ID: 964701158

View in Genome Browser
Species Human (GRCh38)
Location 3:159569098-159569120
Sequence CATTTAAAACACAGGGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1042
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 1011}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964701158_964701165 27 Left 964701158 3:159569098-159569120 CCTGAGTCCCTGTGTTTTAAATG 0: 1
1: 0
2: 0
3: 30
4: 1011
Right 964701165 3:159569148-159569170 GTTTCCTATAATCCAATTACTGG 0: 1
1: 0
2: 0
3: 5
4: 113
964701158_964701164 5 Left 964701158 3:159569098-159569120 CCTGAGTCCCTGTGTTTTAAATG 0: 1
1: 0
2: 0
3: 30
4: 1011
Right 964701164 3:159569126-159569148 CTCATAAGCAGACTACATTTGGG 0: 1
1: 0
2: 0
3: 4
4: 138
964701158_964701163 4 Left 964701158 3:159569098-159569120 CCTGAGTCCCTGTGTTTTAAATG 0: 1
1: 0
2: 0
3: 30
4: 1011
Right 964701163 3:159569125-159569147 CCTCATAAGCAGACTACATTTGG 0: 1
1: 0
2: 0
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964701158 Original CRISPR CATTTAAAACACAGGGACTC AGG (reversed) Intronic
900550769 1:3253402-3253424 CAATAAAAACACATGGACACAGG - Intronic
900914108 1:5622465-5622487 CATTTACAACCCAGGAACACTGG - Intergenic
900918394 1:5654590-5654612 CAATGAGAACACAGGGACACAGG + Intergenic
901562393 1:10082852-10082874 CAATGAGAACACAGGGACACAGG - Intronic
901881887 1:12198992-12199014 CATTCAAAACACAGGATCCCAGG - Intronic
901959469 1:12813181-12813203 CAATGAGAACACAGGGACACAGG - Intergenic
904387675 1:30155289-30155311 CAATGAAAACACATGGACACAGG - Intergenic
904733388 1:32611996-32612018 CATTTAAAACAGTTGGACTTGGG + Intronic
905273801 1:36804347-36804369 CAATTAAAACAGAGAGTCTCTGG + Intronic
906261836 1:44398243-44398265 CAATGAAAACACATGGACACAGG + Intergenic
906279309 1:44542728-44542750 CATTTAATCCACAGGGAGACAGG + Intronic
907574605 1:55514683-55514705 CAATGAAAACACATGGACACAGG - Intergenic
907732647 1:57082722-57082744 CAATTAGAACACATGGACACAGG - Intronic
908037030 1:60066872-60066894 CAATGAAAACACATGGACACAGG - Intronic
908417770 1:63930159-63930181 CAATGAAAACACATGGACTCAGG - Intronic
908910363 1:69065879-69065901 CAATGAGAACACAGGGACACAGG - Intergenic
909377266 1:74953555-74953577 CAATGAGAACACATGGACTCAGG - Intergenic
909555701 1:76951421-76951443 CAATTAGAACACATGGACACAGG + Intronic
909734170 1:78935350-78935372 CAATGAAAACACATGGACACAGG + Intronic
909840536 1:80316289-80316311 TAATTAAAACACTGGGACTCTGG + Intergenic
909891459 1:81012919-81012941 CAATTAGAACACATGGACACAGG - Intergenic
910263344 1:85312818-85312840 CAATGAAAACACATGGACACAGG - Intergenic
910340392 1:86180499-86180521 CAATGAAAACACATGGACACAGG - Intergenic
911217444 1:95210879-95210901 CAATGAGAACACATGGACTCAGG - Intronic
911465712 1:98250248-98250270 CAATGAGAACACATGGACTCAGG - Intergenic
911468467 1:98284972-98284994 CAATGAAAACACATGGACACAGG - Intergenic
911536094 1:99102587-99102609 CAATGAAAACACATGGACACAGG + Intergenic
911554482 1:99326789-99326811 CCTTTAAAACAATGGGGCTCAGG + Intergenic
911685993 1:100778418-100778440 CAATGAAAACACATGGACACAGG + Intergenic
911732185 1:101302599-101302621 CATTCTGAACACAGGGAATCTGG + Intergenic
911968202 1:104394829-104394851 CATTGAGAACACATGGACACAGG - Intergenic
912166800 1:107051156-107051178 CAATGAGAACACAGGGACACAGG + Intergenic
912221505 1:107682486-107682508 CATTAAAAAAACAGGGGTTCTGG - Intronic
912276688 1:108265838-108265860 CAATTAGAACACATGGACACAGG + Intergenic
912291542 1:108428519-108428541 CAATTAGAACACATGGACACAGG - Intronic
912462330 1:109844169-109844191 CAATGAAAACACATGGACACAGG + Intergenic
913419062 1:118643700-118643722 CAATGAAAACACATGGACACAGG + Intergenic
913582587 1:120241372-120241394 CCTTTACAATACAGGGATTCAGG - Intergenic
913625586 1:120656988-120657010 CCTTTACAATACAGGGATTCAGG + Intergenic
914217483 1:145645480-145645502 CATTTAGAGAACAGGGGCTCAGG - Intronic
914342060 1:146768166-146768188 CAATGAAAACACATGGACACAGG - Intergenic
914470052 1:147968165-147968187 CATTTAGAGAACAGGGGCTCAGG - Intronic
914564517 1:148852865-148852887 CCTTTACAATACAGGGATTCAGG - Intronic
914608309 1:149277377-149277399 CCTTTACAATACAGGGATTCAGG + Intergenic
915441031 1:155945621-155945643 CATTTCACACACAGGGACACAGG - Intergenic
915658619 1:157382257-157382279 CAATGAAAACACATGGACACAGG - Intergenic
915768208 1:158388549-158388571 CATTGAGAACACATGGACACAGG + Intergenic
916904967 1:169273253-169273275 CAATGAAAACACATGGACACAGG - Intronic
917242294 1:172961426-172961448 CAATGAGAACACAGGGACACGGG - Intergenic
917393273 1:174562801-174562823 CAGTGAGAACACAGGGACACAGG + Intronic
917694757 1:177510872-177510894 CAATGAGAACACAGGGACACAGG + Intergenic
917779551 1:178378165-178378187 GATCTAAAACACAGGGACCTAGG + Intronic
917887908 1:179405116-179405138 CAATGAAAACACATGGACACAGG - Intronic
917997421 1:180455318-180455340 CAATGAAAACACATGGACACGGG + Intronic
918088522 1:181266166-181266188 CAATGAGAACACATGGACTCAGG - Intergenic
918355158 1:183700949-183700971 CAATGAAAACACATGGACACAGG - Intronic
918361454 1:183763186-183763208 CAATGAGAACACAGGGACACAGG + Intronic
918583221 1:186157002-186157024 CATTAAAAACACAGATACCCAGG + Intronic
918665883 1:187150401-187150423 CAGTGAAAACATAGGAACTCAGG + Intergenic
918693751 1:187515738-187515760 CAATGAAAACACATGGACACAGG - Intergenic
918742144 1:188145741-188145763 CAATGAAAACACATGGACACAGG - Intergenic
918889388 1:190245796-190245818 CATTGAGAACACATGGACACAGG - Intronic
919160815 1:193828145-193828167 CAATGAGAACACAGGGACACAGG + Intergenic
919601346 1:199626541-199626563 CAATGAGAACACAGGGACACAGG + Intergenic
921457384 1:215388829-215388851 CATCTTAACCACAGTGACTCAGG + Intergenic
921728928 1:218554904-218554926 CAATGAAAACACATGGACACAGG - Intergenic
922634493 1:227152826-227152848 CACTTAAAACATAAGGACGCAGG + Intronic
923422273 1:233828177-233828199 CAATGAAAACACATGGACACAGG + Intergenic
923654506 1:235904133-235904155 CAATAAGAACACAGGGACACAGG + Intergenic
923829498 1:237539268-237539290 CATATAAAACCCTGGCACTCAGG - Intronic
923875867 1:238046355-238046377 CAATGAGAACACAGGGACACAGG - Intergenic
924072950 1:240300939-240300961 CAATTCAAACACAGAGACACAGG - Intronic
924179436 1:241425174-241425196 CATTGAGAACACATGGACACAGG - Intergenic
924401216 1:243684351-243684373 CAGTGAGAACACAGGGACACAGG - Intronic
1062870266 10:895900-895922 TATTTAAAAAACTGAGACTCTGG - Intronic
1063047896 10:2412291-2412313 CATTACAAACACAGGGAGTAAGG - Intergenic
1063128743 10:3159298-3159320 GATTTAAATCACAGGCACTGTGG + Intronic
1063327000 10:5113881-5113903 CAATGAGAACACAGGGACACAGG + Intronic
1064779942 10:18824044-18824066 CAATGAAAACACATGGACACAGG - Intergenic
1064915472 10:20451977-20451999 CTTTTAAAATACAAGGACTTGGG - Intergenic
1065085956 10:22176620-22176642 CATTTTAAACACAAAGACTCAGG + Intergenic
1065682798 10:28254278-28254300 CATTTATAATTCAGGGATTCAGG - Intronic
1067839649 10:49665629-49665651 CATTTAAAATATAGTGACTTGGG + Intergenic
1067984547 10:51127905-51127927 CAATGAGAACACATGGACTCAGG + Intronic
1068105331 10:52607901-52607923 CATTGAGAACACATGGACACAGG + Intergenic
1068460699 10:57324682-57324704 CAATGAAAACACATGGACACAGG + Intergenic
1068541403 10:58298753-58298775 CAATGAAAACACATGGACACAGG + Intergenic
1068646687 10:59476026-59476048 CAATGAAAACACATGGACACAGG + Intergenic
1068785843 10:60972482-60972504 CAATGAGAACACAGGGACACAGG + Intronic
1068788621 10:61003123-61003145 CAATGAGAACACAGGGACACAGG - Intergenic
1068922041 10:62494934-62494956 CAATGAAAACACATGGACACAGG - Intronic
1069127481 10:64654326-64654348 CAGTGAAAACACATGGACACAGG - Intergenic
1069255767 10:66330263-66330285 CAATGAGAACACAGGGACACAGG - Intronic
1070125266 10:73616448-73616470 CAATGAAAACACATGGACACAGG + Intronic
1070346780 10:75551527-75551549 CAATTAGAACACATGGACACAGG - Intronic
1070869381 10:79736753-79736775 CATTGAGAACACATGGACACAGG - Intergenic
1071190733 10:83096373-83096395 CAATGAGAACACATGGACTCAGG - Intergenic
1071410825 10:85393138-85393160 CAATGAGAACACAGGGACACAGG - Intergenic
1071636300 10:87258959-87258981 CATTGAGAACACATGGACACAGG - Intergenic
1071658941 10:87478992-87479014 CATTGAGAACACATGGACACAGG + Intergenic
1071983692 10:91029721-91029743 CATTGAGAACACATGGACACAGG + Intergenic
1072003728 10:91221455-91221477 TAATTAAAAGACAGGGAATCAGG - Intronic
1072135832 10:92544742-92544764 CATATAAAACACAGGTAGTAGGG + Intronic
1072311436 10:94159812-94159834 CAATGAAAACACATGGACACAGG - Intronic
1072406924 10:95163616-95163638 CAATGAAAACACATGGACACAGG - Intergenic
1072488786 10:95882637-95882659 CATTGAGAACACATGGACACAGG + Intronic
1072501264 10:96020326-96020348 CTTTTTAAAGACAGGGACTGTGG + Intronic
1072652615 10:97307473-97307495 CACTTAAAACACATGGACTGAGG - Intergenic
1072699233 10:97628326-97628348 TATTGACTACACAGGGACTCAGG + Intronic
1072753045 10:97997581-97997603 CATTTAACACCCAAGGACTGCGG + Intronic
1072854136 10:98928785-98928807 CAATGAGAACACATGGACTCAGG + Intronic
1073241870 10:102064631-102064653 GATTTCAACCACAGGCACTCTGG - Intergenic
1073595841 10:104799491-104799513 CAATGAAAACACATGGACACAGG + Intronic
1073659797 10:105462356-105462378 CAATGAGAACACAGGGACACAGG - Intergenic
1073933753 10:108605541-108605563 CAATGAAAACACATGGACACAGG - Intergenic
1074928634 10:118100480-118100502 CAATGAAAACACATGGACACAGG - Intergenic
1075473971 10:122717411-122717433 CATTTAGAACACAGGCACCGGGG + Intergenic
