ID: 964699479

View in Genome Browser
Species Human (GRCh38)
Location 3:159549070-159549092
Sequence TGCAAACTCTATCTCTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964699478_964699479 1 Left 964699478 3:159549046-159549068 CCTTTAGCTTAGTTGAACTGAAA 0: 1
1: 0
2: 0
3: 11
4: 148
Right 964699479 3:159549070-159549092 TGCAAACTCTATCTCTTGAGTGG 0: 1
1: 1
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964699479 Original CRISPR TGCAAACTCTATCTCTTGAG TGG Intronic
904182804 1:28678695-28678717 TGCAACCTCTGCCTCCTGAGTGG + Intronic
909530148 1:76673268-76673290 TGCGATTTCTATCTCTTGATTGG - Intergenic
913000552 1:114576335-114576357 TGCAACCTCCATCTCCTGGGGGG + Intronic
915046973 1:153025731-153025753 AACAAACTCTATTTCTTGATAGG + Intergenic
915365681 1:155314262-155314284 TGCAATCTCTGCCTCTGGAGCGG + Intronic
915544806 1:156591022-156591044 TGCAAACACACTCTCTTGCGTGG - Intergenic
916604776 1:166330223-166330245 AGCAAACTATATCCCATGAGTGG - Intergenic
918656615 1:187034621-187034643 TGAAACCTCTATCTGTTGAGGGG - Intergenic
920364771 1:205442311-205442333 TGCAATCTCTATTGCTTGAGGGG - Intronic
1063262288 10:4403508-4403530 TGCAAACTCTACTCCTTGGGAGG - Intergenic
1071985478 10:91046038-91046060 ATCAAACTCCATCTCTTGAAGGG + Intergenic
1072105790 10:92272451-92272473 TTCTAACTCTATCTAATGAGAGG - Intronic
1074558094 10:114510256-114510278 TGCAATCACTTTCTCTAGAGGGG - Intronic
1075927974 10:126268718-126268740 TTCAAACTCGTTATCTTGAGTGG - Intronic
1076664823 10:132080856-132080878 TGCAAATCCTATCTCATAAGGGG - Intergenic
1079192157 11:18288037-18288059 TCCAAACTTTATCTCTTAGGCGG + Intronic
1079377187 11:19903928-19903950 TGGAAAGACTTTCTCTTGAGTGG + Intronic
1080777656 11:35401300-35401322 TGCAAAAGCTGTCTCTTGTGGGG - Intronic
1081068038 11:38572135-38572157 TGCAAACTCTCTCACTTGTGTGG - Intergenic
1081851204 11:46276469-46276491 TACAAACTTAATCTCTTGAAAGG - Intergenic
1083875146 11:65519155-65519177 TGCAACCTCAACCTCTTGGGTGG + Intergenic
1084076486 11:66782101-66782123 TCCAAACTCTATCTCCTCTGTGG + Intronic
1086071884 11:82808714-82808736 TCCTAACTCTATCCCCTGAGAGG + Intergenic
1086306860 11:85489108-85489130 TCCAATCTGTATCTCTTAAGTGG - Intronic
1087449916 11:98307722-98307744 TACAAACTGTATCTCTTCACTGG - Intergenic
1088285139 11:108179994-108180016 TGCAAATTCTATCTGATAAGGGG + Intronic
1091838333 12:3601750-3601772 TGCAAAGTGTTTCTATTGAGTGG + Intergenic
1092468074 12:8752603-8752625 TTCAAACTATATATCTTTAGAGG - Intronic
1093303132 12:17478546-17478568 TGTACAATATATCTCTTGAGGGG + Intergenic
1094636843 12:32234752-32234774 TGCAACCTCCACCTCCTGAGTGG + Intronic
