ID: 964687800

View in Genome Browser
Species Human (GRCh38)
Location 3:159416849-159416871
Sequence TACCTGAGGCTGCATCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964687800 Original CRISPR TACCTGAGGCTGCATCAGAC AGG Intronic
900580261 1:3405244-3405266 GAACTGAGGCTGCGTGAGACAGG - Intronic
901060142 1:6468096-6468118 TACCTGGGGCTGGAACAGCCAGG + Exonic
906368925 1:45235812-45235834 CATCTGAGGCTTCATCAGCCTGG - Intronic
906727614 1:48055361-48055383 TACCAGATGCTGCTTCTGACTGG - Intergenic
909355759 1:74708079-74708101 GACCTGAGGCTGAGTCAGTCTGG + Intronic
911237087 1:95423157-95423179 TCTCTGAGGCTGGATCAGGCAGG + Intergenic
918322915 1:183382103-183382125 TTCCTGAGGCTTCCTCAGTCAGG - Intronic
922212375 1:223495940-223495962 TACCTGAGGCTGGAGGAGTCTGG - Intergenic
1063157809 10:3396293-3396315 AACCTGAGCCTGCTGCAGACAGG + Intergenic
1067364384 10:45611521-45611543 TACCTAAGACTTCACCAGACGGG - Intergenic
1069788030 10:71002070-71002092 TATCTGAGACTTCATCAGAATGG + Intergenic
1071934259 10:90509298-90509320 CATCTGAGGCTTCATCAGCCTGG + Intergenic
1071940988 10:90591745-90591767 TACCTAAGTATGCAACAGACAGG - Intergenic
1074484414 10:113859933-113859955 TACCTGAAGCTTCCTCAGCCAGG - Intronic
1074737539 10:116452046-116452068 TATCTGAGACTTCATCAGCCTGG - Intronic
1076485852 10:130816526-130816548 TTCCTGAGGCTGAATTACACCGG + Intergenic
1078088713 11:8250726-8250748 CAGCAGAGGCTGCATCCGACTGG - Intronic
1078182469 11:9023910-9023932 CACATGAGGCTGCTACAGACGGG - Intronic
1083384529 11:62297718-62297740 TCCCTGAGGTTACACCAGACAGG + Intronic
1085265211 11:75233818-75233840 TGCCAGTGACTGCATCAGACTGG - Intergenic
1085753606 11:79185455-79185477 TATCTGAGGCAGCATCCAACAGG + Intronic
1092725690 12:11483535-11483557 TACCTAACTCTGCATCAGACAGG - Intronic
1094357655 12:29595527-29595549 GACCTGGGACTGCACCAGACTGG - Intronic
1099779996 12:87182502-87182524 CATCTGAGACTGCCTCAGACTGG - Intergenic
1101732537 12:107438509-107438531 CTCCTGAGGCTGCAGCACACAGG - Intronic
1106708124 13:32303058-32303080 GACATGAGGCTGCAGAAGACAGG - Intergenic
1110369103 13:74719922-74719944 TACATGGAGCTGCATCAAACTGG + Intergenic
1110902038 13:80836230-80836252 TACCTGAGACTACCTGAGACTGG + Intergenic
1111044711 13:82799419-82799441 CTCCTGAGGCTGTATCACACAGG - Intergenic
1111578654 13:90193009-90193031 CACCTGAGACTGCTTGAGACTGG - Intergenic
1113615018 13:111674207-111674229 CCCCTGAGGCTGGACCAGACAGG + Intergenic
1114255676 14:20999542-20999564 TACCTCTGGCTGCATCAATCTGG - Exonic
1117483729 14:56173284-56173306 TACCTGTGGCTGCATCACTTGGG + Intronic
1119903910 14:78284459-78284481 TTCCTGAGGCTGTGTCAGAGTGG + Intronic
