ID: 964691648

View in Genome Browser
Species Human (GRCh38)
Location 3:159456301-159456323
Sequence TCTCTATGTTGAGGGAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964691648 Original CRISPR TCTCTATGTTGAGGGAATGA TGG Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902991531 1:20190909-20190931 TCTTTCTGTTGATGGAAGGAAGG - Exonic
904608487 1:31712167-31712189 TCTCTTTGTGGTGGCAATGAGGG - Intergenic
904641863 1:31937664-31937686 TGTCGATGTTGGGGGAATGTGGG - Intronic
904870350 1:33613795-33613817 TGTCTCTGTTGAAGGGATGAGGG - Intronic
908399257 1:63755033-63755055 CCTATATGTTGAATGAATGAAGG + Intergenic
909146785 1:71944418-71944440 TCCCTAAATTGAGGGAATAAAGG + Intronic
910287406 1:85571060-85571082 TTTCTAAGCTTAGGGAATGAAGG - Intronic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912236874 1:107861803-107861825 TTTCTGTGTAGAGGAAATGAAGG - Intronic
914447285 1:147760632-147760654 TATCTTAGTTGAGTGAATGAAGG + Intronic
915037059 1:152936554-152936576 TCTGTAGGTAGAGGAAATGAGGG + Intergenic
915087925 1:153400609-153400631 TCTTTATGTTGAGTAGATGAAGG - Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
916767922 1:167879862-167879884 GCTATATGTTGATGGAATGAGGG - Intronic
920553749 1:206888361-206888383 TTTCTATGTTGAAGCAATAAAGG + Intergenic
921716316 1:218420465-218420487 TCTCCAGGTTGAAGGGATGAAGG - Intronic
922627611 1:227065363-227065385 TCTCTAACTTGGGGGAATGTAGG - Intronic
922690522 1:227685775-227685797 TCTCAAAGTGGGGGGAATGAGGG + Intergenic
924151611 1:241135561-241135583 ACTCTTTTTTGAGGGAATAATGG + Intronic
1066455012 10:35565183-35565205 TCTACATGTTGATGGAATGCTGG - Intronic
1068410756 10:56651160-56651182 GCTCAATGTTCAGGGAATGAAGG - Intergenic
1069595967 10:69670428-69670450 TCTATATTTTGAGTGAATGGTGG + Intergenic
1069933010 10:71895971-71895993 TCTCTTTGTTTTGGAAATGAAGG + Intergenic
1071016558 10:81004189-81004211 TCTCCATCTTGGGTGAATGAAGG + Intergenic
1071591767 10:86881521-86881543 TCTGTATGTTGTGGGCAGGAGGG - Intronic
1073214380 10:101828568-101828590 TCTCTAGGCTGAGGGAGGGAGGG - Intronic
1073734679 10:106332277-106332299 TGTCCATGTTGAGGGAAAGAGGG + Intergenic
1075926641 10:126256466-126256488 TATCAATGCAGAGGGAATGAAGG - Intronic
1076487137 10:130830417-130830439 TCTCTATGATGCTGTAATGATGG + Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081241684 11:40714197-40714219 ACTCTATGTTGTTGAAATGAAGG - Intronic
1081310791 11:41569230-41569252 TGTGTTTGTTGAGGAAATGAAGG + Intergenic
1081721967 11:45296199-45296221 TCTCCATGTAAAGGGAGTGAAGG - Intergenic
1081877347 11:46418050-46418072 TCTCTAGGTAGAGGAAAAGAGGG + Exonic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083193062 11:61066439-61066461 TCTCTGTGCTGAGGGAAGCAAGG + Intergenic
1086975731 11:93130613-93130635 TTTCTTCATTGAGGGAATGACGG + Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087535316 11:99436831-99436853 TCTCGATGTTGAGTGTATGAAGG - Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1088063651 11:105688733-105688755 CAGCTATGTTGAAGGAATGATGG - Intronic
1088079622 11:105895145-105895167 TCAATTTGCTGAGGGAATGAAGG - Intronic
