ID: 964690554

View in Genome Browser
Species Human (GRCh38)
Location 3:159444879-159444901
Sequence ACCTGATGTTGAGGGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 249}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964690554 Original CRISPR ACCTGATGTTGAGGGAGTGA AGG Intronic
901249505 1:7765315-7765337 ACCTGATGTAGATGGGGTGCTGG - Intronic
901671717 1:10860096-10860118 ACCTGAGGGTGGGGGAGTGTGGG - Intergenic
901790957 1:11653619-11653641 ACCTGATGAGGAAAGAGTGAGGG + Intronic
901929495 1:12587926-12587948 TCCTGTTGTTGAGTGAGTGAGGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904905631 1:33895506-33895528 ACCTTATATTGAGGGAATCATGG + Intronic
905062568 1:35152351-35152373 CCTTGATGTTGAAGGAGTGAGGG + Intergenic
907483693 1:54762031-54762053 ACCTAATGTTGAGGCAGTAAGGG - Intronic
907596532 1:55725500-55725522 ACCTGATCTGGAGAGAGAGAGGG - Intergenic
908652219 1:66347124-66347146 ACATGAAGTAGAGGGAGTGCTGG - Intronic
909089644 1:71209230-71209252 CCCTGAAGGTGAGGGAGTGCAGG - Intergenic
910546571 1:88425404-88425426 GCCTGGAGTTGTGGGAGTGATGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912926323 1:113916346-113916368 GCCTGCTGTTTAGGGAGTCAGGG + Intergenic
913177795 1:116291065-116291087 AGCTGATGTTTATGGATTGAAGG - Intergenic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916595233 1:166236486-166236508 AGCTGATGTTGTGTGGGTGATGG + Intergenic
917623602 1:176823334-176823356 AGCTGATCTTGAGGGAGATAAGG + Intronic
917970582 1:180204095-180204117 ACCTAGTGTTGCTGGAGTGAGGG + Intergenic
918058284 1:181041571-181041593 GGCTGGAGTTGAGGGAGTGAGGG - Intronic
919422803 1:197391764-197391786 AGCTGATGGTGAGTTAGTGAAGG + Intronic
919478149 1:198054448-198054470 GCCTGGGGTTGAGGGAGGGATGG + Intergenic
921948286 1:220904122-220904144 AGCTGAGGTTGAGGCAGAGAAGG + Intergenic
923307819 1:232704243-232704265 ACCTGACCTTGAGAGAGTGGGGG + Intergenic
923350239 1:233097652-233097674 ACCTCAGGTTGACAGAGTGACGG - Intronic
1063193977 10:3722961-3722983 ATCTAATGGTGAGAGAGTGAGGG + Intergenic
1063994688 10:11608599-11608621 ACTTGGTTTTGAGGGAGTCAGGG - Intronic
1064377536 10:14810433-14810455 ACCTCATGGTGGGGGAGGGAGGG + Intergenic
1068389132 10:56370462-56370484 TCCTAATGTTAAGGGAGTGCTGG - Intergenic
1075319991 10:121483779-121483801 ACATGATGATGAGGGACTGTTGG - Exonic
1076453480 10:130573266-130573288 AACTGATGTTTAGGGAGGGTAGG - Intergenic
1078908577 11:15710260-15710282 ACCTGATGTTTGGGGACTGCAGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1083433191 11:62625573-62625595 ACAGGATGTTGGGGGAATGAAGG + Exonic
1084679187 11:70656139-70656161 GCCCCATGTTGTGGGAGTGAAGG + Intronic
1085147251 11:74212541-74212563 ACCTGAGGTTGGGGGAGAGGTGG - Intronic
1087976672 11:104557597-104557619 ACCCGAGGTTGGGGGAGGGAGGG + Intergenic
1088436155 11:109815375-109815397 ACCTGATGTTGAAGGACACAGGG - Intergenic
1089931948 11:122321684-122321706 ACCTGAGGCTGATGGAATGAAGG - Intergenic
1092006003 12:5071084-5071106 ACCTGAAGTTAAGGGAGTTCAGG + Intergenic
1093233160 12:16573919-16573941 ACTTGATGTAGATAGAGTGAGGG - Intronic
1093629511 12:21391847-21391869 ACCTGATGTAGTGGGAGGGAAGG - Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096113729 12:49043163-49043185 ACCTGAGGATGGGGGCGTGAAGG - Exonic