1095747992 12:45681268-45681290 TGCAACCTCTGCCTCCTGAGAGG + Intergenic
1099272532 12:80528858-80528880 TTCAAACTCATTCTCTTCAGTGG + Intronic
1101312971 12:103600562-103600584 TGCAAACACTATCTCATTGGAGG + Intronic
1101358222 12:104001021-104001043 TGTTAACACTATCTCTTGGGAGG - Intronic
1101568572 12:105932610-105932632 CCCACACTCAATCTCTTGAGTGG - Intergenic
1102750049 12:115285105-115285127 AGCAAAATCTATTTCTTGGGGGG + Intergenic
1102755573 12:115337034-115337056 TGCAAACTCTTTTTCTTAAAAGG + Intergenic
1106094175 13:26628353-26628375 TGCAAACTCTTTCTCATGGTGGG - Intronic
1108297007 13:49031889-49031911 TGCAAACTGTATCTGATAAGGGG + Intronic
1108773838 13:53738648-53738670 TGCAATGAGTATCTCTTGAGTGG + Intergenic
1108926103 13:55747932-55747954 TTCAAACTGGATCTCTTGAATGG + Intergenic
1110969503 13:81743319-81743341 TGCAAACTCTGTCTCTTGAGTGG - Intergenic
1113661424 13:112108499-112108521 TTCAAAATCTGTCTGTTGAGGGG + Intergenic
1115637339 14:35303219-35303241 TACAAAGTCTGTCTCTTGGGTGG + Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1119459905 14:74792473-74792495 TGTAAACTGTATCTCTTTAAAGG - Intronic
1119880909 14:78098827-78098849 AGCAAGCTGTATCTCTTGAATGG - Intergenic
1121308854 14:92923957-92923979 TGGAAACTCTTGCTCTGGAGCGG - Intronic
1122001197 14:98655694-98655716 TGCAAACTCCGTTTCTTGGGTGG - Intergenic
1124794489 15:32763621-32763643 TGAAAACTGTATGGCTTGAGTGG - Intergenic
1125299541 15:38240009-38240031 TGCAATCTCCACCTCCTGAGCGG + Intergenic
1130311681 15:82761522-82761544 TGAAAAATCTATCACTTAAGTGG + Intronic
1131109162 15:89753816-89753838 TGCAAACTCAAACTCCTGAGGGG - Intergenic
1133615077 16:7468795-7468817 AGCAAACTCTTTCTTTTGGGTGG + Intronic
1137936538 16:52640286-52640308 AGCAAACTCTATCCAATGAGAGG - Intergenic
1138032544 16:53571344-53571366 TCCAAACTCTATCTCCTCTGTGG - Intergenic
1141134216 16:81455379-81455401 TCCAAACTATGTCTGTTGAGGGG - Intronic
1141379762 16:83565954-83565976 TGCAAACGCTATAGCATGAGAGG - Intronic
1143372656 17:6449898-6449920 TGCCAGCTCTATGTGTTGAGGGG + Intronic
1143666255 17:8362974-8362996 TAAAAACTCCATCTCTTGATAGG + Intergenic
1144064569 17:11612979-11613001 TGCAAACTCCATGCCATGAGAGG - Intronic
1144238631 17:13287561-13287583 TGATAACTCCATCTCTGGAGTGG - Intergenic
1146610230 17:34298525-34298547 CTCAAACTCTATCCATTGAGAGG + Intergenic
1146899075 17:36569788-36569810 TGCAAAAACTATCTTTTGGGAGG - Intronic
1146997111 17:37330875-37330897 TTCAAACACTATATATTGAGAGG + Intronic
1157015624 18:43709277-43709299 TGCTTACTATATCTTTTGAGTGG + Intergenic
1165477132 19:36037446-36037468 TGCAAACTCCAGCTCTATAGGGG + Intronic
1165564171 19:36709505-36709527 TGAGATCTCTATCTCTGGAGTGG - Intronic