1088381341 11:109196556-109196578 CCTCTATGTTGAAGGAATTTGGG + Intergenic
1089875896 11:121722195-121722217 TCTCTTTCTTGAGGTAAAGAAGG - Intergenic
1090624555 11:128594642-128594664 TGGCTATGTTGAGGGAGTAAGGG - Intergenic
1091509946 12:1112070-1112092 GCTCTTTGAAGAGGGAATGAGGG + Intronic
1092298335 12:7220525-7220547 GCTCTATGTTCAGGGACTTAGGG + Intergenic
1092511971 12:9166356-9166378 CCTCTCTTTTCAGGGAATGAGGG - Intronic
1092898884 12:13040147-13040169 TCTCTCTGCAGAGGGAGTGAGGG + Intergenic
1092921477 12:13235315-13235337 TTTTTATCTTGAGAGAATGAAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096590363 12:52654904-52654926 TCTCTGTGCTGAGGGGATAAAGG - Intergenic
1096840341 12:54376003-54376025 TATCTGTGTTGGGGGAATGCTGG - Intronic
1096982623 12:55737171-55737193 TCTCTCTCCAGAGGGAATGAAGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097907548 12:64935918-64935940 TCACTGTGGAGAGGGAATGAGGG + Intergenic
1100172630 12:91992955-91992977 CCTCTATGTTGAGGGAGACAAGG + Intronic
1100231637 12:92614556-92614578 TCTGTATTTTAAGGCAATGAAGG - Intergenic
1101915400 12:108892048-108892070 TTTCTATCTTGAGGAAATGATGG + Intronic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1106011633 13:25829756-25829778 TTTCTATGCTCAGGGCATGAGGG + Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1109487355 13:63044527-63044549 TTGTTTTGTTGAGGGAATGAAGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1109997975 13:70154684-70154706 TCTCTTTGTTGAGGGATTGCTGG - Intergenic
1112637513 13:101232071-101232093 TCTCTATGTGAAGGCAAAGATGG - Intronic
1113808895 13:113125748-113125770 AATATGTGTTGAGGGAATGAAGG - Intronic
1116289018 14:43007953-43007975 TCTCTATTATGATGCAATGAGGG + Intergenic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1117334733 14:54747383-54747405 ACTCTAGGTTTAGGGAATGCGGG - Intronic
1118268650 14:64320492-64320514 TCTGTATGATGATGTAATGATGG + Intronic
1118643686 14:67817297-67817319 TCTCTAAGTTGAGTAAATGGAGG + Intergenic
1119234101 14:73005266-73005288 TCCCTTTGATGAGGGAAGGAAGG + Intronic
1119528139 14:75339104-75339126 CCTCTCTATTTAGGGAATGATGG - Intergenic
1119636461 14:76277530-76277552 TATCCATGATGAAGGAATGATGG - Intergenic
1120039962 14:79741222-79741244 TCTATATATTTAAGGAATGAAGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121685604 14:95832847-95832869 ACTCTATTTGGAGGGAAAGAAGG + Intergenic
1121801622 14:96778903-96778925 TCTTTATATTGAGGAAATGGAGG + Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1125109286 15:36012326-36012348 TTTCTGTGTTGAGGGTATGGAGG + Intergenic
1126758831 15:51950451-51950473 TCTCTGGGTTGAGGGGCTGAGGG - Intronic
1127596073 15:60483343-60483365 TCGCTGTGTTGGGGAAATGAAGG + Intergenic
1127627332 15:60793011-60793033 TCTCTCTTTTGAGGGAGTGGTGG - Intronic
1127671970 15:61203994-61204016 TCAGTCTGTTGAAGGAATGAAGG - Intronic
1127774188 15:62252781-62252803 TCTCTAGGCTGAGGGAGTCAGGG - Intergenic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1133442661 16:5833720-5833742 TCTCTCTTTTGAGAGAAAGAAGG + Intergenic
1133676221 16:8075446-8075468 TCTTTATGAAGAGGGAATGTAGG - Intergenic