1121054701 14:90843117-90843139 TTCCTAAGGCTGCAGAAGACTGG - Intergenic
1121127717 14:91418321-91418343 TACCTGGGGCTGCACCTGCCAGG - Intergenic
1123630073 15:22255052-22255074 TACCAGAGGCTGCAAGAGACAGG - Intergenic
1124060373 15:26288466-26288488 TATCAGAGGCTGCATAATACAGG - Intergenic
1124134985 15:27027394-27027416 TGCTTGAGGCTGCAATAGACAGG - Intronic
1124716889 15:32072093-32072115 TATCTGAGACTTCATCAGCCTGG - Intronic
1126859987 15:52874055-52874077 GACTTGGTGCTGCATCAGACTGG + Intergenic
1127239026 15:57090308-57090330 TAAATGTGGCTGTATCAGACAGG + Intronic
1127397726 15:58555968-58555990 TCCCTTAGGCTGCATCTGCCGGG - Intronic
1130011105 15:80153434-80153456 TACCGGAAGCTGCAGCACACAGG + Intronic
1130446769 15:84009333-84009355 TACCATAGGCTTCATCAGACTGG - Intronic
1132579369 16:678058-678080 TACCTGAGGCTGCACAGGCCAGG + Exonic
1132907429 16:2290036-2290058 CAACTGAGGCTGCAGCAGGCAGG + Intronic
1135701501 16:24636965-24636987 TACCTGGGGCCCCATCAGATTGG + Intergenic
1136500260 16:30666556-30666578 GACCTCAGGCTGCATGAGGCTGG + Intronic
1138676388 16:58654514-58654536 TCCCTGAGGCTGAATTAGAGGGG + Intergenic
1140696048 16:77535407-77535429 TACATGAGGCTGCTACAAACAGG + Intergenic
1141973018 16:87495605-87495627 TACCAGAGGCTGCAAGAGACAGG + Intergenic
1142427136 16:90007201-90007223 CACCTGGGGCTGCAGCAGCCTGG + Intronic
1143023027 17:3926377-3926399 TACCTGCGGCTCCATCTGAGGGG - Intronic
1143978062 17:10844899-10844921 TGTGTGAGGCTGCAGCAGACAGG - Intergenic
1151032662 17:70759066-70759088 TATCTGAAACTCCATCAGACTGG + Intergenic
1152639426 17:81443500-81443522 TGCCGTAGGCTGCCTCAGACCGG - Exonic
1155851629 18:30781979-30782001 TACCTGAGGCTACTTCAGCTTGG - Intergenic
1159962511 18:74566626-74566648 TACCTGAGGCCACCTCAGCCTGG + Intronic
1160106452 18:75982724-75982746 TGCCTCACGCTGCACCAGACAGG - Intergenic
1161303639 19:3555533-3555555 TACCTGAGGCGGCGGCAGACAGG - Intronic
1163175389 19:15561073-15561095 GACCTGAAGCTGGATCAGGCAGG + Intergenic
1163512167 19:17741771-17741793 CACCTCAGGGTGCATCTGACTGG - Intergenic
1168085234 19:54041011-54041033 TGTCTGAAGCTGCCTCAGACAGG + Exonic
1168380034 19:55912497-55912519 CACCTTCGGCTGCTTCAGACAGG + Exonic
927125799 2:20011965-20011987 GTCCTCAGGCTGCCTCAGACTGG - Intronic
928486690 2:31739425-31739447 TACCAGACACTGCATCAGTCAGG + Intergenic
929195481 2:39180362-39180384 TGCCTGAGGCTGCCCCAGCCGGG + Intronic
930051208 2:47217604-47217626 AACCAGTGGCTGCATCAGGCAGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933794022 2:85905949-85905971 GGCATGAGGCTGCATCAGCCAGG - Intergenic
934843237 2:97644985-97645007 TACCGTAGCCTGCATGAGACAGG + Intergenic