1096124099 12:49107129-49107151 GCCTTATCTTGAGGAAGTGATGG - Intronic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1099829427 12:87821739-87821761 ACCAGAAATTGAGGCAGTGAAGG + Intergenic
1100292549 12:93231631-93231653 ACGTGAGGGTGAGGGAGGGAAGG - Intergenic
1101899144 12:108778306-108778328 AACAGATGCTGAGAGAGTGAGGG - Intergenic
1103783626 12:123415920-123415942 ACCTGGTGTGGAGAGAGAGAGGG + Exonic
1105601495 13:21892294-21892316 GCCTGATGAGGAAGGAGTGAGGG - Intergenic
1105622311 13:22080284-22080306 GCCTGATGTGGAGGGAGAAACGG + Intergenic
1106534151 13:30624083-30624105 ATCTGAAGTGGAGGGAGTCATGG + Intronic
1107382224 13:39869041-39869063 AGATGATGTGGAAGGAGTGAGGG + Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108708230 13:53009180-53009202 AGTTGATGTTGATGGATTGAGGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109787615 13:67200765-67200787 ACCTGGGGTTGGGAGAGTGAGGG + Intronic
1110462154 13:75757040-75757062 ACAGGATGTTGAGGAAATGATGG + Intronic
1112392405 13:98997618-98997640 GTCTGATGTGGATGGAGTGAGGG - Intronic
1113002210 13:105654178-105654200 ACCTGATAATGAAGGAGAGAAGG - Intergenic
1115632613 14:35260406-35260428 TCCTTATGTTGAGGGAGTACTGG - Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116763310 14:49040864-49040886 ATGTGAAGTTTAGGGAGTGAAGG - Intergenic
1117015460 14:51513023-51513045 TCCTAATTTTGAGAGAGTGAGGG - Intronic
1119717722 14:76870544-76870566 AACAGATGCTGAGGGAATGAGGG + Intergenic
1119739281 14:77003726-77003748 CCCTGTTGTTTAGGGAATGAAGG + Intergenic
1120014754 14:79459023-79459045 ACCTGATGATGATGGAAAGAAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1120951937 14:90049603-90049625 CCCTGATGGGGAGGGAGGGAGGG + Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1126370351 15:47939308-47939330 AACTGATGATGCAGGAGTGAAGG + Intergenic
1127975282 15:63992633-63992655 ACCTGATAGGGAGGGAGTGAAGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129498871 15:76016596-76016618 ACCTGCTCTTGAGTGACTGATGG - Intronic
1130412372 15:83657769-83657791 GCCTGATCTTCAGGGAGTGTGGG + Intronic
1132796457 16:1726023-1726045 ACCTGCTGTTGAGGTAGCTAGGG - Intronic
1134334847 16:13288923-13288945 ACATGAAAGTGAGGGAGTGAAGG + Intergenic
1135561382 16:23479439-23479461 ACCTGCTGCTGAGGGAATCAGGG - Intronic
1136283118 16:29225809-29225831 GTCTGATGTTCAGGGAATGAAGG - Intergenic
1137568762 16:49551045-49551067 ACCTGATGATAAGGGAGAGTGGG - Intronic
1137663106 16:50226889-50226911 ACCAGAGGTTAAGGGAGGGAAGG - Intronic
1139963274 16:70730090-70730112 GACTGATGTGGAGAGAGTGAGGG - Intronic
1141743338 16:85909082-85909104 CCCAGATTTTGAGGAAGTGACGG + Exonic
1141893996 16:86946974-86946996 ACCTGATGGTGTGGGGGAGAGGG - Intergenic
1142671681 17:1490643-1490665 ACCTCATGTTCATAGAGTGAAGG + Intronic
1142733583 17:1879933-1879955 TCCTGGAGTTGAGGGAGGGAGGG + Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146555726 17:33822059-33822081 AGCTGACGTTTAGAGAGTGAAGG - Intronic
1149077012 17:52607654-52607676 CCCACATGTTGAGGGAGGGAGGG + Intergenic
1149180689 17:53932520-53932542 TCCTGGTGTTGAGGGAGGGGTGG + Intergenic