1168428266 19:56257105-56257127 TCCACACTCTGTCTTTTGAGGGG - Intronic
926788704 2:16547368-16547390 TGAAAACTTTACCTCTTGGGTGG + Intergenic
928724542 2:34156753-34156775 TGCAAATTCTGTCTCTTGGTTGG - Intergenic
929850827 2:45588743-45588765 TACAAACTGTATTTCTTCAGAGG - Intronic
935682597 2:105651114-105651136 TGCAACCTAGATCTCTTGTGTGG + Intergenic
938752894 2:134351438-134351460 TGGAAACTCTATCTCTTGTAGGG - Intronic
939135014 2:138283163-138283185 TGCAAACTGTATCTGATAAGGGG + Intergenic
939733789 2:145818919-145818941 TGCAAGCACAGTCTCTTGAGTGG - Intergenic
941308368 2:163898248-163898270 TCCAACCTCTATCCCTTGAGAGG - Intergenic
942285670 2:174413380-174413402 TGCAAATTCTGTCTCTTGGTTGG + Intronic
943355944 2:186856070-186856092 TGCTTTCTCTACCTCTTGAGTGG + Intergenic
944038102 2:195322006-195322028 TGCACATTCTATCACTGGAGAGG - Intergenic
944493826 2:200285789-200285811 TTCACACTCTGTTTCTTGAGTGG - Intergenic
944626998 2:201580961-201580983 TGCAAACTCTGTCTCTTAGTTGG - Intronic
944890541 2:204112739-204112761 TGCAAACTCTGTCTGTTCAATGG - Intergenic
945568261 2:211431379-211431401 TGCAAACTCTTTCTTTAGTGAGG + Intronic
945983672 2:216337844-216337866 TGCATCCTCTAACTGTTGAGTGG + Intronic
946795608 2:223348325-223348347 TGCAATCTGTATCTTTTAAGTGG - Intergenic
947043219 2:225948560-225948582 TGTAAACTCTGTTTCTTGGGTGG - Intergenic
947437948 2:230089303-230089325 TGCAAACTTTATTTTTTGCGGGG - Intergenic
947539670 2:230967473-230967495 TGCAGCCTCTACTTCTTGAGAGG + Intergenic
1170121476 20:12917111-12917133 TCCAAACTCTGTAACTTGAGTGG - Intergenic
1170329671 20:15194809-15194831 TGCAAACAGTAACTCTGGAGTGG - Intronic
1170613379 20:17931418-17931440 AACAAACTCTATCTTTTGATGGG - Intergenic
1171903810 20:30882757-30882779 TGCAAACTATATATGATGAGAGG + Intergenic
1173711851 20:45164808-45164830 TGCATGCTCTAACTCTGGAGTGG - Intergenic
1175709682 20:61209318-61209340 AACAAACTCTATCTCTAGATGGG + Intergenic
1178055800 21:28797163-28797185 TGCAGACTCTAACTCTTCACTGG + Intergenic
1181907844 22:26213453-26213475 TGCAATCTTTATCTGTTTAGAGG + Intronic
1182102322 22:27666862-27666884 AACAGACTCTATCTCTTGATGGG + Intergenic
1182205646 22:28622397-28622419 TGCAAACTCTGTTTCTTAAGTGG - Intronic
1182766978 22:32764724-32764746 TGCAAATTCTATCTCCTGACTGG + Intronic
1184316228 22:43692205-43692227 TGCATACTCTGTTTCTTGGGTGG - Intronic
1184619266 22:45662523-45662545 TGAAAACTCTATTTCTTCAGGGG + Intergenic
1184896720 22:47411867-47411889 TGAAAACTACATCACTTGAGAGG + Intergenic
950897988 3:16470669-16470691 TGCCAACTCTGTCTCTTGGGTGG - Intronic
954946693 3:54431689-54431711 TGCAACCTCCATCTCCTGGGCGG + Intronic