1075666772 10:124236588-124236610 CTTTTTCAACACAGGGTCTCTGG - Intergenic
1075681162 10:124333101-124333123 CATTCAACACACAGAGTCTCTGG + Intergenic
1075885332 10:125895589-125895611 GTTTTAAAACACAGTGATTCAGG - Intronic
1076482193 10:130792130-130792152 CCTTGGAAACACAGGGGCTCTGG - Intergenic
1077831496 11:5876720-5876742 CAATGAAAACACATGGACACAGG + Intronic
1078144972 11:8716289-8716311 CATGGAGAACACAGGGGCTCTGG + Intronic
1078404782 11:11060924-11060946 CAGTGAAAACACATGGACACGGG + Intergenic
1078621143 11:12909471-12909493 CAATGAGAACACAGGGACACAGG + Intronic
1078880506 11:15444244-15444266 CAGTTAAATCACAGGGGTTCTGG - Intergenic
1079433703 11:20423047-20423069 TTTTTAAAATACAGGGAATCAGG - Intronic
1079496819 11:21053314-21053336 CAATGAAAACACATGGACACAGG - Intronic
1079525666 11:21384640-21384662 CAATGAAAACACAAGGACACAGG - Intronic
1079751026 11:24197462-24197484 CAATGAAAACACATGGACACAGG - Intergenic
1080141935 11:28931993-28932015 CAATGAGAACACAGGGACACAGG - Intergenic
1080334960 11:31185206-31185228 CAATGAGAACACAGGGACACAGG + Intronic
1081035117 11:38134537-38134559 CAATGAAAACACATGGACACAGG + Intergenic
1081819176 11:45975011-45975033 GATTTAAAACAGATGGACTCAGG + Intronic
1082116325 11:48333203-48333225 CAATGAAAACACATGGACACAGG - Intergenic
1082256753 11:50040920-50040942 CATTGAGAACACAAGGACACAGG + Intergenic
1082712283 11:56567530-56567552 CCATTAAAACACATGGACACAGG - Intergenic
1082721596 11:56684406-56684428 CATTGAGAACACATGGACACAGG + Intergenic
1082878189 11:58010039-58010061 CAATAAGAACACAGGGACACAGG - Intergenic
1082891471 11:58143647-58143669 CAATGAAAACACATGGACACAGG + Intronic
1082959258 11:58903269-58903291 CACCTAAGACACAGGGAATCTGG + Intronic
1083858598 11:65406626-65406648 CTTTTTAAAAACAGGGTCTCGGG - Intronic
1083979415 11:66153919-66153941 CACTTTAAACACAGAGACACAGG + Intronic
1084849865 11:71929910-71929932 CGTTTAAAACTCAGCAACTCCGG - Intronic
1085330086 11:75641281-75641303 CAATGAGAACACATGGACTCAGG + Intronic
1085398370 11:76219276-76219298 CCTTTAAAAAACAGGGAGTGTGG + Intergenic
1086074129 11:82831912-82831934 CAATGAGAACACATGGACTCAGG - Intronic
1086377486 11:86215735-86215757 CATTCAAAAGAAAGGGACTTTGG - Intergenic
1087404323 11:97711470-97711492 CAATGAGAACACAGGGACACAGG + Intergenic
1087481085 11:98701164-98701186 CAGTGAAAACACATGGACACAGG + Intergenic
1087502295 11:98972974-98972996 CATTGAGAACACATGGACACAGG - Intergenic
1087950041 11:104209704-104209726 AATTTAAAACAAATGAACTCAGG - Intergenic
1088008568 11:104971585-104971607 CAATAAGAACACATGGACTCAGG + Intergenic
1088150337 11:106737592-106737614 CAATGAGAACACAGGGACACAGG - Intronic
1088200301 11:107325495-107325517 CAATGAAAACACATGGACACAGG + Intergenic
1088360949 11:108989497-108989519 CATTGAGAACACATGGACACAGG - Intergenic
1088554882 11:111051868-111051890 CAATGAAAACACATGGACACAGG + Intergenic
1089312296 11:117566772-117566794 CAATGAAAACACATGGACACAGG - Intronic
1089659811 11:119978543-119978565 CATTTCAAACACAGGGAGTGAGG + Intergenic
1090032562 11:123219665-123219687 TATTTAAAAGACAGGCACCCTGG + Intergenic
1091245388 11:134089502-134089524 CAATGAGAACACAGGGACACAGG - Intronic
1091640844 12:2235960-2235982 CATTTATAAAACAGGGACAATGG - Intronic
1091951950 12:4600489-4600511 GATATACAACACAGGGACTTTGG + Intronic
1092320317 12:7465872-7465894 CATTGAGAACACATGGACACAGG + Intronic
1092702760 12:11250877-11250899 CAATGAGAACACAGGGACACAGG - Intergenic
1092703838 12:11262740-11262762 CAATGAGAACACAGGGACACAGG + Intergenic
1092707837 12:11303877-11303899 CAATGAGAACACAGGGACACAGG + Intergenic
1092923103 12:13249882-13249904 CAATGAGAACACAGGGACACAGG - Intergenic
1093252269 12:16821168-16821190 CAATGAAAACACATGGACACAGG - Intergenic
1093627489 12:21366346-21366368 CAATGAGAACACAGGGACACAGG + Intronic
1094195564 12:27745759-27745781 CAATGAGAACACAGGGACACAGG - Intronic
1094724729 12:33102477-33102499 CAATTAGAACACATGGACACTGG - Intergenic
1095376432 12:41534489-41534511 CAATGAAAACACATGGACACAGG - Intronic
1095494915 12:42773894-42773916 CATTTAAAATACAGCCACACTGG - Intergenic
1095677578 12:44937638-44937660 CAATGAGAACACATGGACTCAGG + Intergenic
1095695318 12:45137470-45137492 CAATGAAAACACATGGACACAGG + Intergenic
1095934855 12:47667194-47667216 CATTTAAAATACAGGTATCCAGG - Intronic
1096102122 12:48976151-48976173 CATTTAAAACACAAGTGCCCGGG + Intergenic
1096555545 12:52401309-52401331 CATTCTCAACACAGGGACGCAGG + Exonic
1097604378 12:61734311-61734333 CATTGAAAACACATGGACATGGG + Intronic
1097911770 12:64977979-64978001 CAATGAAAACACATGGACACAGG - Intergenic
1098434572 12:70454662-70454684 CAATGAAAACACATGGACACAGG - Intergenic
1098679844 12:73338843-73338865 CAATGAAAACACATGGACACAGG + Intergenic
1098714698 12:73815263-73815285 CATTGAGAACTCAGGAACTCAGG - Intergenic
1098780685 12:74682322-74682344 CAATGAGAACACATGGACTCAGG + Intergenic
1098878763 12:75894746-75894768 CAATGAGAACACAGGGACACAGG + Intergenic
1098991529 12:77069019-77069041 CAATGAAAACACATGGACACAGG - Intergenic
1099025276 12:77457814-77457836 CAATGAGAACACAGGGACTTAGG + Intergenic
1099052192 12:77793517-77793539 CAGTGAAAACACATGGACACAGG - Intergenic
1099549629 12:84026842-84026864 CATTGAGAACACATGGACACAGG + Intergenic
1099558708 12:84146278-84146300 CAATGAAAACACATGGACACAGG - Intergenic
1099687625 12:85909782-85909804 CATTGAGAACACATGGACACAGG + Intergenic
1101067101 12:101033264-101033286 CAATGAGAACACATGGACTCAGG + Intronic
1101100941 12:101391989-101392011 CAATGAGAACACATGGACTCAGG + Intergenic
1101291623 12:103376353-103376375 CAATGAAAACACACGGACGCAGG + Intronic
1101524319 12:105514055-105514077 CAATGAAAACACATGGACACAGG - Intergenic
1101790677 12:107924175-107924197 CATTGAGAACACATGGACGCAGG + Intergenic
1102105493 12:110318388-110318410 CATTTTATGCACAGGAACTCAGG - Intronic
1102189066 12:110972311-110972333 CATGTAAAACACGGGCACTTTGG + Intergenic
1103203880 12:119112749-119112771 CATTGAGAACACATGGACACAGG + Intronic
1104172447 12:126295278-126295300 AACTTAAATCACAAGGACTCGGG + Intergenic
1104297687 12:127532253-127532275 CATTCAAAACATAAGGACACCGG - Intergenic
1104594898 12:130114300-130114322 CACTTTACACACATGGACTCAGG - Intergenic
1105665884 13:22555667-22555689 CATTAAAAAAACACGGATTCAGG + Intergenic
1105839755 13:24243875-24243897 AAATTAAAGCATAGGGACTCTGG - Intronic
1105983869 13:25546827-25546849 GATTCAAAACACAGGCAGTCTGG + Intronic
1106262562 13:28080073-28080095 CATCTAAAACACTGGGGATCTGG + Intronic
1106378593 13:29214317-29214339 CAATTAAAAGACAGAGACTGGGG - Intronic
1106651328 13:31693261-31693283 CAATGAGAACACAGGGACACAGG - Intergenic
1106889687 13:34231402-34231424 CATTGAGAACACATGGACACAGG - Intergenic
1106983313 13:35316302-35316324 CAATGAGAACACATGGACTCAGG - Intronic
1106996729 13:35492791-35492813 CACTTAAAGCACTGGGACTGAGG + Intronic
1107284803 13:38779174-38779196 CAATGAGAACACAGGGACACAGG + Intronic
1107534695 13:41316603-41316625 CATTTAAAAAACAGGAAATGTGG - Intronic
1108099821 13:46943015-46943037 CAATGAGAACACAGGGACACAGG + Intergenic
1108218232 13:48206804-48206826 CAATGAGAACACATGGACTCAGG + Intergenic
1108911487 13:55557534-55557556 CAATGAAAACACATGGACACAGG + Intergenic
1109013746 13:56981813-56981835 CAATGAGAACACAGGGACACAGG - Intergenic
1109016756 13:57025451-57025473 CATTGAGAACACATGGACACAGG - Intergenic
1109331325 13:60934399-60934421 CAATGAGAACACATGGACTCAGG - Intergenic
1109980276 13:69897911-69897933 CAGTTAAACCTCAGGAACTCAGG + Intronic
1110530852 13:76596003-76596025 CAATGAGAACACAGGGACACAGG + Intergenic
1110540567 13:76702383-76702405 CAATTAGAACACATGGACACAGG + Intergenic
1110752866 13:79136316-79136338 CAATGAGAACACAGGGACACAGG + Intergenic
1110825248 13:79964399-79964421 CAATGAAAACACATGGACACAGG + Intergenic
1110829740 13:80017464-80017486 CAATGAAAACACATGGACACAGG + Intergenic
1110939215 13:81328405-81328427 CAGTGAGAACACATGGACTCAGG - Intergenic
1110961098 13:81627284-81627306 CAATTAGAACACACGGACACAGG - Intergenic
1111404879 13:87790774-87790796 CAATGAAAACACATGGACACAGG - Intergenic
1111506592 13:89197584-89197606 CAATGAAAACACATGGACACAGG + Intergenic
1111529011 13:89511897-89511919 CAATTAGAACACATGGACACAGG + Intergenic
1111558612 13:89913655-89913677 CATGAAAAAAACAGGAACTCAGG - Intergenic
1111573101 13:90113859-90113881 CAATGAGAACACAGGGACCCAGG + Intergenic
1111628486 13:90819126-90819148 CAATGAAAACACATGGACACAGG + Intergenic
1111998894 13:95192133-95192155 CATTTATAAAACAGGGGCTTGGG - Intronic
1112268040 13:97943506-97943528 CAATGAGAACACATGGACTCAGG + Intergenic
1113049452 13:106193314-106193336 CAGTAAGAACACAGGGACACAGG + Intergenic
1113170789 13:107500899-107500921 CAATGAAAACACATGGACACAGG + Intronic
1113213275 13:108007671-108007693 CAGTAAAAACACAGGTTCTCAGG - Intergenic
1113245601 13:108391307-108391329 CAATGAAAACACATGGACACAGG - Intergenic
1113409843 13:110075303-110075325 CAATGAGAACACAGGGACACAGG - Intergenic
1113532399 13:111037793-111037815 CATTGAAATCCCAGGGGCTCTGG + Intergenic
1113748201 13:112760789-112760811 GATTTAAAACACAGTGGCCCGGG + Intronic
1114042273 14:18689966-18689988 CAATGAGAACACAGGGACACGGG + Intergenic
1114939952 14:27596507-27596529 CAATGAGAACACAGGGACACAGG - Intergenic
1115792204 14:36892742-36892764 CATTGAGAACACATGGACACAGG - Intronic
1115872895 14:37825269-37825291 CATTTAATAAACAAGGAATCAGG - Intronic
1115882494 14:37935338-37935360 CAGTGAAAACACATGGACACAGG - Intronic