935205812 2:100895734-100895756 TACCTGTGGCTGCTGCAAACAGG - Intronic
937007896 2:118534975-118534997 AACTTGAGCCTGCATTAGACAGG + Intergenic
945484682 2:210381478-210381500 TACCTGAGACTACCTCAGTCTGG - Intergenic
947912824 2:233812530-233812552 TACTTTAAGCTGCATCAAACAGG + Intronic
949039426 2:241840720-241840742 GACCTGAGGCTGCACCAGGCAGG - Intergenic
1170100698 20:12696216-12696238 TACATTAGGCTTCATCCGACAGG + Intergenic
1170810142 20:19667868-19667890 TGCCCGAGGCTGCAGCAGAAGGG + Intronic
1171177528 20:23064031-23064053 TACCAGAAGCTGCATGATACCGG - Intergenic
1174012457 20:47461321-47461343 TAACTGAGGATGCATCGGAGAGG + Intergenic
1174306385 20:49616897-49616919 AAACTGAGGCTGCACAAGACAGG - Intergenic
1174417448 20:50376913-50376935 CCCCTGCGGCTGCATCTGACAGG - Intergenic
1180036706 21:45253961-45253983 GACCGGGGGCTGCACCAGACCGG - Intergenic
1182459905 22:30476192-30476214 TACCTGAGCCTGGCTCAGCCTGG - Intergenic
1183026308 22:35068088-35068110 AACCTGAGGCTGCAGTGGACAGG - Intronic
949681669 3:6520820-6520842 CACCTGAGGCCTCATCAGAATGG + Intergenic
950003492 3:9676059-9676081 TCCCTGAGGTGGCCTCAGACAGG + Intronic
950504621 3:13386952-13386974 TACCTAAGGGTGCACTAGACAGG - Intronic
951523042 3:23627012-23627034 TGCCTGAGACTTCATCAGAGTGG + Intergenic
954619230 3:51986235-51986257 TACCTGAGGGGGCATAAGCCAGG - Exonic
956884902 3:73549396-73549418 AACCTAAGCCTGCAGCAGACAGG - Intronic
957018817 3:75101000-75101022 TTCCTGAGGCTGCCCCAGTCAGG + Intergenic
960950930 3:122997969-122997991 TGCCTGAGGTTGCATCAAGCTGG - Intronic
962432715 3:135334955-135334977 TAGAGGAGGCTGCTTCAGACAGG - Intergenic
962720235 3:138167078-138167100 TACCTGATGCTGCATCAAGGCGG + Exonic
962906852 3:139811543-139811565 TAACTGAGGCTGGATTAAACAGG - Intergenic
964687800 3:159416849-159416871 TACCTGAGGCTGCATCAGACAGG + Intronic
965790282 3:172379909-172379931 TACCTGATCATGCATCAGAGTGG - Intronic
968967518 4:3776574-3776596 CACCTGAGGCTGGGTCAGCCTGG - Intergenic
970499281 4:16660877-16660899 GGCCTGAGGCTGAATTAGACTGG - Intronic
971022873 4:22556231-22556253 TCCCTGAGACCTCATCAGACTGG - Intergenic
971688221 4:29798921-29798943 TACCTGAGGCTGCAGGAGCATGG - Intergenic
972752946 4:42011019-42011041 TACCTGAGGCTGTGTCTTACAGG + Intronic
974202145 4:58656114-58656136 TACCTGAGACCCCCTCAGACTGG - Intergenic
974973886 4:68866064-68866086 TTCCTGAGGCCTCCTCAGACAGG + Intergenic
975544772 4:75549400-75549422 TACCTGAGGCTGAGTGAGTCAGG - Intronic
976868035 4:89754681-89754703 GCACTGAGGCTGAATCAGACGGG + Intronic
985809457 5:2072416-2072438 CATCTGAGGCTTCATCAGCCTGG - Intergenic
987492167 5:18594926-18594948 TATCTAAGGCTGCATCAGCCTGG + Intergenic