957719253 3:83972595-83972617 TTCAAACTCTACTTATTGAGTGG - Intergenic
958050132 3:88334472-88334494 TGCAAAATCTTTCTCTCTAGAGG - Intergenic
959347562 3:105218344-105218366 AACAAACTCTGTCTCTTGATAGG - Intergenic
961489635 3:127245666-127245688 TGCAAACTGGATCTCCTGATGGG - Intergenic
963871487 3:150419958-150419980 TTCAAATTTTATTTCTTGAGTGG + Intronic
964699479 3:159549070-159549092 TGCAAACTCTATCTCTTGAGTGG + Intronic
964763687 3:160158095-160158117 TAAAAACTCTATCTCTTAATGGG + Intergenic
964843066 3:161015461-161015483 TGCAAACTATATCTCTAAACTGG + Intronic
968285630 3:197506996-197507018 TGCAGGGTCTATATCTTGAGGGG + Intergenic
969141651 4:5079615-5079637 TGGAAACTCCATCTTTTGAGAGG + Intronic
971732934 4:30408729-30408751 GGCAATCTATATCTCTTAAGTGG - Intergenic
972469990 4:39395079-39395101 TGCAAACTCCACCTCCTGGGTGG - Intergenic
974593540 4:63986672-63986694 TCCAATCTGTATCTCTTAAGTGG - Intergenic
974883714 4:67790151-67790173 GGCAAACTCCATCTCATGAATGG - Intergenic
975705395 4:77107351-77107373 TGCAAACTCTATCTCTGATAAGG + Intergenic
976282631 4:83340280-83340302 TGCAACCTCCACCTCTCGAGAGG + Intergenic
976734644 4:88297163-88297185 AGAAAACTCTACCTCTTGATGGG - Intergenic
977237115 4:94521601-94521623 TACATACTAGATCTCTTGAGAGG - Intronic
977474865 4:97492919-97492941 AGCAGACTCTACCTCTTGACTGG - Intronic
977933033 4:102769011-102769033 TGCAAACTATATCTCTGAAAAGG + Intergenic
980182030 4:129413204-129413226 TGCAAACTCTGTGGCTTAAGAGG + Intergenic
983062741 4:163176922-163176944 GGCCCACTCTATCTCTTCAGAGG - Intergenic
985467949 5:15290-15312 TGCAACCTCTACCTCCTGTGTGG - Intergenic
989028371 5:37091652-37091674 TGCAGGCTTTATGTCTTGAGAGG - Intergenic
989136340 5:38158948-38158970 TGTAAACTCTATCACTTGGCTGG - Intergenic
989646075 5:43633924-43633946 TCCTAATTCTATCTCCTGAGAGG - Intronic
990429592 5:55721352-55721374 TGCAAACTCTGTCTCATGGGTGG - Intronic
990945887 5:61249004-61249026 TGCTATCTCTATCTATGGAGTGG - Intergenic
991202136 5:64006810-64006832 TGCAAAAACCATCTCTTGTGGGG + Intergenic
991352253 5:65731316-65731338 AACAGACTCTATCTCTTGATGGG + Intronic
993313011 5:86360876-86360898 TGCAAATTCTATCTCTAGAAGGG + Intergenic
993332211 5:86614970-86614992 TGGAAATTCTTTCTATTGAGTGG - Intergenic
994672698 5:102781633-102781655 TGCAAGCTCTAAGTCTTGATAGG + Intronic
995059264 5:107796029-107796051 TCCAAACTATATCGCTAGAGTGG + Intergenic
1000107154 5:158070950-158070972 TGCAAACTGTCTCTCTCCAGTGG + Intergenic
1000926660 5:167202604-167202626 TCAAAACTCTACCTCTTGATAGG + Intergenic
1001252349 5:170156228-170156250 TGCAAACTATATGACTGGAGGGG - Intergenic
1005817690 6:29569320-29569342 TGCATGCTCTATATCTTGAATGG - Intronic