1149241112 17:54650841-54650863 AGCTGATGTGGAGGTAGGGATGG - Intergenic
1149344836 17:55724350-55724372 CCCTGAGGTTGGGGGAGTCATGG + Intronic
1150021311 17:61616172-61616194 ACCTGAAGTGGAGGCAATGAAGG + Intergenic
1150301786 17:64053269-64053291 CACCGATGTTGAGGGAGTGGAGG + Exonic
1151324852 17:73373027-73373049 GCCAGAGGCTGAGGGAGTGAGGG - Intronic
1151353141 17:73543269-73543291 CCCTGGGGTTGAGGCAGTGATGG + Intronic
1151628789 17:75295628-75295650 ACCTGACCTTGAGGGACTGCAGG - Intergenic
1152145541 17:78566489-78566511 AGCTGATGTCCAGGGAGGGAGGG - Intronic
1153187718 18:2503214-2503236 ATATGATGTTGAGGCAGAGAAGG - Intergenic
1153948026 18:10033784-10033806 ACCTGCAGTAGAAGGAGTGAAGG - Intergenic
1155233159 18:23793829-23793851 AACTGATGGTGAGGGAAGGAGGG - Intronic
1157324561 18:46659238-46659260 ACCTGGTGGTGAGCGGGTGATGG + Intergenic
1157475675 18:48021997-48022019 ACTTGCTGCTGAGGGAGAGAGGG + Intergenic
1159051663 18:63426199-63426221 ATCTGATTTTGACGGAGTGCAGG + Intergenic
1162876637 19:13625617-13625639 ACATGATGTTGAGTGAAAGAAGG + Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163526342 19:17823859-17823881 ATCTGAGGTTGAGAGAGGGAAGG + Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164712408 19:30366877-30366899 ATCTGAAGCTGAGGGACTGAGGG + Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1167001867 19:46750280-46750302 ACCTGCTGGTGAGGGTGTGAGGG - Intronic
1168132866 19:54332187-54332209 GCCTGACGTTGTGGGGGTGAGGG + Intergenic
1168403010 19:56096939-56096961 TCCCGATGTTGAGAGGGTGAGGG - Intronic
926745273 2:16151748-16151770 AGCTGATGTAGAGGTTGTGAGGG + Intergenic
929731331 2:44496336-44496358 AGCTGTTGTCTAGGGAGTGAAGG + Intronic
930277874 2:49334649-49334671 ACTTGATGTTTAGAGAGTGGTGG - Intergenic
930686351 2:54312596-54312618 AACTGATGATGGAGGAGTGATGG - Intergenic
932356434 2:71071820-71071842 ACCGGATGGTGAGGAAGTGGAGG + Exonic
933083890 2:78030079-78030101 TCCTTATGTTGTGGGAGTGCTGG + Intergenic
933606888 2:84392553-84392575 ACCTGGGGTTAAGGGAGAGAAGG - Intergenic
934718116 2:96554834-96554856 ACCTGAGGTTGAGGGGAGGAGGG + Intergenic
937024787 2:118689149-118689171 AGCTGCTGTTGAAGGAATGAAGG + Intergenic
937628283 2:124068646-124068668 ACCTGGTGTTGAAGGAGGGGTGG - Intronic
938936000 2:136127916-136127938 ACTTGGTGTTAAGGGAGTAATGG + Intergenic
940024800 2:149194631-149194653 ACCTGATGGGGAGGGAGTCAGGG + Intronic
940381516 2:153019754-153019776 AGCTCATATTGGGGGAGTGAGGG + Intergenic
941708721 2:168688639-168688661 ACCTGACGTTGTCAGAGTGAGGG + Intronic
945310659 2:208308589-208308611 ACCAGAGGTTGAGGGAGTGAAGG - Intronic
946532531 2:220587597-220587619 ACCAGATCTTGAGTGATTGAAGG + Intergenic
946890716 2:224273471-224273493 AACTGTTGTTGAGGGAATGAAGG - Intergenic
948549116 2:238756519-238756541 TCCTGATGTTCTTGGAGTGAGGG + Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948755941 2:240159591-240159613 CCCTGGTGCTGAGGGACTGAGGG - Intergenic
1169597234 20:7214219-7214241 ACCTGAGGTTGGGGGAGGGGTGG - Intergenic
1171199339 20:23228450-23228472 ACATGGTGTTGGGGGAGTGAGGG - Intergenic
1172790832 20:37504364-37504386 AGAGCATGTTGAGGGAGTGATGG - Intronic