1134589082 16:15437334-15437356 TCTCTATTTTCAGAAAATGAAGG - Intronic
1134772354 16:16820741-16820763 TCTGTATGTTCAGAGAGTGATGG + Intergenic
1139122663 16:64039501-64039523 TCTCTCAGTTGAGGAAATTAAGG - Intergenic
1139286359 16:65817881-65817903 ACTCTATGTTAAGGGGATCAAGG + Intergenic
1140192601 16:72830709-72830731 TCTAGATGCTGAGGGAAAGAAGG + Intronic
1141777554 16:86134469-86134491 TCACTAGGTTGAGGGGTTGAGGG - Intergenic
1142534457 17:604856-604878 TCCCTTTGTTGAGTGGATGAGGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146611803 17:34312773-34312795 TCTGTATATTTAGGAAATGAGGG + Intergenic
1147601444 17:41748344-41748366 TCGATATGTTGAGGGCCTGAAGG + Intergenic
1149409314 17:56388519-56388541 TAGCTATGTTGAGAGAATAAGGG - Intronic
1150204698 17:63394121-63394143 AATACATGTTGAGGGAATGATGG - Intronic
1150569069 17:66369837-66369859 TCTGCATGTGGAGGGAAGGAAGG - Intronic
1151350110 17:73526869-73526891 CCTCTGTGTTGAGGAATTGAGGG - Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1153992785 18:10414842-10414864 GCTCTATGATGAGGGAATGCTGG - Intergenic
1154228485 18:12530920-12530942 TCTCAACGTGGAGGCAATGATGG + Intronic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155824836 18:30427914-30427936 TCTGTATGTTAAGGAAATGCAGG + Intergenic
1156042482 18:32838076-32838098 TCTCTATGTGGATGAAATGAAGG + Intergenic
1156718031 18:40036061-40036083 TCTTTATGTTGAGTCAATGGTGG - Intergenic
1157357756 18:46951116-46951138 TCTCCGTGTTGAGAGAATGAGGG - Intronic
1157887087 18:51379228-51379250 TATCTCTGGTGAGGGAAAGAGGG - Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159063198 18:63539084-63539106 TCTCTATGAGAAGAGAATGAAGG + Intergenic
1160197199 18:76765510-76765532 TTTTTATGTTGAGAGAATGAAGG - Intergenic
1161634582 19:5379588-5379610 TCTCTAGGATGAGGGAATTTTGG - Intergenic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163489626 19:17609583-17609605 TCTGTCTGGTGAAGGAATGAGGG - Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164721979 19:30439130-30439152 TGTCTGTGTTGAGGGAAGGGTGG - Intronic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1167209072 19:48121880-48121902 TCTCTGTCCTGAGGGAAAGACGG - Intronic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
926417476 2:12663891-12663913 TCTCTCTGCGGAGGAAATGAAGG - Intergenic
926428295 2:12759920-12759942 TTTGTATGTAGAGGGAATGATGG - Intergenic
926753316 2:16216908-16216930 TATCCATCTTGAAGGAATGAAGG - Intergenic
926828450 2:16933741-16933763 TCTCTTTTCTGAGGGAAAGAGGG - Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
928980261 2:37129655-37129677 TGTTTCTGTTGATGGAATGAAGG + Intronic
929590746 2:43144193-43144215 TCTCTTTTTTGATGAAATGATGG - Intergenic
933043107 2:77494922-77494944 TATTTACGTTGAGGGAAAGAAGG - Intronic
934032518 2:88061113-88061135 TCTTTAGGGTGAGGGAATGCTGG + Intergenic
939021017 2:136958602-136958624 TCACTATTTTGAGGGAATTGGGG + Intronic
941622501 2:167793890-167793912 TCCCTATGCGGAGGGCATGAAGG - Intergenic
944136731 2:196407564-196407586 TCTCTGTGTTGGGGAAAGGAAGG - Intronic
945031008 2:205663590-205663612 TCCTTATGGTGAGGGAAGGATGG + Intergenic
945446745 2:209947339-209947361 TCTCTATGTTGCAGGAATATTGG - Intronic