1115911304 14:38259419-38259441 CAATGAAAACACATGGACACAGG - Intergenic
1116233876 14:42253436-42253458 CAATGAAAACACATGGACACAGG + Intergenic
1116417724 14:44698884-44698906 CAATGAGAACACAGGGACACAGG + Intergenic
1116486856 14:45459848-45459870 CAATGAGAACACAGGGACACAGG - Intergenic
1116692535 14:48128145-48128167 CAATTAGAACACATGGACACAGG - Intergenic
1116915217 14:50518437-50518459 CAGTGAGAACACAGGGACACAGG - Intronic
1117306364 14:54478975-54478997 GATTTGTAACACAGGGACACTGG - Intronic
1117853009 14:59994808-59994830 CAATGAAAACACATGGACACAGG + Intronic
1117931861 14:60851745-60851767 CAGTGAAAACACATGGACACAGG - Intronic
1119978593 14:79054107-79054129 CAATGAAAACACATGGACACAGG + Intronic
1119993030 14:79220947-79220969 CAATGAAAACACATGGACACAGG - Intronic
1120041066 14:79753517-79753539 CAATGAAAACACATGGACACAGG + Intronic
1120122169 14:80694696-80694718 CAATGAGAACACATGGACTCAGG + Intronic
1120276318 14:82377891-82377913 CAATGAAAACACATGGACACAGG + Intergenic
1120491553 14:85184738-85184760 AATTTAAAAAACAAAGACTCTGG + Intergenic
1120674234 14:87401938-87401960 CATTTATAAGAAAGGAACTCAGG + Intergenic
1120918101 14:89727851-89727873 CATTTAAGACACATGGTCTCTGG + Intergenic
1121102730 14:91261306-91261328 CACTTAAACCACAGGTGCTCAGG - Intergenic
1121655354 14:95591513-95591535 CAATGAAAACACATGGACACAGG + Intergenic
1122433621 14:101676149-101676171 CAATGAGAACACATGGACTCAGG + Intergenic
1122473060 14:101985130-101985152 GATTTAAAACCCAGGAAGTCTGG - Intronic
1123576085 15:21670677-21670699 CAGTGAGAACACAGGGACACAGG - Intergenic
1123612706 15:22113151-22113173 CAGTGAGAACACAGGGACACAGG - Intergenic
1124167923 15:27345077-27345099 CATTTTAAACATAAAGACTCAGG - Intronic
1124182419 15:27489072-27489094 CAATGAGAACACATGGACTCAGG - Intronic
1125362773 15:38881622-38881644 CATTGAGAACACAGGGACACAGG + Intergenic
1125977511 15:43967961-43967983 CAATGAAAACACATGGACACAGG - Intronic
1126470180 15:49001656-49001678 CAGTTAGAACACATGGACACAGG - Intronic
1126818005 15:52472586-52472608 CAATGAGAACACAGGGACACAGG - Intronic
1127055550 15:55127500-55127522 CAATGAAAACACATGGACACAGG + Intergenic
1128496917 15:68204053-68204075 CTTTTAAAACACAGGGCCCGGGG - Intronic
1129073819 15:72974451-72974473 CAATTAAAAAACAGGGACAGAGG - Intergenic
1129369182 15:75077667-75077689 CATTTACAATCCAGGGCCTCAGG - Intronic
1129489527 15:75909960-75909982 CAATGAAAACACATGGACACAGG - Intronic
1130357432 15:83146308-83146330 CATTTAACACACAGGGCCATGGG + Intronic
1130484114 15:84388241-84388263 CAATGAGAACACAGGGACACAGG - Intergenic
1130786280 15:87100256-87100278 CAATGAGAACACATGGACTCAGG + Intergenic
1131202411 15:90410633-90410655 CAATGAAAACACATGGACACAGG + Intronic
1131777036 15:95814073-95814095 CAATGAAAACACATGGACACAGG - Intergenic
1131862911 15:96673888-96673910 CAATTAGAACACATGGACACAGG - Intergenic
1131939242 15:97542409-97542431 CAATGAAAACACATGGACACAGG - Intergenic
1131991498 15:98097341-98097363 CAATGACAACACATGGACTCAGG + Intergenic
1132106671 15:99067742-99067764 TTTTTAAAATAAAGGGACTCTGG - Intergenic
1202984953 15_KI270727v1_random:404922-404944 CAGTGAGAACACAGGGACACAGG - Intergenic
1132706449 16:1245599-1245621 CTTTTAAAACCCACGGCCTCAGG - Intergenic
1134359080 16:13513783-13513805 CAATGAAAACACATGGACACAGG + Intergenic
1134403233 16:13931759-13931781 CATTTAAAACACAGCTTCTTTGG - Intronic
1134652202 16:15918636-15918658 CAATGAAAACACATGGACACAGG + Intergenic
1134760303 16:16708720-16708742 CAATGAAAACACATGGACGCAGG - Intergenic
1134985768 16:18650485-18650507 CAATGAAAACACATGGACGCAGG + Intergenic
1136407440 16:30056471-30056493 CATGTAAAACACAGCAACTTTGG - Intronic
1136504175 16:30692265-30692287 CTTTTAAACCAGGGGGACTCTGG - Intergenic
1137462733 16:48680220-48680242 CAATGAAAACACATGGACACAGG + Intergenic
1137784748 16:51129116-51129138 CAGTTAATACACAGTGACTAAGG + Intergenic
1137894412 16:52195470-52195492 CAATGAAAACACATGGACACAGG - Intergenic
1138739682 16:59293621-59293643 CAATGAAAACACATGGACACAGG - Intergenic
1139214124 16:65110691-65110713 AATTTAAAACACAGGGGATTTGG + Intronic
1139457355 16:67092125-67092147 CAATTAGAACACATGGACACAGG - Intronic
1139992215 16:70949255-70949277 CAATGAAAACACATGGACACAGG + Intronic
1140295683 16:73707537-73707559 CAATGAGAACACAGGGACACAGG + Intergenic
1140437898 16:74963536-74963558 CAGTGAAAACACATGGACACAGG + Intronic
1140563135 16:76007824-76007846 CAGCAAAAACACAGGGACTGGGG - Intergenic
1141126628 16:81405092-81405114 CATTGAGAACACATGGACACAGG - Intergenic
1142918005 17:3159317-3159339 CAGTGAGAACACAGGGACACAGG + Intergenic
1142943565 17:3404636-3404658 CAATGAAAACACATGGACACAGG - Intergenic
1143279721 17:5744105-5744127 CATTGAGAACACATGGACACAGG - Intergenic
1143312565 17:6004311-6004333 CATGCAGAACACAGGGACACAGG + Intronic
1143876251 17:9992798-9992820 CAATGAGAACACAGGGACACAGG - Intronic
1143876621 17:9996368-9996390 CAATGAGAACACAGGGACACAGG + Intronic
1144089766 17:11845199-11845221 CAATGAAAACACATGGACACAGG - Intronic
1144379239 17:14677219-14677241 CAATGAAAACACATGGACACAGG - Intergenic
1145830497 17:27912335-27912357 CAATGAGAACACAGGGACACAGG - Intergenic
1146528869 17:33590903-33590925 CATCTAAACCATAGGTACTCAGG + Intronic
1146730148 17:35186228-35186250 CATTTCCAACACATGAACTCTGG + Intronic
1146743792 17:35310128-35310150 CAATGAAAACACATGGACACAGG + Intergenic
1147768081 17:42850135-42850157 CATCCCAAACACAGTGACTCTGG + Exonic
1148609855 17:48957754-48957776 TATTTTAAAGACAGGGTCTCAGG + Intergenic
1148957292 17:51364397-51364419 CATTTAAAATACAGATACCCAGG - Intergenic
1148972364 17:51494950-51494972 CAATGAGAACACATGGACTCAGG - Intergenic
1149191417 17:54067664-54067686 CAATTACAACACATGGACACAGG - Intergenic
1149198595 17:54154674-54154696 CACTGAGAACACAGGGACACAGG + Intergenic
1149228083 17:54499031-54499053 CAATGAAAACACATGGACACGGG + Intergenic
1149399139 17:56276060-56276082 CAATGAAAACACATGGACACAGG - Intronic
1149409458 17:56390241-56390263 CAATTAGAACACATGGACACAGG - Intronic
1152106984 17:78336104-78336126 AATTTAAGACACAGGGTCTTAGG + Intergenic
1152883595 17:82834664-82834686 CAGTGAAAACACATGGACACAGG + Intronic
1153540524 18:6149242-6149264 CAATGAAAACACATGGACACAGG - Intronic
1154459018 18:14560757-14560779 CAATGAGAACACAGGGACACAGG - Intergenic
1154535112 18:15396870-15396892 CAATGAGAACACATGGACTCAGG - Intergenic
1155333771 18:24744607-24744629 CATTTCAAACACAGGAACTTTGG - Intergenic
1155633750 18:27925747-27925769 CAATGAAAACACATGGACACAGG - Intergenic
1155648213 18:28107783-28107805 CATTTAAAAAAAAAGGAATCAGG + Intronic
1155718680 18:28981953-28981975 CAATTAGAACACATGGACACAGG + Intergenic
1156210323 18:34933093-34933115 CATCTAGAACACATGGATTCCGG + Intergenic
1156550921 18:38015701-38015723 CAATGAAAACACATGGACACAGG - Intergenic
1156754936 18:40512175-40512197 CAATGAGAACACAGGGACACAGG - Intergenic
1156810040 18:41237888-41237910 CAATGAAAACACATGGACACTGG + Intergenic
1157111879 18:44828309-44828331 CAATGAAAACAAAGGGACTCAGG + Intronic
1158030010 18:52951477-52951499 CAATGAGAACACAGGGACACAGG - Intronic
1158812219 18:61050907-61050929 CATTGAGAACACATGGACACAGG - Intergenic
1158812468 18:61053617-61053639 CATTGAAATCACTGGGAGTCTGG + Intergenic
1159127361 18:64239251-64239273 CATTTAGAAAGCAGGGACTCAGG + Intergenic
1163172589 19:15542748-15542770 CAATGAAAACACACGGACACAGG - Intronic
1163180716 19:15599223-15599245 CAATGAGAACACAGGGACACAGG + Intergenic
1163972621 19:20813614-20813636 CATTGAGAACACATGGACACAGG + Intronic
1164093583 19:21983798-21983820 CAATGAGAACACAGGGACACAGG + Intronic
1164151006 19:22551397-22551419 CAGTGAAAACACACGGACACAGG + Intergenic
1164420248 19:28085062-28085084 CAATGAGAACACAGGGACACAGG + Intergenic
1164620520 19:29693208-29693230 CATTTTAAACACTAGAACTCAGG + Intergenic
1165607881 19:37122410-37122432 CAGTGAGAACACAGGGACACAGG + Intronic
1165969884 19:39618683-39618705 CAATGAGAACACATGGACTCAGG - Intergenic
1167296345 19:48652414-48652436 AAATAAAAACACAGGGACTGTGG + Intergenic
1167371758 19:49086686-49086708 CATTTAAAACAGAGAAACTGAGG - Intronic
925708103 2:6709748-6709770 CAATGAAAACACATGGACACAGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927328150 2:21830701-21830723 CATCTAACACATAAGGACTCAGG - Intergenic
927366963 2:22307896-22307918 CAATGAGAACACAGGGACACAGG + Intergenic
927385157 2:22524183-22524205 CAATGAAAACACATGGACACAGG + Intergenic
927715168 2:25347187-25347209 CATTGAATACTCAGGGACCCTGG + Intergenic
928822677 2:35380896-35380918 CATTAACAACACAGGGATTGTGG + Intergenic
928892378 2:36218941-36218963 CAATGAAAACACATGGACACAGG + Intergenic
929172204 2:38943404-38943426 AAATGAAAACAAAGGGACTCAGG - Intronic
929293189 2:40216199-40216221 CATTGAGAACACATGGACACAGG - Intronic
929964363 2:46522436-46522458 CATTGAGAACACATGGACACAGG - Intronic
930222489 2:48759161-48759183 CAATGAAAACACATGGACACAGG - Intronic
930322584 2:49875254-49875276 CAATGAGAACACAGGGACACAGG - Intergenic
930496211 2:52147516-52147538 CAATAAGAACACAGGGACACAGG - Intergenic
931624341 2:64243473-64243495 CCTTCAAAAAACAGGGATTCTGG + Intergenic
931846768 2:66212163-66212185 CATTGAGAACACATGGACACAGG + Intergenic
932014064 2:68006762-68006784 CATTGAGAACACATGGACACAGG + Intergenic
932379107 2:71265708-71265730 CAGTGAAAACACATGGACACAGG - Intergenic
932508927 2:72265447-72265469 CAATGAAAACACAGGGACACAGG - Intronic