1173121431 20:40293345-40293367 AACTGAGGAAGAGGGAGTGATGG + Intergenic
1173158545 20:40635528-40635550 ACTTGAGGTTCAGGGAGTGTGGG - Intergenic
1173503632 20:43570703-43570725 AAATGATGTTGAGGGAGTGCAGG - Exonic
1173650698 20:44662391-44662413 AGCTGGGGTTGAGGGGGTGAGGG - Intergenic
1174729244 20:52898644-52898666 ACCTGATGTGATGGCAGTGACGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175048068 20:56125998-56126020 ACTTCAAGGTGAGGGAGTGATGG - Intergenic
1175062701 20:56258092-56258114 ACCTGAGGCTTAAGGAGTGAGGG + Intergenic
1175285691 20:57835251-57835273 AACTGAGGCTGAGGGACTGAGGG + Intergenic
1179398165 21:41060155-41060177 ACCTGATGTCAAGGGAGGCAAGG - Intergenic
1180791213 22:18576717-18576739 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1180798378 22:18619239-18619261 AGCTGAAGGAGAGGGAGTGAGGG + Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1181120513 22:20664758-20664780 GCCTGGGGTTGAGGGAGGGATGG + Intergenic
1181223340 22:21376026-21376048 AGCTGAAGGAGAGGGAGTGAGGG - Intergenic
1181230525 22:21418597-21418619 TCCTGCTGTTGGGGGAGTGGGGG - Intronic
1181248125 22:21516272-21516294 TCCTGCTGTTGGGGGAGTGGGGG + Intergenic
1181255400 22:21559600-21559622 AGCTGAAGGAGAGGGAGTGAGGG + Intronic
1181986097 22:26800784-26800806 AGCTGATGGGGAGGGAGAGAAGG + Intergenic
1182130898 22:27849847-27849869 ATGTGATCTTGAGGGAGTGGGGG + Intergenic
1182984009 22:34699445-34699467 GCCTGAAGTGAAGGGAGTGAAGG - Intergenic
1184929173 22:47668018-47668040 ACCTGATGTTGAGGGTGCTGAGG + Intergenic
1184929848 22:47672928-47672950 AGCTGAAGTTGAGGCAGTGACGG + Intergenic
950127313 3:10517870-10517892 CCCTGTCGTTGAGGGAGCGATGG + Intronic
950257760 3:11520014-11520036 TGCTGATGTTGCAGGAGTGAGGG + Intronic
950348035 3:12316934-12316956 AACTGATGGTGAGGGAGAAAAGG + Intronic
952811962 3:37411984-37412006 ACCTGTGGTTGAGGGAGGGTTGG + Intronic
954984723 3:54779580-54779602 AGCTGATGTTCTGAGAGTGAGGG - Intronic
956222861 3:66922918-66922940 GCCTAGTGTTGAGGGAGAGATGG - Intergenic
957467514 3:80613511-80613533 ACCTGGTGAAGAGGGACTGATGG + Intergenic
957673513 3:83336924-83336946 ACATAATCTTGAGGTAGTGATGG - Intergenic
959962313 3:112312426-112312448 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
961592119 3:127988863-127988885 AAGTGATGTTGAGGAAGAGATGG + Intergenic
961596437 3:128021861-128021883 ACCTCATGTATAGGGAGTAAGGG - Intergenic
962198663 3:133383900-133383922 AGCTGATGTGGAGGCAGTCAGGG - Intronic
962588036 3:136862044-136862066 GCCTGATGTGGAGGGAGCGGAGG - Intergenic
963259592 3:143178666-143178688 ATTTGATGTGGAGGCAGTGAAGG + Intergenic
964690554 3:159444879-159444901 ACCTGATGTTGAGGGAGTGAAGG + Intronic
966236155 3:177704075-177704097 ACATGATGTGGAGGAAGGGATGG - Intergenic
968373041 4:12387-12409 ACCTCTTGTTCAGGGTGTGAGGG + Intergenic
969833980 4:9823910-9823932 TGCTTATGTTGGGGGAGTGAAGG + Intronic
969928699 4:10609893-10609915 ACCAGATGCTGAGAGAGAGAAGG + Intronic
969999413 4:11349618-11349640 ACCTTATGTTTGGGGAGTGGAGG + Intergenic
970278648 4:14429530-14429552 CCCTGATGTTTAGGTAGTTATGG + Intergenic
971025465 4:22585050-22585072 ACCAGATGTTGGGGGTGGGAGGG - Intergenic