946071414 2:217037339-217037361 TCTCTTGGCTGAGAGAATGATGG - Intergenic
946203809 2:218089234-218089256 TCTCTCTGATGGGGGGATGAAGG - Exonic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175132279 20:56798300-56798322 TGTCTTTGTTTAGGGACTGAAGG + Intergenic
1178602567 21:34007540-34007562 TCTCTATGGTCACAGAATGAAGG - Intergenic
1178629294 21:34245151-34245173 TCTTAATGTTTAGAGAATGAAGG - Intergenic
1178677204 21:34641340-34641362 TTTCTATGTTGAGGGAGTGCTGG - Intergenic
1181044123 22:20206630-20206652 TCTTTATGGTGGGGGAAGGAAGG + Intergenic
1181917642 22:26293196-26293218 TCACTATGTTCAGGGCATGTGGG + Intronic
949726054 3:7046403-7046425 TTTCCATGTTGAAGAAATGATGG - Intronic
951451489 3:22844477-22844499 TCTCTTTCCTGATGGAATGAGGG + Intergenic
952803082 3:37315940-37315962 AATGTGTGTTGAGGGAATGAGGG + Intronic
954519917 3:51215696-51215718 TGTCTATGGAGAGAGAATGAAGG - Intronic
954751867 3:52818373-52818395 TCTCGATGTTGAAGTAGTGAGGG - Exonic
957182879 3:76903682-76903704 TCTTTATTTTGAGGGAACCAGGG + Intronic
958429906 3:94026314-94026336 TCTGTATGTTTAGAGAAAGAGGG + Intronic
958813697 3:98892576-98892598 TCTCTTTGTGGAAGGAATCATGG - Intronic
959685173 3:109137677-109137699 TTTCTATGTTTAGGAATTGAAGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960258709 3:115539830-115539852 TCTCCAAGCTAAGGGAATGATGG - Intergenic
960376321 3:116906234-116906256 TCTCTCTTCAGAGGGAATGATGG - Intronic
962410578 3:135138184-135138206 TGTCTGTGTTGTGGGCATGATGG - Intronic
963202976 3:142602975-142602997 TTTGAATGTTGAGAGAATGAGGG - Intronic
963207342 3:142650424-142650446 TCTCTTTGTTGGAGGCATGATGG + Intronic
963536886 3:146540655-146540677 CTTCTGTTTTGAGGGAATGAGGG - Intronic
964572785 3:158128424-158128446 TGTCTTTCTTGGGGGAATGAGGG + Intronic
964691648 3:159456301-159456323 TCTCTATGTTGAGGGAATGATGG + Intronic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966103452 3:176305238-176305260 TCTCAATAATGAGGGTATGAAGG - Intergenic
967102832 3:186230424-186230446 CATCTAGGTTGAGGGATTGAGGG + Intronic
970366341 4:15362276-15362298 TGTCTATATAGAGGGAAAGAGGG - Intronic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971334570 4:25710811-25710833 TCTCTATCCTGGGGGAAGGAGGG - Intergenic
975048777 4:69832919-69832941 TCTCTATATTGAGGGAGTGCTGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
978552610 4:109943890-109943912 TCTCGATGGTGTGGGAGTGAAGG + Exonic
978975647 4:114867202-114867224 TGTGTCTGTTGAAGGAATGAAGG - Intronic
980478003 4:133345060-133345082 TTTGTATGTAGAGGGAAGGAGGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
984214420 4:176891336-176891358 ACTCTATGATAAGGAAATGATGG - Intergenic
985143179 4:186863893-186863915 TCTCTTTGATGGGGGAATGGAGG - Intergenic
985290320 4:188380033-188380055 TCACTCTGTTGTGGGACTGATGG - Intergenic
985947061 5:3194090-3194112 TCTCTGTGTAGAGGGAGGGATGG + Intergenic
987224617 5:15827086-15827108 TGTCTTTGTGGAGGAAATGATGG - Intronic
987369746 5:17182059-17182081 TTTCTTTGTTGAGTGAGTGAAGG - Intronic
987715311 5:21561403-21561425 TCTGTTAGTTGAGTGAATGAGGG - Intergenic