932847169 2:75147604-75147626 CAATGAAAACACATGGACACAGG - Intronic
933161858 2:79033986-79034008 CAATTGAAACACATGGACACAGG + Intergenic
933305921 2:80598249-80598271 CAATGAAAACACATGGACACAGG + Intronic
933467739 2:82677038-82677060 CAATGAAAACACATGGACACAGG + Intergenic
933557816 2:83852053-83852075 CAGTGAGAACACAGGGACACAGG + Intergenic
934125912 2:88889808-88889830 CAATGAAAACACATGGACACAGG - Intergenic
934592694 2:95570493-95570515 CAATGAGAACACAGGGACACAGG + Intergenic
935246226 2:101220885-101220907 CAATGAGAACACAGGGACACAGG + Intronic
935508235 2:103934212-103934234 CATTTAAAATACATGGTTTCAGG + Intergenic
935527774 2:104192598-104192620 CATTTAAAACAAATGGAGTCGGG + Intergenic
935730061 2:106057842-106057864 CATTGAGAACACACGGACACAGG + Intergenic
935821643 2:106898729-106898751 CAATGAAAACACATGGACACAGG - Intergenic
936945716 2:117929057-117929079 CAATGAAAACACATGGACACAGG + Intronic
937137663 2:119568534-119568556 CAATGAAAACACATGGACACAGG - Intronic
937738545 2:125320201-125320223 CAATGAAAACACATGGACACAGG - Intergenic
937991053 2:127662576-127662598 CATTGAGAACACATGGACACAGG + Intronic
938775594 2:134538742-134538764 CATTTCATACACATGGAATCAGG - Intronic
939033805 2:137107333-137107355 CATTGAGAACACATGGACACAGG + Intronic
939161036 2:138589252-138589274 CAATGAAAACACATGGACACAGG + Intergenic
939383156 2:141462440-141462462 CAGTGAAAACACATGGACACAGG + Intronic
939434425 2:142155605-142155627 CAATGAAAACACATGGACACAGG + Intergenic
939457414 2:142455255-142455277 CAATGAGAACACATGGACTCAGG + Intergenic
939526704 2:143304401-143304423 CAATGAGAACACAGGGACACAGG + Intronic
939607498 2:144270601-144270623 CAATGAAAACACATGGACACAGG + Intronic
939672048 2:145024707-145024729 CATTGAGAACACATGGACACAGG - Intergenic
939705070 2:145442549-145442571 CAATGAGAACACAGGGACACAGG + Intergenic
939724345 2:145697815-145697837 CAATGAGAACACAGGGACACAGG + Intergenic
939947505 2:148427586-148427608 CAATGAAAACACATGGACACAGG + Intronic
940098909 2:150010863-150010885 CAATGAAAACACATGGACACAGG + Intergenic
940193450 2:151066735-151066757 CAATGAAAACACATGGACACAGG - Intergenic
940379852 2:153001656-153001678 CAATGAGAACACAGGGACACAGG + Intergenic
940821919 2:158365603-158365625 CAATGAAAACACATGGACACAGG + Intronic
941040918 2:160622806-160622828 CAATGAGAACACAGGGACACAGG + Intergenic
941082004 2:161072481-161072503 CAATGAAAACACATGGACACAGG - Intergenic
941554156 2:166954861-166954883 CAATGAGAACACAGGGACACAGG + Intronic
941678915 2:168374641-168374663 CAATGAGAACACATGGACTCAGG + Intergenic
941715793 2:168761953-168761975 CAATGAGAACACAGGGACACAGG + Intronic
941779822 2:169432097-169432119 CAATGAAAACACATGGACACAGG + Intergenic
941840041 2:170072369-170072391 CAATGAGAACACAGGGACACAGG + Intronic
942366700 2:175235812-175235834 CAGTGAAAACACATGGACACGGG + Intergenic
942534831 2:176952032-176952054 CAATGAAAACACATGGACACAGG + Intergenic
942691064 2:178585636-178585658 CAATGAAAACACATGGACACAGG - Intronic
942851410 2:180492242-180492264 CAATGAGAACACATGGACTCAGG - Intergenic
942864696 2:180659200-180659222 CAATGAGAACACAGGGACCCAGG - Intergenic
942872033 2:180746448-180746470 CAATGAGAACACACGGACTCAGG - Intergenic
943163373 2:184283700-184283722 CAATGAAAACACATGGACACAGG - Intergenic
943478479 2:188388074-188388096 CAATGAGAACACAGGGACACAGG - Intronic
944063979 2:195599911-195599933 CAATGAAAACACATGGACACAGG - Intronic
944284463 2:197932563-197932585 CAATGAAAACACATGGACACAGG - Intronic
944435060 2:199680033-199680055 CATTAAAAACTCAAGGACCCAGG - Intergenic
944908137 2:204283189-204283211 CAATGAAAACACATGGACACAGG - Intergenic
945024840 2:205610330-205610352 GATTTCAAACACAGGGTCTTAGG - Intronic
945341369 2:208659871-208659893 CAATGAAAACACATGGACACAGG - Intronic
945359448 2:208879416-208879438 TATTTTAAACAAAGGGACTTTGG + Intergenic
945524539 2:210871871-210871893 CAATGAGAACACAGGGACACAGG + Intergenic
945612535 2:212022479-212022501 CAATGAAAACACATGGACACAGG + Intronic
945648209 2:212527897-212527919 CAATGAGAACACAGGGACACAGG - Intronic
945664488 2:212723774-212723796 CATTCAAAAGATAGGGATTCTGG + Intergenic
945714351 2:213338809-213338831 CAATCAAAACACATGGACACAGG + Intronic
945927956 2:215825258-215825280 CAATGAGAACACAGGGACACAGG + Intergenic
946547326 2:220758793-220758815 CAATGAGAACACAGGGACACAGG + Intergenic
946597971 2:221327468-221327490 CATTGAGAACACATGGACACAGG + Intergenic
946706068 2:222460078-222460100 CAGTCAAAACCCAGGGCCTCCGG + Intronic
946713172 2:222526810-222526832 CAGTGAAAACACATGGACACAGG + Intronic
946796139 2:223355777-223355799 CATTGAGAACACATGGACACAGG + Intergenic
947074580 2:226328557-226328579 CAATGAGAACACAGGGACACAGG + Intergenic
947439254 2:230103756-230103778 CAATGAAAACACATGGACACAGG - Intergenic
947600896 2:231449418-231449440 CATTGAAAACACAGGTAGTTTGG - Intergenic
948504584 2:238419865-238419887 CATTTAAAACACAGGCAAAATGG - Intergenic
948504665 2:238420635-238420657 CATCACAAGCACAGGGACTCAGG - Intergenic
1169418471 20:5438797-5438819 CAATGAGAACACAGGGACACAGG - Intergenic
1169457057 20:5761203-5761225 CAGTGAGAACACAGGGACACAGG + Intronic
1170096865 20:12655392-12655414 CAGTGAAAACACATGGACACAGG + Intergenic
1170682318 20:18537533-18537555 CATTGAGAACACATGGACACAGG + Intronic
1171075711 20:22120872-22120894 CAATGAGAACACAGGGACACTGG + Intergenic
1171315801 20:24193590-24193612 CATTTAGTTCACAGGGACTTTGG + Intergenic
1171984671 20:31651352-31651374 CAATGAAAACACATGGACACAGG - Intergenic
1172327750 20:34050177-34050199 CATGTACAATTCAGGGACTCTGG - Intronic
1173440442 20:43070772-43070794 CAATGAAAACACTTGGACTCAGG + Intronic
1174997011 20:55581394-55581416 CAATGAGAACACAGGGACACAGG + Intergenic
1175068299 20:56309594-56309616 CAATGAAAACACATGGACACAGG + Intergenic
1175309594 20:58002641-58002663 CAATGAGAACACAGGGACACAGG + Intergenic
1175854391 20:62112563-62112585 GATTTCAAACACAAGGACTATGG + Intergenic
1176344061 21:5724836-5724858 CAATGAAAACACATGGACACAGG - Intergenic
1176500766 21:7599620-7599642 CAATGAAAACACATGGACACAGG + Intergenic
1176538382 21:8122905-8122927 CAATGAAAACACATGGACACAGG - Intergenic
1176815122 21:13592582-13592604 CAATGAGAACACAGGGACACAGG + Intergenic
1177086584 21:16712432-16712454 CAATGAAAACACATGGACACAGG - Intergenic
1177159048 21:17528408-17528430 CATTTCAAAAAAAGGGTCTCTGG - Intronic
1177240069 21:18444430-18444452 CAATTAGAACACATGGACACAGG + Intronic
1177264813 21:18768947-18768969 AATTTATAACACAGGAACTTTGG - Intergenic
1177720017 21:24893539-24893561 CAATTAGAACACATGGACACAGG - Intergenic
1178405125 21:32317300-32317322 CTCTTTAAACACAGGGAATCAGG + Intronic
1178616548 21:34139133-34139155 CATTGAGAACACATGGACACTGG + Intronic
1178758828 21:35380619-35380641 CAATGAAAACACATGGACACAGG + Intronic
1178772507 21:35518830-35518852 AAATAAAAACACAGGGCCTCCGG - Intronic
1179059120 21:37963513-37963535 CAATGAAAACACAGGGACACAGG - Intronic
1179378399 21:40874782-40874804 CATTGAGAACACATGGACACAGG + Intergenic
1179899843 21:44384652-44384674 CATTTACAACACATGAACTTTGG + Intronic
1180575699 22:16771915-16771937 CAATGAGAACACAGGGACACAGG + Intergenic
1180587761 22:16907998-16908020 CAATGAGAACACATGGACTCAGG - Intergenic
1181362773 22:22351413-22351435 CATGGAAAACACAGGAGCTCAGG + Intergenic
1181365534 22:22374195-22374217 CATGGAAAACACAGGAGCTCAGG + Intergenic
1181898587 22:26133089-26133111 CAATGAGAACACAGGGACACAGG - Intergenic
1183156555 22:36080053-36080075 CAATAAAAACACATGGACACAGG - Intergenic
1183815931 22:40300493-40300515 CATTGAAAAGACCTGGACTCAGG - Exonic
1184395433 22:44233417-44233439 CAATGAGAACACAGGGACACAGG - Intergenic
1184930004 22:47673999-47674021 CAATGAAAACACATGGACACAGG + Intergenic
1203243329 22_KI270733v1_random:39261-39283 CAATGAAAACACATGGACACAGG - Intergenic
949162505 3:896906-896928 CAATTAGAACACATGGACACAGG - Intergenic
949636806 3:5991463-5991485 CAATGAAAACACATGGACACAGG + Intergenic
950293787 3:11810065-11810087 CATTTCAAACACAGGGAGACTGG + Intronic
950326026 3:12110656-12110678 CTTGTACAGCACAGGGACTCTGG + Intronic
950959493 3:17090321-17090343 CATCTAGAACCCAGAGACTCTGG - Exonic
951008678 3:17650090-17650112 CAATGAAAACACATGGACACAGG + Intronic
951316702 3:21196076-21196098 CAATGAAAACACATGGACACAGG + Intergenic
951323938 3:21279922-21279944 CAATGAAAACACATGGACACAGG - Intergenic
951548130 3:23849551-23849573 CAATGAAAACACATGGACACAGG - Intronic
951767861 3:26220124-26220146 CAATGAAAACACATGGACACAGG - Intergenic
951787389 3:26437396-26437418 CAATGAAAACACATGGACACAGG + Intergenic
951861475 3:27258414-27258436 CAATGAGAACACATGGACTCAGG - Intronic
951994583 3:28713184-28713206 CAATAAAAACACATGGACACAGG - Intergenic
952000098 3:28775175-28775197 CAATGAGAACACAGGGACACAGG - Intergenic
952087137 3:29837792-29837814 CATTTAAAAGAAAATGACTCAGG - Intronic
952511489 3:34061286-34061308 CACTGAAAACACATGGACACAGG + Intergenic
952556797 3:34540838-34540860 CAATGAGAACACAGGGACACAGG + Intergenic
952728318 3:36613167-36613189 CAATGAAAACACATGGACACAGG + Intergenic
952842060 3:37654886-37654908 CAATGACAACACAGGGACACAGG - Intronic
953052041 3:39353416-39353438 CAATGAGAACACAGGGACACAGG + Intergenic
954474606 3:50732203-50732225 CACTGAGAACACATGGACTCAGG + Intronic
954732748 3:52678436-52678458 ACTTTAATACACATGGACTCTGG + Intronic
955583554 3:60451320-60451342 GATTTATAACACAGGGAACCAGG - Intronic