987584939 5:19842829-19842851 TATCTGAGACTGCCTCAGCCTGG - Intronic
993299089 5:86184267-86184289 CACCTGAGGCTGTATCAGGAAGG + Intergenic
995135344 5:108674211-108674233 CACCTGAGACTTCATCAGAATGG + Intergenic
996889755 5:128404686-128404708 TCCATGAAGCTGCATAAGACAGG + Intronic
997628619 5:135349110-135349132 TTCCTCAGGCTGCAGCAGGCAGG + Intronic
999426697 5:151493778-151493800 CTCTTGAGGCTGCAACAGACAGG - Intergenic
1001927765 5:175651197-175651219 TAACTGAGGCTTCATCAGCCTGG + Intergenic
1003462338 6:6341653-6341675 AACCTGAGGCTCCATCAGGTAGG - Intergenic
1014782996 6:125586402-125586424 TACCTGAGACTGGTTCAGAAGGG - Intergenic
1015415135 6:132939660-132939682 TATCTGAGACTTCATCAGCCTGG - Intergenic
1020736141 7:11950863-11950885 TACATGAGGCTGCTACACACTGG - Intergenic
1022342301 7:29479975-29479997 TGCCGGAGGCTGCTGCAGACAGG + Intronic
1022806102 7:33824121-33824143 CTCCTGAGGCTGCATCATCCAGG + Intergenic
1025729846 7:64099870-64099892 TGCAAGAGGCTGCATCCGACAGG + Intronic
1025929513 7:65982591-65982613 TGCAAGAGGCTGCATCAGACAGG - Intergenic
1033286967 7:140049630-140049652 TTCCTGAGGAAGCATCAGCCTGG - Intronic
1034462770 7:151207202-151207224 AAGCAGAGGCTGCATGAGACAGG + Intergenic
1035530838 8:349805-349827 TGCCTGAGGCTGGATGGGACAGG + Intergenic
1035790633 8:2301257-2301279 TTCCTGAGGCTTCCTCAGGCAGG - Intergenic
1035802172 8:2420448-2420470 TTCCTGAGGCTTCCTCAGGCAGG + Intergenic
1037403536 8:18517914-18517936 TTCCTGAGGCCTCCTCAGACAGG - Intergenic
1037762679 8:21752341-21752363 TTCCTGAGCATCCATCAGACAGG - Intronic
1045348361 8:101315471-101315493 GTCCTGAGGCTCCATCAGCCAGG + Intergenic
1048705826 8:137152342-137152364 TACTAGAGGCTGCATGAGACAGG + Intergenic
1055774531 9:79753189-79753211 TACCTGAGACCACATCAGCCTGG + Intergenic
1056523076 9:87418065-87418087 TACCTGAGGCTGAGACAGAAGGG + Intergenic
1056724631 9:89103881-89103903 TACCAGAGGCTGCCTCTGTCAGG + Intronic
1057293531 9:93822149-93822171 TACCTGACCCTGGATCAGATGGG - Intergenic
1057904962 9:98976271-98976293 TTCCTGGGGCTGCATCTGACCGG - Intronic
1059956547 9:119521905-119521927 TATGTGAGGCTGCTTCAGTCTGG - Intronic
1061022198 9:128023144-128023166 TAGCAGAGGCTCCATCAGCCAGG + Intergenic
1188782023 X:34297133-34297155 TTCCTGTGGCTGCACCAAACTGG - Intergenic
1190154425 X:47976651-47976673 TACCTCATGCTGCATCAGAGAGG - Exonic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1197931208 X:131698157-131698179 CACCTGAGACTTCATCAGAATGG - Intergenic
1198873657 X:141201228-141201250 TACCTGAGGCCTCTTCAGACTGG - Intergenic
1199435687 X:147810106-147810128 TTCCTGAGGCTTCCTCAGCCAGG + Intergenic
1200294328 X:154902950-154902972 AACTTGAGCCTGCATCAGGCTGG - Intronic