987763679 5:22197129-22197151 TCTTTAAGTTGAGGTATTGAAGG - Intronic
988038245 5:25855540-25855562 TCTCTATGTTTAAAGAAAGAAGG + Intergenic
988046204 5:25957965-25957987 TATCTTTCTTTAGGGAATGAGGG + Intergenic
989220354 5:38953288-38953310 TCTCTATGTTGAAGAATAGATGG - Intronic
990599109 5:57339443-57339465 TTTCTATGGTGATGGAATTAGGG + Intergenic
991533782 5:67644171-67644193 CCTTTAAGTTGAAGGAATGAAGG - Intergenic
991898400 5:71430215-71430237 TCTTTAAGTTGAGGTATTGAAGG - Intergenic
991969571 5:72126113-72126135 TCCCTGTGTTGAGGGAAGCAGGG + Intronic
992648982 5:78838695-78838717 TCACTATGCTGAGGGCATTAGGG + Intronic
994250867 5:97535517-97535539 ACTCACTGTTGAGGAAATGAAGG + Intergenic
996602316 5:125278655-125278677 TCTATATGCCAAGGGAATGAAGG - Intergenic
996924864 5:128812552-128812574 GCTCTAAGATGAGGGACTGAAGG + Intronic
1000192426 5:158924422-158924444 TGTCTATGTTGAACAAATGAAGG - Intronic
1000246490 5:159452718-159452740 GCTCTTCCTTGAGGGAATGAAGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003849658 6:10208872-10208894 TCTCTATGTTGAAGGAGAGTGGG - Intronic
1003965811 6:11251146-11251168 TTTCCATGTTGAGAGAATTAAGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1009786547 6:68347649-68347671 TATGTATGTAGAAGGAATGAAGG - Intergenic
1010074476 6:71784610-71784632 TTTCTGTGTTGAGGGGATGTGGG - Intergenic
1011431537 6:87292757-87292779 TCTCTAAAATGAAGGAATGAAGG - Intronic
1012187476 6:96237314-96237336 TCCCTGTGTTGAGGGAAGGTGGG - Intergenic
1014609598 6:123524528-123524550 TTTATATCTTAAGGGAATGATGG + Intronic
1015437703 6:133208698-133208720 TTGCTTTTTTGAGGGAATGAAGG - Intergenic
1016897854 6:149071207-149071229 TCTCTATGTAGAGGCTAAGAAGG - Intronic
1017091954 6:150767129-150767151 TCTTTATTTTGAGGGAGTGTAGG + Intronic
1017299838 6:152844223-152844245 TTTATAAGTTGAGGGAATCATGG - Intergenic
1018838355 6:167501649-167501671 TCACTATGTTGAGGGAGAGAAGG + Intergenic
1020910405 7:14122565-14122587 TGTCCATGTTGAGACAATGATGG + Intergenic
1021710157 7:23408048-23408070 TCTATATGATGAGTGAATGTTGG - Intronic
1021769194 7:23981735-23981757 TCTTTATGACTAGGGAATGATGG + Intergenic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1023858797 7:44203934-44203956 TCTCTCTGTTGAGCCCATGATGG + Intronic
1024423614 7:49199979-49200001 TCTGTATGTTGAGGGAGTGCTGG - Intergenic
1024731334 7:52256861-52256883 TCTCCCTGTTTAGGGAATGATGG - Intergenic
1027390906 7:77702615-77702637 TCTCTTTGTGGGTGGAATGATGG + Intronic
1028028772 7:85881553-85881575 TCTTAATGGTGAGGAAATGATGG + Intergenic
1028800556 7:94960368-94960390 CCTCTATGCTGAGGGAGGGAGGG + Intronic
1029058805 7:97775474-97775496 TCTCTATTCTGAGGGAAGTAAGG - Intergenic
1029655221 7:101919628-101919650 TCTCTTTGTTCTGGGAAAGAAGG + Intronic
1030911793 7:115259310-115259332 TGTCTATGCTGAGGTACTGAGGG + Intergenic
1032065748 7:128768905-128768927 TATGTATGTAGGGGGAATGAGGG + Intronic
1032420450 7:131774991-131775013 TCTCTTTGCTGAGGAAATGCAGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032929485 7:136649768-136649790 TCTCTATGTGGATGGAATCCTGG - Intergenic