956241551 3:67136200-67136222 CAATGAAAACACATGGACACAGG - Intergenic
956535428 3:70270831-70270853 CAATTAGAACACATGGACACAGG + Intergenic
956566569 3:70645171-70645193 CAATGAGAACACAGGGACACAGG - Intergenic
957000888 3:74883369-74883391 CATTTAAAACACAGGATCCAGGG + Intergenic
957092551 3:75746067-75746089 CAATGAAAACACATGGACACAGG - Intronic
957104442 3:75868553-75868575 CAATGAGAACACAGGGACACAGG + Intergenic
957141125 3:76358966-76358988 CAATGAGAACACATGGACTCAGG - Intronic
957258691 3:77872184-77872206 CAATGAAAACACATGGACACAGG - Intergenic
957390487 3:79560330-79560352 CAATTAGAACACATGGACACAGG + Intronic
957399345 3:79688166-79688188 CAATGAAAACACATGGACACAGG + Intronic
957454907 3:80428908-80428930 CAATGAAAACACACGGACACAGG - Intergenic
957663023 3:83185226-83185248 CAGTGAAAACACATGGACACAGG - Intergenic
957749258 3:84391128-84391150 CAATTAGAACACATGGACACAGG - Intergenic
957768969 3:84662971-84662993 CAATGAAAACACATGGACACAGG - Intergenic
958101667 3:89019801-89019823 CATTATAAACACATGGCCTCAGG + Intergenic
958457120 3:94345819-94345841 CAATAAAAACACATGGACTTAGG + Intergenic
958825766 3:99028677-99028699 CAATGAAAACACATGGACACAGG + Intergenic
958922343 3:100121285-100121307 CAATGAAAACACACGGACACAGG - Intronic
959059691 3:101604804-101604826 CAATGAGAACACATGGACTCAGG - Intergenic
959387328 3:105726746-105726768 CATTGAGAACACATGGACCCAGG - Intronic
959525762 3:107374593-107374615 GAGGTAAAACACATGGACTCTGG + Intergenic
959775163 3:110150623-110150645 CAATTAGAACACATGGACACAGG - Intergenic
959834134 3:110898379-110898401 CAATGAAAACACATGGACACAGG - Intergenic
960128267 3:114024647-114024669 CAATGAGAACACAGGGACACAGG + Intronic
960250291 3:115444053-115444075 CAGTGAGAACACATGGACTCAGG - Intergenic
961937476 3:130600661-130600683 CATTGAGAACACATGGACACAGG + Intronic
962125753 3:132615623-132615645 CAATGAAAACACATGGACACAGG + Intronic
962340451 3:134577816-134577838 CAATGAGAACACAGGGACACAGG - Intergenic
963566264 3:146934893-146934915 CAGTGAGAACACATGGACTCAGG + Intergenic
963650991 3:147979782-147979804 CAATGAAAACACATGGACACAGG + Intergenic
963931306 3:151006681-151006703 CAATTAGAACACATGGACACAGG - Intergenic
964258723 3:154810169-154810191 CATTGAGAACACATGGACACAGG + Intergenic
964581650 3:158246194-158246216 CAATGAGAACACAGGGACACAGG + Intronic
964701158 3:159569098-159569120 CATTTAAAACACAGGGACTCAGG - Intronic
965194816 3:165580335-165580357 CAATTAGAACACATGGACACAGG + Intergenic
965319840 3:167239740-167239762 CATGAATAACACAGGGACTTGGG - Intergenic
965343894 3:167523590-167523612 CAATTAGAACACATGGACACAGG - Intronic
965365679 3:167796551-167796573 CAATTAGAACACATGGACACAGG - Intronic
965479046 3:169194261-169194283 CAATGAAAACACATGGACACAGG + Intronic
966101745 3:176277609-176277631 CAATGAAAACACATGGACACAGG - Intergenic
966128255 3:176605859-176605881 CAATGAGAACACAGGGACACAGG + Intergenic
966450594 3:180055993-180056015 CAATGAGAACACAGGGACACAGG + Intergenic
966477094 3:180361580-180361602 CAATGAAAACACATGGACACAGG - Intergenic
967379190 3:188838803-188838825 CAATGAAAACACATGGACACAGG + Intronic
967707248 3:192665553-192665575 CAATGAGAACACAGGGACACAGG + Intronic
967771118 3:193334327-193334349 CATGTAAAAGACTGGGACTCAGG + Intronic
967802522 3:193679077-193679099 CATTGAGAACACATGGACACAGG + Intronic
968475777 4:807271-807293 CATTGAGAACACATGGACACAGG + Intronic
968828467 4:2916729-2916751 CAATTAGAACACATGGACACAGG - Intronic
970037886 4:11759640-11759662 AATTTAAAGCACGGGGACACTGG + Intergenic
970612086 4:17735128-17735150 CAATGAAAACACATGGACACAGG + Intronic
970654848 4:18219503-18219525 CAATAAAAACACATGGACACAGG - Intergenic
971015036 4:22479942-22479964 CAATGAAAACACATGGACACAGG + Intronic
971285418 4:25284687-25284709 CAGTGAGAACACAGGGACACAGG - Intergenic
971438838 4:26657279-26657301 CAATGAAAACACATGGACACAGG - Intronic
971510870 4:27421671-27421693 CAATGAGAACACAGGGACACAGG - Intergenic
971634850 4:29045380-29045402 CATTGAGAACACATGGACACTGG + Intergenic
971722776 4:30268086-30268108 CAATTAAAACACTTGGACACAGG + Intergenic
971740739 4:30517356-30517378 CAGTGAGAACACAGGGACACAGG + Intergenic
971771899 4:30908046-30908068 CAATTAGAACACATGGACACAGG + Intronic
971974589 4:33667377-33667399 CAATGAAAACACATGGACACAGG + Intergenic
972249867 4:37288107-37288129 CATTGAGAACACATGGACACAGG + Intronic
972269384 4:37495656-37495678 CAGTTAGAACACACGGACACAGG + Intronic
972315642 4:37923150-37923172 CAGTGAGAACACATGGACTCAGG - Intronic
973018171 4:45167349-45167371 CATTGAGAACACATGGACACAGG - Intergenic
973082150 4:46006682-46006704 CAATGAAAACACATGGACACAGG - Intergenic
973678766 4:53293924-53293946 CAATTAAAATACATGGACACAGG - Intronic
973743417 4:53940229-53940251 CAATGAAAACACATGGACACAGG + Intronic
973799797 4:54466055-54466077 CAATGAAAACACATGGACACAGG + Intergenic
973920811 4:55682865-55682887 CAATGAGAACACAGGGACACAGG - Intergenic
973950947 4:56013649-56013671 CAGTTAAAATATAGGGACCCTGG + Intronic
973995036 4:56450118-56450140 CACTGAAAACACATGGACACAGG + Intronic
974129979 4:57742642-57742664 CAATGAAAACACATGGACACAGG - Intergenic
974147230 4:57963910-57963932 CAATTAGAACACATGGACACAGG + Intergenic
974170380 4:58259065-58259087 CAATGAGAACACATGGACTCAGG - Intergenic
974180716 4:58381006-58381028 CAATGAGAACACAGGGACTCAGG - Intergenic
974216450 4:58853476-58853498 CATTGAGAACACATGGACACAGG + Intergenic
974276080 4:59722772-59722794 CAATGAGAACACAGGGACACAGG + Intergenic
974536215 4:63179028-63179050 CAATGAGAACACAGGGACACAGG - Intergenic
974760899 4:66272162-66272184 CATTAAGAACACATGGACACAGG + Intergenic
974920832 4:68237133-68237155 CAATGAAAACACATGGACACAGG - Intronic
975001349 4:69226366-69226388 CAATGAAAACACATGGACACAGG - Intergenic
975012452 4:69374312-69374334 CAATGAAAACACATGGACACAGG + Intronic
975162795 4:71143142-71143164 CAATGAAAACACATGGACACAGG - Intergenic
975249667 4:72163969-72163991 CAATGAGAACACATGGACTCAGG - Intergenic
975476594 4:74830737-74830759 CAGTGAAAACACATGGACACAGG + Intergenic
975902404 4:79168064-79168086 CAATTAGAACACATGGACACAGG - Intergenic
976065356 4:81181028-81181050 CATTGAGAACACATGGACACAGG - Intronic
976120687 4:81777777-81777799 CAATTAGAACACATGGACACAGG - Intronic
976248116 4:83023905-83023927 CAATGAAAACACATGGACACAGG + Intergenic
976355558 4:84113244-84113266 CATTGAGAACACATGGACACAGG + Intergenic
976510387 4:85902019-85902041 CAATGAGAACACATGGACTCAGG - Intronic
976655400 4:87483280-87483302 CAGTGAAAACACATGGACACAGG - Intronic
976682712 4:87775020-87775042 CAATGAAAACACATGGACACAGG + Intergenic
976894219 4:90088814-90088836 CAATGAAAACACATGGACACAGG - Intergenic
977154926 4:93560025-93560047 CAATGAAAACACATGGACACAGG + Intronic
977293673 4:95190287-95190309 CAATGAGAACACAGGGACACAGG + Intronic
977363362 4:96034729-96034751 CAATGAGAACACAGGGACACAGG + Intergenic
977999349 4:103538022-103538044 CAATGAAAACACATGGACACCGG - Intergenic
978078378 4:104562324-104562346 CAATGAGAACACAGGGACACAGG - Intergenic
978476611 4:109138180-109138202 CAATGAAAACACATGGACACAGG - Intronic
978560011 4:110022918-110022940 CAATGAAAACACATGGACACAGG - Intergenic
978592529 4:110340959-110340981 CATTGAGAACACATGGACACAGG - Intergenic
979501525 4:121446040-121446062 CAATGAAAACACATGGACACAGG + Intergenic
979598054 4:122556061-122556083 CAATGAAAACACATGGACACAGG - Intergenic
979603078 4:122607504-122607526 CATTGAGAACACATGGACACAGG - Intergenic
979945208 4:126821659-126821681 CAATGAAAACACATGGACACAGG - Intergenic
979978082 4:127221498-127221520 CATTCAGAACACATGGACACAGG - Intergenic
980139826 4:128901468-128901490 CAATGAGAACACAGGGACACAGG + Intronic
980731856 4:136834023-136834045 CAATTAGAACACATGGACACAGG + Intergenic
980867553 4:138571049-138571071 CAATGAGAACACAGGGACACAGG + Intergenic
980885931 4:138762231-138762253 CCTTTAAAACAAAGGGAATCCGG - Intergenic
981450976 4:144897309-144897331 CATTGAGAACACATGGACACAGG + Intergenic
981663042 4:147189826-147189848 CAGTAAGAACACAGGGACCCAGG + Intergenic
981752657 4:148107793-148107815 CAATAAAAACACATGGACACAGG + Intronic
981855800 4:149290594-149290616 CAATGAAAACACACGGACACAGG + Intergenic
982195187 4:152904592-152904614 CAATGAGAACACATGGACTCAGG - Intronic
982333165 4:154204982-154205004 CATTGAGAACACATGGACACAGG - Intergenic
982872918 4:160607086-160607108 CAATGAGAACACATGGACTCAGG + Intergenic
982923838 4:161310073-161310095 GAATTAAAACACAGGCAGTCTGG - Intergenic
982942402 4:161574556-161574578 CAATGAAAACACATGGACACAGG - Intronic
983099323 4:163605853-163605875 CAATTAGAACACATGGACACAGG + Intronic
983127447 4:163971720-163971742 TATTTAAAACACAGGAACAAAGG - Intronic
983134073 4:164058069-164058091 CAATGAAAACACATGGACACAGG + Intronic
983217741 4:165017773-165017795 CAATGAGAACACAGGGACACAGG - Intergenic
983377953 4:166953882-166953904 CAATGAGAACACAGGGACACAGG + Intronic
983440767 4:167781182-167781204 CAATGAGAACACAGGGACACAGG - Intergenic
983703931 4:170634017-170634039 CAATGAAAACACATGGACACAGG - Intergenic
983995420 4:174175986-174176008 CAATGAGAACACATGGACTCAGG - Intergenic
984193411 4:176631058-176631080 CAATTATAACACATGGACACAGG + Intergenic
984270787 4:177546442-177546464 CAATGAGAACACATGGACTCAGG - Intergenic
984438561 4:179735312-179735334 CATTGAGAACACATGGACACAGG - Intergenic
984619193 4:181932961-181932983 CAATGAAAACACACGGACACAGG + Intergenic