971231979 4:24807441-24807463 ACATTCTGTTGAAGGAGTGAAGG + Exonic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
975544771 4:75549399-75549421 ACCTGAGGCTGAGTGAGTCAGGG - Intronic
976212016 4:82681039-82681061 ACTTGAGGTTGAGGGACTGTGGG - Intronic
977277958 4:95002129-95002151 ACCAGAGGTGGAGGGAGGGAAGG - Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
982166437 4:152617735-152617757 CCCTGATGCTGTGGGAGTGTGGG + Intergenic
982683444 4:158459596-158459618 ACCTGGGGTTGGGGGAGGGATGG + Intronic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983566028 4:169152834-169152856 ACATGATGTTGAGGAAGAAAAGG + Intronic
985462354 4:190120180-190120202 ACCTCTTGTTCAGGGTGTGAGGG - Intergenic
985714051 5:1445856-1445878 CCCTGATGGGGAGGGAGGGAAGG - Intergenic
986893617 5:12338956-12338978 AGCTGATGTTGGGGTAGGGAAGG + Intergenic
987959700 5:24790294-24790316 AGCTCATGTTGAGGATGTGATGG + Intergenic
988410055 5:30875485-30875507 ACCTGATGGAGAGGTGGTGAAGG + Intergenic
988708558 5:33750495-33750517 AACAGATGATGAGGCAGTGAGGG - Intronic
989666500 5:43859991-43860013 ACCTGAAGTGGAGGGATTGTGGG + Intergenic
990896053 5:60700939-60700961 ACAAGACGTTGAAGGAGTGAAGG + Intergenic
991107524 5:62861393-62861415 GCCTGGGGTTGAGGGAGAGATGG + Intergenic
991569179 5:68036410-68036432 CCCTGATGATGAGAGAGAGAGGG + Intergenic
994436988 5:99748823-99748845 ACCTGACATTGAGGGAGGGGTGG + Intergenic
996583472 5:125057792-125057814 ACCTAATGAAGAGGGAGGGATGG + Intergenic
996931703 5:128896619-128896641 ACCTGGTGTTGGGGAAGGGATGG + Intronic
997226209 5:132211208-132211230 ATCTGCTGTAGAGGGAGTGCTGG + Intronic
997733933 5:136199835-136199857 ACCTGGTGTTTGGGGAGGGATGG - Intergenic
998014443 5:138721137-138721159 ACATGTTGTTGGGGGAGTGGGGG + Intronic
998167516 5:139852685-139852707 ACTTGATGTTGGGGCAGCGATGG + Intronic
999514129 5:152283955-152283977 ACCTTGTGTTGAGAGATTGAGGG + Intergenic
1001401496 5:171449027-171449049 GCCTGATTTTGGGGGAGTGAGGG + Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003373880 6:5556043-5556065 ATCTGAAGTTGTGGGAGTGGTGG - Intronic
1005849770 6:29812874-29812896 TGCTGATGTTGATGGAGTCACGG - Intergenic
1005854778 6:29852669-29852691 GGCTGATGTTGATGGAGTCACGG - Intergenic
1006048410 6:31319424-31319446 ACCTCTTGATGAGGGAGTGGTGG - Intronic
1006060468 6:31414810-31414832 GGCTGATGTTGATGGAGTGATGG + Intronic
1006072911 6:31509582-31509604 GGCTGATGTTGATGGAGTGATGG + Intronic
1006186675 6:32185314-32185336 ATTTGATGTGGAGGCAGTGAAGG - Exonic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1010208142 6:73341446-73341468 AACTGAAGTTGAGGAAGTTAAGG - Intergenic
1012932723 6:105333738-105333760 ACCAGATCTTGTGGGGGTGATGG - Intronic
1014696170 6:124623805-124623827 TCCTGATGTAGAAGGAGAGATGG + Intronic
1015558207 6:134484471-134484493 ACATGATGTTGGGGGATTAAAGG + Intergenic
1017003997 6:150016364-150016386 ACTTGCTGTGGAGGGAGTCAGGG - Intergenic
1017327618 6:153158232-153158254 ACATGCAGTTGAAGGAGTGAAGG - Intergenic
1019075308 6:169382454-169382476 ACCAGATGTGGTGGGAGTGAGGG + Intergenic
1019981057 7:4622536-4622558 CCCAGGTGTTGAGGGAGGGAGGG + Intergenic
1020041088 7:5002246-5002268 ACTTGCTGTGGTGGGAGTGAAGG - Intronic