1009435771 6:63616610-63616632 TGTAAATGCTATCTTTTGAGGGG - Intergenic
1011558283 6:88590950-88590972 AGGAAAATCTAGCTCTTGAGTGG - Intergenic
1019234672 6:170600491-170600513 TGCAACCTCTACCTCCTGGGTGG + Intergenic
1022073549 7:26941865-26941887 TGGAAACTCAAGCTCTTCAGTGG - Intronic
1026110979 7:67458781-67458803 TGTAGACTCTACCTCTTGATGGG + Intergenic
1027800763 7:82746312-82746334 TGCAACCTTTAGCTCTTGAATGG - Intergenic
1028905532 7:96150407-96150429 TGCAAAAAGTACCTCTTGAGTGG - Intronic
1031543167 7:123020645-123020667 TCCAATCTCTCTCTTTTGAGTGG + Intergenic
1037187937 8:16087562-16087584 TGCAGACTCTGTCTCATGGGTGG - Intergenic
1039860630 8:41454097-41454119 TGCAAACACACTCTGTTGAGGGG - Intergenic
1040610992 8:48982137-48982159 TGCAGCCTCCATCTCTTGATGGG + Intergenic
1041049734 8:53922453-53922475 GGCAATCTCTATCTTTTGATTGG + Intronic
1041245426 8:55884467-55884489 AGCGAACTCTGTCTCTTCAGTGG - Intronic
1042302067 8:67294780-67294802 TCCTAACTCTATCTGCTGAGAGG + Intronic
1043786378 8:84405640-84405662 TTAAAACTGTAACTCTTGAGAGG - Intronic
1045709775 8:104969645-104969667 TGTAGACTTTGTCTCTTGAGTGG - Intronic
1047480889 8:125281956-125281978 TGCAAACTCTAACTCCTGCAGGG + Intronic
1047837751 8:128712709-128712731 TGGGAACTCTTTCTCTTGGGTGG + Intergenic
1049492792 8:142914051-142914073 TGCAAACTCAGTCTCATGTGAGG + Intronic
1049695962 8:143984440-143984462 TGCAAACTCCATCTCTGCAATGG - Intronic
1049856193 8:144863431-144863453 AACCAACTCTATCTGTTGAGAGG + Intergenic
1050118451 9:2284273-2284295 TGCAACCTCCACCTCCTGAGTGG + Intergenic
1051609396 9:18946482-18946504 TGCAAACTCTGTGTCTTGGGTGG - Intronic
1052407215 9:28077280-28077302 AACAAACTCTATCTCTTTACTGG - Intronic
1052711226 9:32058570-32058592 TGCATACTCTATATCTTGATAGG + Intergenic
1058511760 9:105726704-105726726 TGCAATCTCTATCTTTTAATTGG + Intronic
1058719420 9:107750103-107750125 TCCAAATTCTATGTCTGGAGTGG + Intergenic
1186170395 X:6870788-6870810 TGCAAACCCTGTCTCTTGATGGG + Intergenic
1188128921 X:26406175-26406197 AGCATACTTTTTCTCTTGAGAGG + Intergenic
1188174047 X:26965837-26965859 TCCAAACTCTATCTCTCCTGTGG - Intergenic
1188484192 X:30664776-30664798 TGCAATCTCCATCTCCTGGGTGG + Intronic
1192512525 X:71731723-71731745 TGTAATTTCTATCTCTGGAGTGG - Intergenic
1192514172 X:71749786-71749808 TGTAATTTCTATCTCTGGAGTGG + Intergenic
1192886282 X:75337830-75337852 TGCAATCGCTATCTCTTGGCTGG - Intergenic
1196178751 X:112667981-112668003 TGGATACTCCATCTCTTCAGTGG + Intronic
1199645989 X:149912431-149912453 TGCAACCTCCACCTTTTGAGGGG - Intergenic
1200425109 Y:3011843-3011865 GGCAAACACTATATCTTAAGTGG + Intergenic