984949682 4:184997702-184997724 CAATGAGAACACATGGACTCAGG - Intergenic
985050521 4:185986607-185986629 CAATGAGAACACAGGGACACAGG - Intergenic
985222483 4:187722697-187722719 CAATGAAAACACACGGACACAGG + Intergenic
985253415 4:188045172-188045194 CATATAAATACCAGGGACTCTGG + Intergenic
985321912 4:188722180-188722202 CAATGAAAACACATGGACACAGG - Intergenic
985352172 4:189076063-189076085 CAATGAGAACACATGGACTCAGG + Intergenic
985808184 5:2063715-2063737 CATTGAGAACACATGGACACAGG + Intergenic
985920864 5:2971961-2971983 CAATGAAAACACATGGACACAGG + Intergenic
986713160 5:10502495-10502517 ACTTTAAAACACAGGTACTCGGG - Intergenic
986823630 5:11496931-11496953 CAGTCAAAACTCAGGAACTCAGG - Intronic
986940331 5:12940551-12940573 CATTGAGAACACATGGACACGGG + Intergenic
987494574 5:18627399-18627421 CAATGAAAACACATGGACACAGG + Intergenic
987540310 5:19246508-19246530 CATTAAGAACACATGGACACTGG + Intergenic
987618800 5:20311592-20311614 CAATGAGAACACAGGGACACAGG + Intronic
987639533 5:20594865-20594887 CAATGAAAACACATGGACGCAGG - Intergenic
987824870 5:23017849-23017871 CATTTAAAACTGAGTGAATCTGG - Intergenic
988083606 5:26444657-26444679 CAATGAAAACACATGGACACAGG + Intergenic
988320231 5:29685479-29685501 CAATGAGAACACATGGACTCAGG - Intergenic
988320685 5:29691531-29691553 TATTTAAAGCATAGGGACTCAGG + Intergenic
989018768 5:36973874-36973896 CAATGAAAACACATGGACCCAGG - Intronic
989364454 5:40640210-40640232 CATTGAGAAGACATGGACTCAGG + Intergenic
989813762 5:45710775-45710797 CATTGAGAACACATGGACACAGG + Intergenic
989843119 5:46106469-46106491 CAATGAAAACACATGGACACAGG - Intergenic
989862802 5:46402537-46402559 CATTGAAAACACATGGACACAGG + Intergenic
990094702 5:52097811-52097833 CAATGAAAACACATGGACACAGG - Intergenic
990292404 5:54366084-54366106 CAATGAGAACACATGGACTCAGG + Intergenic
990340606 5:54818894-54818916 CAATGAAAACACATGGACACAGG + Intergenic
990619452 5:57543861-57543883 CAATGAAAACACATGGACACAGG - Intergenic
991009560 5:61868704-61868726 CAATGAGAACACAGGGACACAGG - Intergenic
991169056 5:63599679-63599701 CAATGAGAACACAGGGACACAGG - Intergenic
991400727 5:66248558-66248580 CAATGAAAACACATGGACACAGG - Intergenic
992276668 5:75128205-75128227 CAATGAAAACACATGGACACAGG + Intronic
993279710 5:85909750-85909772 CAATTAGAACACATGGACACAGG - Intergenic
993368238 5:87059079-87059101 CATTGAGAACACATGGACACAGG + Intergenic
993402281 5:87468295-87468317 CAATGAAAACACATGGACACAGG - Intergenic
993408889 5:87549381-87549403 CAATGAAAACACATGGACACAGG - Intergenic
993473574 5:88335960-88335982 CAATGAAAACACATGGACACAGG + Intergenic
993503672 5:88688083-88688105 CAGTTAACACACAGGTACTGGGG + Intergenic
993512869 5:88793838-88793860 CAATGAGAACACATGGACTCAGG - Intronic
993937303 5:94020218-94020240 CAATGAAAACACATGGACACGGG + Intronic
993952913 5:94198545-94198567 CAATGAGAACACAGGGACACAGG + Intronic
994378620 5:99043563-99043585 CAATGAAAACACATGGACACAGG + Intergenic
994388163 5:99157619-99157641 CAGTGAGAACACAGGGACACAGG - Intergenic
995028507 5:107452159-107452181 CATTGAGAACACATGGACACAGG + Intronic
995267924 5:110186322-110186344 CAATGAGAACACAGGGACACAGG - Intergenic
996012431 5:118495830-118495852 CAATGAGAACACAGGGACACAGG + Intergenic
996253936 5:121374758-121374780 CATTGAGAACACATGGACACAGG + Intergenic
996263106 5:121499085-121499107 CAATGAAAACACATGGACACAGG + Intergenic
996592798 5:125166618-125166640 CAATGAGAACACATGGACTCAGG + Intergenic
996649506 5:125856486-125856508 CAATGAAAACACATGGACACAGG + Intergenic
996660689 5:125998895-125998917 CAATGAAAACACATGGACACAGG + Intergenic
996676213 5:126177765-126177787 CAATGAAAACACATGGACACTGG + Intergenic
997045213 5:130307707-130307729 CAATGAGAACACAGGGACACAGG - Intergenic
998751572 5:145327978-145328000 CAATGAGAACACAGGGACACCGG - Intergenic
998928982 5:147159405-147159427 CATTTAATAAACAGGGAAACTGG - Intergenic
999024532 5:148212258-148212280 CATTTTAAACACAGCAACTTAGG + Intronic
999514880 5:152290938-152290960 CAATGAGAACACAGGGACACAGG - Intergenic
1000091882 5:157936833-157936855 CAATGAAAACACATGGACACAGG - Intergenic
1000283739 5:159807457-159807479 CAATGAGAACACAGGGACACAGG + Intergenic
1000384694 5:160663586-160663608 CATTGAGAACACATGGACACAGG + Intronic
1000463763 5:161550457-161550479 CAATGAAAACACATGGACACAGG - Intronic
1000510123 5:162170666-162170688 CAATGAGAACACATGGACTCAGG + Intergenic
1000708345 5:164539303-164539325 CAATGAAAACACATGGACACAGG + Intergenic
1000886381 5:166752328-166752350 CAATGAGAACACATGGACTCAGG - Intergenic
1001142745 5:169158980-169159002 CAATTAAAAAACAGAGACTGAGG + Intronic
1001142763 5:169159082-169159104 CAATTAAAAAACAGAGACTGAGG + Intronic
1001990466 5:176112226-176112248 CATTCAAAGCACAGGGATTTGGG - Intronic
1002226405 5:177725914-177725936 CATTCAAAGCACAGGGATTTGGG + Intronic
1002267441 5:178045299-178045321 CATTCAAAGCACAGGGATTTGGG - Intronic
1002677699 5:180932154-180932176 CAATGAAAACACATGGACACAGG + Intronic
1002797448 6:485938-485960 CAGATAACACACAGGGCCTCAGG + Exonic
1003261401 6:4519664-4519686 CATTGAGAACACACGGACACAGG + Intergenic
1003296165 6:4830797-4830819 CAATGAAAACACATGGACACAGG - Intronic
1003688564 6:8328804-8328826 CAATGAAAACACATGGACACAGG + Intergenic
1003721206 6:8704330-8704352 CAGTGAAAACACACGGACACAGG - Intergenic
1003738675 6:8908433-8908455 CATTGAGAACACATGGACACAGG - Intergenic
1004231221 6:13835372-13835394 CATTGAGAACACATGGACACAGG + Intergenic
1004234794 6:13864888-13864910 CATTGAGAACACATGGACACAGG - Intergenic
1004253390 6:14041119-14041141 CATTGAGAACACATGGACACAGG - Intergenic
1004369201 6:15037689-15037711 CAATTCAAACACAGGCACCCTGG + Intergenic
1004780919 6:18907782-18907804 CAATTAGAACACATGGACACAGG + Intergenic
1005092675 6:22074748-22074770 CAATGAAAACACATGGACACAGG + Intergenic
1005783670 6:29219701-29219723 CAATGAAAACACATGGACACAGG - Intergenic
1006282259 6:33063653-33063675 CAATTAGAACACATGGACACAGG - Intergenic
1007134949 6:39511891-39511913 CAATGAAAACACATGGACACAGG + Intronic
1008003815 6:46388745-46388767 CAATGAAAACACATGGACACAGG + Intronic
1008069986 6:47089793-47089815 CAATAAAAACACATGGACACAGG + Intergenic
1008188645 6:48426588-48426610 CAGTTACTACACAGGGACTAGGG + Intergenic
1008350445 6:50483433-50483455 CAATTAGAACACATGGACACAGG + Intergenic
1008376787 6:50801130-50801152 CAATTAGAACACATGGACACAGG - Intergenic
1008410381 6:51171960-51171982 CATTGAGAACACATGGACACAGG + Intergenic
1008661830 6:53676655-53676677 CAATGAAAACACATGGACACAGG + Intergenic
1008763456 6:54881957-54881979 CAATGAGAACACAGGGACACAGG - Intronic
1009000405 6:57706330-57706352 CAATGAAAACACATGGACGCAGG + Intergenic
1009188878 6:60605756-60605778 CAATGAAAACACATGGACACAGG + Intergenic
1009226916 6:61028673-61028695 CAATCAGAACACATGGACTCAGG + Intergenic
1009708289 6:67284319-67284341 CAATAAAAACACATGGACACAGG + Intergenic
1010572152 6:77489728-77489750 CAATGAAAACACATGGACACAGG + Intergenic
1010580069 6:77585461-77585483 CATTTAATCCAAAGGGAATCTGG + Intergenic
1010592851 6:77730821-77730843 CAATGAGAACACAGGGACACAGG - Intronic
1010633799 6:78231753-78231775 CAATAAAAACACATGGACACAGG - Intergenic
1010707538 6:79133004-79133026 CAATGAAAACACATGGACACAGG + Intergenic
1010852857 6:80799475-80799497 CAATAAAAACACAGGAACACTGG - Intergenic
1010886144 6:81243693-81243715 CAATTAGAACACACGGACACAGG + Intergenic
1010886956 6:81255737-81255759 CAATGAGAACACATGGACTCAGG - Intergenic
1010913496 6:81587444-81587466 CAATGAAAACACATGGACACAGG - Intronic
1011006479 6:82651280-82651302 CAATGAGAACACAGGGACACAGG + Intergenic
1011308129 6:85951977-85951999 CAATGAGAACACAGGGACACAGG + Intergenic
1011319200 6:86071355-86071377 CATTTTGAACACATGGACACAGG - Intergenic
1011365341 6:86575509-86575531 CAATGAGAACACAGGGACACAGG + Intergenic
1011380419 6:86737027-86737049 CATTGAGAACACATGGACACAGG + Intergenic
1011493883 6:87920031-87920053 CATTTGAGACACAGAGACGCGGG - Intergenic
1011557878 6:88588242-88588264 CATTGTGCACACAGGGACTCGGG - Intergenic
1011830749 6:91368403-91368425 CAGTGAGAACACAGGGACACAGG - Intergenic
1011881266 6:92030898-92030920 CAATGAAAACACATGGACACAGG + Intergenic
1012105695 6:95155117-95155139 CAATGAAAACACATGGACACAGG + Intergenic
1012361622 6:98389573-98389595 CAATGAGAACACATGGACTCAGG - Intergenic
1012680086 6:102169259-102169281 CAGTGAAAACACAGGGACACAGG + Intergenic
1012684002 6:102220676-102220698 TATTAAAATCACAGGAACTCTGG + Intergenic
1013750584 6:113401057-113401079 CAATGAGAACACAGGGACACAGG + Intergenic
1013881897 6:114914827-114914849 CAATTAGAACACATGGACACAGG - Intergenic
1013902113 6:115169264-115169286 CAATGAAAACACATGGACACAGG - Intergenic
1014134559 6:117873413-117873435 CAATGAAAACACATGGACACAGG - Intergenic
1014275734 6:119386359-119386381 CAATGAAAACACATGGACACAGG + Intergenic
1014425595 6:121301484-121301506 CAATGAAAACACATGGACACAGG + Intronic
1014515835 6:122377419-122377441 CAATGAAAACACATGGACACAGG - Intergenic
1014608801 6:123514877-123514899 CAATGAGAACACATGGACTCGGG + Intronic
1014864531 6:126511456-126511478 CAATGAAAACACATGGACACAGG + Intergenic
1014994645 6:128126261-128126283 CAATGAAAACACATGGACACAGG - Intronic
1015557473 6:134477846-134477868 GTTTTAAAAGACAGGGTCTCAGG - Intergenic
1015798966 6:137042006-137042028 CAATGAAAACACATGGACACAGG - Intronic
1016184496 6:141182458-141182480 CAATGAAAACACAGGGACACAGG + Intergenic
1016188942 6:141236121-141236143 CAATGAGAACACAGGGACACAGG + Intergenic