1022845749 7:34208162-34208184 ACCCGGTGTTGTGGGACTGAGGG - Intergenic
1023200210 7:37688631-37688653 ACCTGAAATTGTGGAAGTGAAGG - Intronic
1024226620 7:47330495-47330517 TCCTGAGGCTGAGGGAGGGAGGG + Intronic
1024564275 7:50668660-50668682 ATCTGATGTTTATGGAGTGAGGG - Intronic
1031806129 7:126308504-126308526 ACTTGATGTTGATGGGGAGATGG - Intergenic
1032463493 7:132128772-132128794 GTCTGATGTTTGGGGAGTGAAGG + Exonic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1034759219 7:153655534-153655556 ATCTGATGTTGGGGGAGTTTGGG - Intergenic
1035482573 7:159199080-159199102 AACTGCTGATGAGGGACTGAAGG + Intergenic
1039805901 8:40997934-40997956 ACCTTATGTGGAGGGAGGAAGGG - Intergenic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1041224498 8:55685161-55685183 TCTTGATCATGAGGGAGTGAAGG + Intergenic
1041301318 8:56414838-56414860 AGCAGATATTGAGGGAGGGAGGG - Intergenic
1042403423 8:68376041-68376063 ACATGATGCTGAGGGAGGTAAGG + Intronic
1042797475 8:72680286-72680308 ACCTCAGTTTGAGGGAGTGTGGG + Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045158545 8:99508874-99508896 GCCTTATGTTAAGGGAGTTAAGG + Intronic
1045994849 8:108351259-108351281 GCCTGAGGTTGGGGGAGGGATGG - Intronic
1046883635 8:119338766-119338788 ATTTGATGCTGAGGGAGAGAGGG - Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047834974 8:128679620-128679642 TTCTGATTTTGAGGGAGAGATGG - Intergenic
1050508151 9:6368763-6368785 GCCTGAGGTTGAGGGAGGGGTGG - Intergenic
1050648920 9:7754263-7754285 ACCAGATGTGGAGAGAGTGAAGG - Intergenic
1052677291 9:31643747-31643769 GCCTGGTGTTGAGGCTGTGAGGG - Intergenic
1055886539 9:81069861-81069883 ACCTGGGGTTGGGGGAGGGATGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1059096053 9:111415952-111415974 ACCTGTTGTTGAGGTTGTTAGGG - Intronic
1059485214 9:114621769-114621791 ACATCATGTTCAGGGACTGAAGG + Intronic
1059859929 9:118448460-118448482 ACCTCATGGAGAGGGACTGATGG - Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185635175 X:1547043-1547065 GCCTGATGTTGAGAGAGGAACGG + Intergenic
1185924627 X:4132600-4132622 ACCTGATATTGGGGATGTGATGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1187056969 X:15749848-15749870 CCCTGAGGTGGAGGGAGGGAGGG - Intronic
1187823768 X:23314720-23314742 ACCTGATGGAGAGAGAGAGAGGG - Intergenic
1190535046 X:51417646-51417668 TCCTTACGTTGAGGGAGTGCTGG + Intergenic
1190935041 X:54992215-54992237 GCCTGATGTTGAGGATATGATGG + Intronic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192088567 X:68127813-68127835 ACCTGATGTAGGGGGAATGTGGG - Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193742288 X:85231975-85231997 GCCTGGAGTTGAGGGAGTGGTGG - Intergenic
1195199284 X:102532482-102532504 ACCTGGGGTTGGGGGAGGGATGG - Intergenic
1195741053 X:108064733-108064755 GCCAGATGTTGAGGCTGTGAAGG + Intronic
1197360224 X:125492637-125492659 TCCTTATGTTGAGAGAGTGCTGG - Intergenic
1199376941 X:147123836-147123858 CCCTGATGGGGAGGGAGGGAGGG + Intergenic
1199522384 X:148750454-148750476 ACCTCATGCTGAGGGATGGAAGG - Intronic
1199962872 X:152792095-152792117 ACCTGCAGTTGAGGGAGGGGTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1202032971 Y:20597344-20597366 GCCTGGGGTTGAGGGAGGGATGG - Intergenic