284781 X:17894545-17894567 TGAGAGAATGCAGTGATTTGGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188799448 X:34509504-34509526 ATAGAGAGTGCAGTGAGACAAGG - Intergenic
1189737027 X:44081843-44081865 AGAGAGAGAGAAGAGAGTGAGGG - Intergenic
1189760227 X:44314580-44314602 AGAGAGAGTGGAGGGAATGGTGG - Intronic
1189928962 X:45987563-45987585 AGGGAGAGTGGACTGATTTAAGG - Intergenic
1190224236 X:48533335-48533357 AGAGTGAGTGAAGTGATTAGGGG - Intergenic
1191813352 X:65216317-65216339 AGAGAGAGCGTAGTGAGTGTGGG + Intergenic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1192875348 X:75223645-75223667 AGGGAAACTGCAGTGATTGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193440952 X:81538647-81538669 AGAGAAAATGAAGTGATTGTGGG + Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194251820 X:91585354-91585376 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195062535 X:101210212-101210234 AGAGAAAGTGTTGTGATTCAAGG - Intergenic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195619637 X:106939983-106940005 AGTGAGACTGCAGGGAATGAGGG - Intronic
1195823204 X:108969769-108969791 AGAGAAAGTGCAGCAATTGTGGG + Intergenic
1195863208 X:109402881-109402903 ACAGAGAGTCCAGTCATTGGTGG - Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1197024871 X:121737159-121737181 AGAGAGAGTGTAGTGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1198006303 X:132497936-132497958 AGAGATAGGGTAGTGATTAAGGG + Intergenic
1198700542 X:139392745-139392767 AGAAAGAGTTCAGGGATTGGAGG + Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200570754 Y:4826585-4826607 AGGGAGAGTGCAGAAATTGTGGG + Intergenic
1200826189 Y:7644820-7644842 TTAGAGAGTCCTGTGATTGATGG - Intergenic