1016306232 6:142686832-142686854 CATGTGCAACACAGGGACTGTGG - Intergenic
1016433318 6:144009712-144009734 CAATGAGAACACATGGACTCAGG - Intronic
1017279481 6:152607980-152608002 CAATGAAAACACACGGACACAGG + Intronic
1018094831 6:160376289-160376311 CAATGAGAACACATGGACTCAGG + Intronic
1018273175 6:162102232-162102254 CAGTGAGAACACAGGGACACAGG - Intronic
1018670793 6:166175431-166175453 CATTGAGAACACATGGACACCGG + Intergenic
1019014420 6:168869513-168869535 CATTGAGAACACATGGACACAGG + Intergenic
1019484033 7:1280219-1280241 CATTGAGAACACATGGACACAGG + Intergenic
1019645430 7:2126345-2126367 CAATAAACACACAGGCACTCGGG + Intronic
1020364139 7:7361977-7361999 CAATGAAAACACATGGACACAGG + Intronic
1020533177 7:9360291-9360313 CATTGAGAACACATGGACACAGG - Intergenic
1020873744 7:13668265-13668287 CAATGAGAACACAGGGACACAGG - Intergenic
1020984907 7:15121016-15121038 CAATGAGAACACATGGACTCAGG - Intergenic
1021042616 7:15881868-15881890 CAATTATAACACATGGACACAGG - Intergenic
1021173795 7:17426559-17426581 CAATGAAAACACATGGACACAGG + Intergenic
1021305704 7:19029287-19029309 CAATGAGAACACAGGGACACAGG + Intronic
1021486846 7:21176839-21176861 CAATGAAAACACATGGACACAGG - Intergenic
1021747254 7:23754693-23754715 CATTGAGAACACATGGACACAGG - Intronic
1022139390 7:27480183-27480205 CAATGAAAACACATGGACACAGG + Intergenic
1022220782 7:28311659-28311681 CCTTTAGAAAACAGGGAGTCAGG + Intronic
1022631305 7:32087798-32087820 CAATGAAAACACATGGACACAGG + Intronic
1022957544 7:35395323-35395345 CAAATAAAACACAGGGTCACAGG + Intergenic
1023132247 7:37014669-37014691 CAATGAGAACACAGGGACACAGG - Intronic
1023167271 7:37355185-37355207 CATTGAAAACGCTGTGACTCTGG + Intronic
1023205312 7:37742439-37742461 CAATGAAAACACATGGACACAGG - Intronic
1023247706 7:38223314-38223336 CATTTAATACAAAGGGATGCAGG - Intronic
1023457050 7:40350831-40350853 CAATGAAAACACATGGACACAGG - Intronic
1023487241 7:40700200-40700222 AATTTAAAACACAGGGTGTAAGG - Intronic
1023815571 7:43947072-43947094 CAATGAGAACACAGGGACACAGG - Intronic
1023894886 7:44425089-44425111 CAATGAAAACACATGGACACAGG + Intronic
1024402373 7:48939740-48939762 CATTTAAAGAACATGGTCTCAGG + Intergenic
1024832724 7:53480335-53480357 CAATGAGAACACAGGGACACAGG - Intergenic
1024860098 7:53828883-53828905 CAATGAAAACACATGGACACAGG + Intergenic
1025018027 7:55456746-55456768 CAATGAAAACACATGGACACAGG + Intronic
1026187443 7:68092862-68092884 CAATGAAAACACATGGACACAGG - Intergenic
1026212498 7:68318293-68318315 CAATGAGAACACATGGACTCAGG + Intergenic
1026488680 7:70844102-70844124 CAATGAAAACACATGGACACAGG + Intergenic
1027335026 7:77141113-77141135 CAATGAGAACACAGGGACACAGG - Intronic
1027608458 7:80329389-80329411 CAATGAAAACACATGGACACAGG + Intergenic
1027944605 7:84728840-84728862 CATTTTGAACACATGGACACAGG + Intergenic
1027946289 7:84749372-84749394 CTTTCACAACACAGGGACTCAGG + Intergenic
1027976617 7:85165039-85165061 CAATGAGAACACAGGGACACAGG - Intronic
1028019889 7:85757058-85757080 CAATGAAAACACATGGACACAGG + Intergenic
1028139528 7:87258051-87258073 CAATGAAAACACATGGACACAGG - Intergenic
1028691167 7:93652629-93652651 CAATGAGAACACAGGGACACAGG - Intronic
1028940415 7:96515823-96515845 CAATGAGAACACAGGGACGCAGG + Intronic
1029029625 7:97453957-97453979 CAATGAAAACACATGGACACAGG - Intergenic
1030411915 7:109191646-109191668 CCTTTATAACAAAGGCACTCTGG + Intergenic
1030578701 7:111323938-111323960 CAATGAGAACACAGGGACACAGG + Intronic
1030711457 7:112754685-112754707 CAATGAGAACACAGGGACACAGG - Intergenic
1031463983 7:122085482-122085504 CATTAAAAAAACATGGACTGGGG - Intronic
1031653019 7:124315076-124315098 CATTGAGAACACATGGACACAGG - Intergenic
1033430588 7:141285889-141285911 CAATGAAAACACATGGACACAGG + Intronic
1033717312 7:144016152-144016174 CATTGAGAACACATGGACACAGG + Intergenic
1034405751 7:150901455-150901477 TATTCAATAAACAGGGACTCAGG - Intergenic
1034856883 7:154558142-154558164 CATTGAGAACACATGGACACAGG - Intronic
1034865022 7:154634205-154634227 CAATGAGAACACATGGACTCAGG - Intronic
1035480588 7:159179392-159179414 CATTTATAACTCAGTGACTTTGG + Intergenic
1035889011 8:3324140-3324162 CATCTAACACCCAGAGACTCGGG + Intronic
1035997776 8:4568318-4568340 CAATGAGAACACAGGGACACAGG - Intronic
1036139787 8:6196934-6196956 CAATGAAAACACATGGACACAGG + Intergenic
1036740790 8:11359734-11359756 CATTGAGAACACATGGACACAGG + Intergenic
1036975115 8:13402406-13402428 CTTGTACAACACAGGGAATCTGG - Intronic
1036995117 8:13646232-13646254 CAATGAGAACACAGGGACACAGG + Intergenic
1037016861 8:13918484-13918506 CAATTAGAACACATGGACACAGG + Intergenic
1037021999 8:13984806-13984828 CAATGAGAACACAGGGACACAGG - Intergenic
1037026906 8:14050095-14050117 CAATGAAAACACATGGACACAGG - Intergenic
1037056443 8:14447679-14447701 CATTTAAAAAATAATGACTCTGG - Intronic
1037223303 8:16552807-16552829 CTTTGAAAACACAGGGATTGTGG - Intronic
1037231118 8:16660118-16660140 CAATGAGAACACAGGGACACAGG + Intergenic
1037234768 8:16704836-16704858 CAATGAAAACACATGGACACAGG - Intergenic
1037269968 8:17115834-17115856 CATTCAGAAAACAGGGAGTCTGG - Intronic
1037895077 8:22646531-22646553 AATTTAAACCACTGTGACTCAGG - Intronic
1038370213 8:26981622-26981644 CAATTAGAACACATGGACACAGG + Intergenic
1038845117 8:31222007-31222029 CAATGAGAACACAGGGACACAGG + Intergenic
1038907021 8:31916398-31916420 CAATGAGAACACAGGGACACAGG - Intronic
1039119912 8:34133988-34134010 CAATTAGAACACATGGACACAGG - Intergenic
1039745494 8:40422383-40422405 TGATTAAAACACACGGACTCTGG + Intergenic
1039830908 8:41213682-41213704 CAATGAAAACACATGGACACAGG + Intergenic
1039958502 8:42225750-42225772 CATGAAAAACACTGGGAATCTGG - Intergenic
1040285361 8:46097968-46097990 CATGAGAAACACAGGGATTCTGG - Intergenic
1040367321 8:46731336-46731358 CAATGAGAACACATGGACTCAGG + Intergenic
1040719182 8:50296559-50296581 AAATGAAAACACAGGGACACAGG + Intronic
1040734453 8:50488971-50488993 CAATGAGAACACAGGGACACAGG - Intronic
1040963365 8:53059312-53059334 CAATGAGAACACAGGGACACAGG + Intergenic
1041051389 8:53938330-53938352 CAATGAAAACACATGGACACAGG + Intronic
1041347806 8:56919589-56919611 CAATGAGAACACAGGGACACAGG + Intergenic
1041625745 8:60024737-60024759 CAATGAAAACACATGGACACAGG + Intergenic
1041892549 8:62886860-62886882 CAATGAGAACACAGGGACCCAGG - Intronic
1042163978 8:65927268-65927290 CAATGAAAACACATGGACACAGG - Intergenic
1042265720 8:66907270-66907292 CAATTAGAACACACGGACACAGG - Intronic
1042333386 8:67606129-67606151 CAATGAAAACACATGGACACAGG + Intronic
1042365367 8:67930252-67930274 CAATTAGAACACATGGACACAGG + Intergenic
1042515700 8:69656516-69656538 CATTGAGAACACATGGACACAGG - Intronic
1042820995 8:72929993-72930015 CAATGAGAACACAGGGACACAGG - Intronic
1043031610 8:75140974-75140996 CAATGAAAACACATGGACACAGG + Intergenic
1043303712 8:78767964-78767986 CAATGAGAACACAGGGACACAGG - Intronic
1043724712 8:83595926-83595948 CAATGAGAACACAGGGACACAGG - Intergenic
1043805143 8:84663027-84663049 CAATGAAAACACATGGACTCAGG - Intronic
1044632751 8:94295434-94295456 CAATGAAAACACACGGACACAGG + Intergenic
1044890186 8:96826823-96826845 CAATGAAAACACACGGACACAGG - Intronic
1044944113 8:97375135-97375157 CTTTTTAAACAGAGGGACTCTGG + Intergenic
1044944535 8:97378205-97378227 CAATGAGAACACAGGGACACAGG - Intergenic
1045166387 8:99610534-99610556 CAATGAGAACACATGGACTCGGG + Intronic
1045378258 8:101597627-101597649 CAATGAGAACACATGGACTCAGG + Intronic
1045394039 8:101742867-101742889 CAATGAGAACACAGGGACACAGG - Intronic
1045639927 8:104238245-104238267 CAATGAGAACACAGGGACACAGG + Intronic
1045715545 8:105039474-105039496 CAATTAAAATACATGGACACAGG + Intronic
1046298877 8:112259387-112259409 CAATGAGAACACAGGGACACAGG + Intronic
1046578125 8:116057529-116057551 CATTCAAAACCCAGGGAGACTGG + Intergenic
1046876757 8:119263454-119263476 CATTTCAAACCCAGGAAGTCTGG + Intergenic
1046983614 8:120363368-120363390 CAATGAGAACACAGGGACACAGG + Intronic
1047225164 8:122950370-122950392 CAATGAAAACACATGGACACAGG + Intronic
1047425567 8:124742458-124742480 CTTTTATAACAAAGGTACTCTGG + Intergenic
1047554262 8:125911686-125911708 CATTGAGAACACATGGACACAGG - Intergenic
1047675085 8:127192435-127192457 CAATGAAAACACATGGACACAGG - Intergenic
1048098889 8:131325367-131325389 CAATGAAAACACATGGACACAGG + Intergenic
1048340042 8:133531608-133531630 CAGTGAAAACACATGGACACAGG + Intronic
1050123236 9:2330078-2330100 CAATGACAACACAGGGACACAGG - Intergenic
1050193671 9:3057265-3057287 CAGTGAAAACACATGGACACAGG + Intergenic
1050262659 9:3856984-3857006 CATTTTAAACATAGTGAGTCAGG - Intronic
1050715672 9:8522350-8522372 CGATTGAAACACAGGGACTTAGG + Intronic
1051002610 9:12303329-12303351 CAATGAGAACACAGGGACACAGG - Intergenic
1051090799 9:13405332-13405354 CAATGAAAACACATGGACACAGG - Intergenic
1051141593 9:13985051-13985073 CAATGAAAACACATGGACACAGG - Intergenic
1051338557 9:16090363-16090385 CAATGAAAACACATGGACACAGG + Intergenic
1051373334 9:16377954-16377976 CATTTAGAACGCATGGACACAGG - Intergenic
1051575246 9:18607771-18607793 CAATGAGAACACAGGGACACAGG - Intronic
1051703514 9:19851522-19851544 CAATGAGAACACAGGGACACAGG - Intergenic
1051770362 9:20571634-20571656 CAATGAAAACACATGGACCCGGG - Intronic
1052428415 9:28334868-28334890 CATTTAAAACACCAGAATTCAGG + Intronic
1052433863 9:28401330-28401352 CATTGAGAACACATGGACACAGG - Intronic
1052528800 9:29655869-29655891 CATTAAAAGCATCGGGACTCCGG + Intergenic