1033573431 7:142656681-142656703 TCTGGATGTTGAGGGAAGCAGGG - Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1039143821 8:34422918-34422940 TCTATTTGTTGAGTGAATGTGGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1042047444 8:64669692-64669714 TCTCTCTAGGGAGGGAATGAAGG + Intronic
1042054418 8:64748802-64748824 ACTATTTGTTGAGTGAATGAAGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1043064156 8:75545129-75545151 TATTTTTGATGAGGGAATGAAGG - Intronic
1043862576 8:85337407-85337429 TGTCTTTGTTGAAAGAATGAAGG - Intronic
1044866771 8:96578835-96578857 TCTCTAATTTGAGGGGATGATGG + Intronic
1046405452 8:113766911-113766933 TCTCTATAATGGGGGAAGGAAGG + Intergenic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1046872177 8:119215716-119215738 TCTCTATGCTCAGGGGATGAGGG + Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047821559 8:128526698-128526720 TCTCGGTGCTGGGGGAATGATGG + Intergenic
1048264763 8:132975817-132975839 TCACTATGTTGTGTGATTGAAGG + Intronic
1048684851 8:136893076-136893098 TCTCTATGGTATGTGAATGAGGG - Intergenic
1051002392 9:12300025-12300047 TCTCTATCTACAGGGAATGTAGG - Intergenic
1052886037 9:33649075-33649097 TCTGGATGTTGAGGGAAGCAGGG - Intergenic
1052920949 9:33968511-33968533 TCTCCATGTTGGTGGAATCAAGG + Intronic
1053232971 9:36427328-36427350 TCTGTAGGTGGAGGGACTGATGG - Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1055272636 9:74578420-74578442 TGTTTAGGTTTAGGGAATGAAGG + Intronic
1055432325 9:76256818-76256840 TCACTGTGTTAAGGGAAGGATGG - Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1056975655 9:91250846-91250868 TCTCTAAGTTGAAGGAAACAGGG - Intronic
1057330282 9:94107753-94107775 TTTCTATTTTGAGAGAAGGAGGG - Intronic
1057636720 9:96776237-96776259 TCTTTATGTTGCAGGAAGGAGGG - Exonic
1058453391 9:105117279-105117301 TCTCCTTGTTGAGTGAATGCAGG - Intergenic
1058741121 9:107943817-107943839 TCTAGATGTTGTGTGAATGATGG + Intergenic
1059043754 9:110842339-110842361 TGTTTAGGTTGAGGGGATGAGGG - Intergenic
1059228880 9:112698856-112698878 TCTGTATCTGGAGGGAAAGAAGG - Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186734608 X:12448104-12448126 TGTGCATGTTCAGGGAATGATGG + Intronic
1187675963 X:21716846-21716868 TCTCTAGGATGAGGGAATCTTGG + Intronic
1187679580 X:21753517-21753539 CCTCCATGTTGATGGAAAGATGG + Intronic
1188534855 X:31185255-31185277 ACTATTTGTTGAGAGAATGACGG - Intronic
1188572525 X:31605271-31605293 TCTCAAAGTAGTGGGAATGATGG - Intronic
1189920999 X:45903344-45903366 TGTCTTTGTTGAGGGAAGCAAGG - Intergenic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1192474929 X:71432192-71432214 ACAATATGTTGAGGGGATGAAGG + Intronic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1198117638 X:133559458-133559480 TCTCTATCTTGTGGGGAAGATGG + Intronic
1199943484 X:152647491-152647513 TCTTTCAGTTGAGGGAATCAAGG - Intronic
1200114937 X:153765852-153765874 TCTCTCTGTGGAGGGCAGGAGGG + Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201147566 Y:11073206-11073228 TCTCCATGTTGAGGGCGTGGCGG - Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1201667838 Y:16478969-16478991 TTCCTGTGTTGAGGGAATTAAGG - Intergenic
1201897812 Y:19012067-19012089 TCTGTATGGTCAGTGAATGAAGG - Intergenic