1052596914 9:30573250-30573272 CAATGAAAACACATGGACACAGG + Intergenic
1053608324 9:39682294-39682316 CAATGAAAACACATGGACACAGG - Intergenic
1053866164 9:42438654-42438676 CAATGAAAACACATGGACACAGG - Intergenic
1054245206 9:62660115-62660137 CAATGAAAACACATGGACACAGG + Intergenic
1054559334 9:66694646-66694668 CAATGAAAACACATGGACACAGG + Intergenic
1055005220 9:71498352-71498374 CAATGAGAACACAGGGACACAGG + Intergenic
1055175334 9:73311877-73311899 CAATTAGAACACATGGACACAGG + Intergenic
1055242628 9:74202460-74202482 CCTTGAAACCACAGGGACTGAGG + Intergenic
1056837510 9:89968918-89968940 CAATGAGAACACAGGGACACAGG + Intergenic
1056928308 9:90853668-90853690 CATTGAGAACACATGGACACAGG + Intronic
1056971147 9:91204910-91204932 CAATGAGAACACAGGGACACAGG + Intergenic
1057162600 9:92900127-92900149 CATTGAGAACACATGGACACAGG - Intergenic
1057323661 9:94038851-94038873 CATTTTAAATACAGTGATTCTGG - Intronic
1057539955 9:95958071-95958093 CATTGAGAACACATGGACACAGG - Intronic
1057615439 9:96585404-96585426 CAATGAGAACACAGGGACACAGG - Intronic
1057921338 9:99100547-99100569 CAATGAGAACACAGGGACACAGG + Intergenic
1058080915 9:100700341-100700363 CAATGAAAACACATGGACACAGG + Intergenic
1058494680 9:105543627-105543649 CAATGAAAACACATGGACACAGG - Intronic
1058586274 9:106509556-106509578 CAATGAGAACACATGGACTCAGG - Intergenic
1058942470 9:109826161-109826183 CAATGAGAACACAGGGACACAGG + Intronic
1058962009 9:110000206-110000228 CAATGAAAACACATGGACACAGG - Intronic
1059941293 9:119362273-119362295 CAATAAGAGCACAGGGACTCAGG - Intronic
1059955244 9:119508978-119509000 CAATGAAAACACATGGACACAGG - Intronic
1060192455 9:121601580-121601602 CATTCAACACACAGGCACTGAGG + Intronic
1060960291 9:127676029-127676051 CATTTAAAAGACATGGACTGGGG + Intronic
1203532237 Un_GL000213v1:156848-156870 CAATGAGAACACAGGGACACAGG - Intergenic
1203459653 Un_GL000220v1:22343-22365 CAATGAAAACACATGGACACAGG - Intergenic
1203358676 Un_KI270442v1:191184-191206 CAATGAAAACACATGGACACAGG + Intergenic
1185519825 X:729955-729977 CATTTAATGCACAGGGAATGCGG + Intergenic
1185692074 X:2163569-2163591 CAATGAGAACACAGGGACACAGG - Intergenic
1185711313 X:2305787-2305809 CAATGAGAACACAGGGACACAGG + Intronic
1185718617 X:2363936-2363958 CACTCAACACACAGGGACTGAGG + Intronic
1185727452 X:2433598-2433620 CAGTGAGAACACAGGGACGCAGG - Intronic
1185825749 X:3247852-3247874 CATTGAAAATTCAGGGACTTTGG - Intergenic
1185988184 X:4860250-4860272 CATTGAGAACACATGGACACAGG + Intergenic
1186256043 X:7721082-7721104 CATTTAAAACACAGAGGCTTAGG + Intergenic
1186913899 X:14199418-14199440 CAATGAAAACACATGGACACAGG + Intergenic
1186987298 X:15030896-15030918 CATTGAGAACACATGGACACAGG + Intergenic
1187173721 X:16875706-16875728 CAATGAGAACACATGGACTCAGG + Intergenic
1187585064 X:20651392-20651414 CAATGAAAACACATGGACACAGG + Intergenic
1187618289 X:21021864-21021886 CAATGAAAACACATGGACACAGG + Intergenic
1187661465 X:21551162-21551184 CAATGAAAACACATGGACACAGG + Intronic
1187907335 X:24079599-24079621 TCTCTAAAAAACAGGGACTCTGG - Intergenic
1188034600 X:25303302-25303324 CAATGAAAACACATGGACACAGG + Intergenic
1188291211 X:28391186-28391208 CAATGAAAACACATGGACACAGG + Intergenic
1188415828 X:29933131-29933153 CAATGAGAACACAGGGACACAGG + Intronic
1188567615 X:31544517-31544539 CTCTGAAAACACAGGGACACAGG + Intronic
1188744325 X:33823954-33823976 CAATGAGAACACATGGACTCAGG - Intergenic
1188848853 X:35107417-35107439 CAATGAAAACACACGGACACAGG + Intergenic
1188939640 X:36221035-36221057 CATTTAAAACTCAGAGATTTTGG + Intergenic
1189436041 X:40993465-40993487 CAATGAGAACACAGGGACACAGG - Intergenic
1189882668 X:45508561-45508583 CATTGAAAATACAGGGCCTCTGG + Intergenic
1189958727 X:46305252-46305274 CAATGAAAACACATGGACACAGG + Intergenic
1189979281 X:46492937-46492959 CAATGAGAACACAGGGACACAGG + Intronic
1190096904 X:47488764-47488786 CATTTAAAATAAAGAGACTGGGG - Intergenic
1190423089 X:50305452-50305474 CAATGAAAACACATGGACACAGG + Intronic
1190830172 X:54052508-54052530 CAATTAGAACACATGGACACAGG - Intergenic
1190924557 X:54890917-54890939 CAATGAGAACACATGGACTCAGG + Intergenic
1191042393 X:56097711-56097733 CAATTAGAACACATGGACACAGG - Intergenic
1191042676 X:56101640-56101662 CATTTAAATAACAGCCACTCTGG + Intergenic
1191045988 X:56137552-56137574 CAATGAGAACACAGGGACACAGG + Intergenic
1191096581 X:56679637-56679659 CAATTAGAACACATGGACACAGG + Intergenic
1191113488 X:56827564-56827586 CAATGAAAACACATGGACACAGG - Intergenic
1191132796 X:57032347-57032369 CAATGAAAACACATGGACACAGG - Intergenic
1191159587 X:57313924-57313946 CAATTAAAATACAGGGTGTCAGG + Intronic
1191653158 X:63563971-63563993 CAATTAGAACACATGGACACAGG - Intergenic
1191831768 X:65422728-65422750 CAATTAGAACACATGGACACAGG - Intronic
1191895135 X:65984706-65984728 CAGTGAAAACACATGGACACAGG + Intergenic
1192042479 X:67637371-67637393 CATTGAGAACACATGGACACAGG - Intronic
1192988457 X:76426236-76426258 CAATTACAACACATGGACACAGG + Intergenic
1192998991 X:76542780-76542802 CAATTAGAACACATGGACACAGG - Intergenic
1193002069 X:76573995-76574017 CAATTAGAACACATGGACACAGG + Intergenic
1193065005 X:77250081-77250103 CAATGAGAACACATGGACTCAGG + Intergenic
1193153865 X:78152637-78152659 CAGTTAGAACACATGGACACAGG - Intergenic
1193222090 X:78937505-78937527 CAATGAGAACACAGGGACACAGG - Intergenic
1193364653 X:80617369-80617391 CAATGAAAACACATGGACACAGG - Intergenic
1193462596 X:81808771-81808793 CAATGAAAACACATGGACACAGG + Intergenic
1193477760 X:81987538-81987560 CAATGAAAACACATGGACACAGG + Intergenic
1193599766 X:83496084-83496106 CATTTCAAACACCGTGGCTCTGG - Intergenic
1193712823 X:84899082-84899104 CATTGAGAACACATGGACACGGG - Intergenic
1193801567 X:85942954-85942976 CAATGAGAACACAGGGACACAGG - Intronic
1193991553 X:88314286-88314308 CATTGAGAACACACGGACACAGG + Intergenic
1194380743 X:93188404-93188426 CAATGAGAACACATGGACTCAGG - Intergenic
1194409615 X:93542017-93542039 CATCTTAAACACATGGACTGAGG - Intergenic
1194418607 X:93644624-93644646 CAATGAGAACACATGGACTCAGG - Intergenic
1194532713 X:95070935-95070957 CAATGAAAACACATGGACACAGG + Intergenic
1194832462 X:98640952-98640974 CAATGAGAACACAGGGACACAGG + Intergenic
1194907330 X:99594183-99594205 CAATGAAAACACATGGACCCAGG - Intergenic
1194953759 X:100155744-100155766 CAATTAGAACACATGGACACAGG - Intergenic
1195102687 X:101570878-101570900 CAATTAGAACACATGGACCCAGG + Intergenic
1195110595 X:101645170-101645192 TATTGAGAACACAGGGACACGGG + Intergenic
1195234318 X:102881938-102881960 CAATGAAAACACATGGACACAGG + Intergenic
1195435306 X:104836934-104836956 CAATTAGAACACATGGACACAGG - Intronic
1195518605 X:105805679-105805701 CAATGAGAACACAGGGACACAGG - Intergenic
1195586436 X:106570416-106570438 CAATGAAAACACATGGACACAGG + Intergenic
1195827612 X:109019522-109019544 CAATGAAAACACATGGACACAGG - Intergenic
1196398008 X:115286771-115286793 CAATGAAAACACATGGACACAGG + Intergenic
1196499653 X:116364963-116364985 CAATAAAAACACATGGACACAGG + Intergenic
1196759170 X:119185365-119185387 CATTGAGAACACATGGACACAGG - Intergenic
1196870093 X:120105012-120105034 CATTGAGAACACATGGACACAGG + Intergenic
1197097814 X:122616057-122616079 CAATGAGAACACATGGACTCAGG - Intergenic
1197191633 X:123654202-123654224 CAATTAGAACACAAGGACACAGG + Intronic
1197413349 X:126145167-126145189 CAATGAGAACACATGGACTCAGG - Intergenic
1197552386 X:127908722-127908744 CGTTTAAAACCCAGTGAGTCAGG + Intergenic
1197961604 X:132012416-132012438 CATGTGAAAAACATGGACTCTGG - Intergenic
1197993797 X:132350220-132350242 CAGTAAAAACACATGGACTAAGG + Intergenic
1198488384 X:137111595-137111617 CAATGAAAACACATGGACACAGG - Intergenic
1198543882 X:137671050-137671072 CATTGAGAACACATGGACACAGG - Intergenic
1199012059 X:142769840-142769862 CAATGAGAACACAGGGACACAGG - Intergenic
1199016996 X:142829844-142829866 CAATGAAAACACATGGACACAGG + Intergenic
1199159189 X:144587388-144587410 CAATGAAAACACATGGACACGGG + Intergenic
1199336386 X:146622536-146622558 CAATGAAAACACATGGACACAGG - Intergenic
1199468221 X:148164502-148164524 CAATGAAAACACATGGACACAGG + Intergenic
1199477104 X:148257760-148257782 CAATGAAAACACATGGACACAGG - Intergenic
1200322418 X:155203557-155203579 CAATGAAAACACATGGACACAGG + Intronic
1200334916 X:155340294-155340316 CAATGAAAACACATGGACACAGG - Intergenic
1200351550 X:155500927-155500949 CAATGAAAACACATGGACACAGG + Intronic
1200485325 Y:3762227-3762249 CATTGAGAACACATGGACACAGG - Intergenic
1200743793 Y:6884228-6884250 CAATTAGAACACATGGACACAGG + Intergenic
1200760623 Y:7035745-7035767 CAATTAGAACACATGGACACAGG + Intronic
1200819730 Y:7570248-7570270 CAATGAGAACACAGGGACACAGG - Intergenic
1200867034 Y:8055687-8055709 CAATGAGAACACAGGGACACAGG - Intergenic
1201253245 Y:12081965-12081987 CATTGAAAATTCAGGGACTTTGG + Intergenic
1201483210 Y:14463303-14463325 CAATGAAAACACATGGACACAGG + Intergenic
1201528048 Y:14958774-14958796 CATTGAGAACACATGGACACAGG + Intergenic
1201591800 Y:15623596-15623618 CATTGAGAACACAAGGACACAGG + Intergenic
1201629462 Y:16053806-16053828 CATTGAGAACACATGGACACAGG - Intergenic
1201677116 Y:16598316-16598338 CAATGAGAACACAGGGACACAGG - Intergenic
1201727406 Y:17168972-17168994 CAGTGAAAACACATGGACACAGG - Intergenic
1202124851 Y:21558347-21558369 CAATAAGAACACAGGGACACAGG + Intergenic
1202154157 Y:21871033-21871055 CAATAAGAACACAGGGACACAGG - Intergenic