ID: 964704247

View in Genome Browser
Species Human (GRCh38)
Location 3:159601518-159601540
Sequence AGGTATGCAGAGGGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1172
Summary {0: 1, 1: 1, 2: 5, 3: 76, 4: 1089}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964704238_964704247 2 Left 964704238 3:159601493-159601515 CCTAGCCTTTGTTGGCAGTAGGA 0: 1
1: 0
2: 3
3: 8
4: 123
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704230_964704247 15 Left 964704230 3:159601480-159601502 CCGGCCCACCCACCCTAGCCTTT 0: 1
1: 2
2: 6
3: 50
4: 465
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704232_964704247 10 Left 964704232 3:159601485-159601507 CCACCCACCCTAGCCTTTGTTGG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704229_964704247 18 Left 964704229 3:159601477-159601499 CCTCCGGCCCACCCACCCTAGCC 0: 1
1: 0
2: 8
3: 51
4: 586
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704228_964704247 19 Left 964704228 3:159601476-159601498 CCCTCCGGCCCACCCACCCTAGC 0: 1
1: 0
2: 1
3: 27
4: 317
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704236_964704247 3 Left 964704236 3:159601492-159601514 CCCTAGCCTTTGTTGGCAGTAGG 0: 1
1: 0
2: 1
3: 3
4: 97
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704239_964704247 -3 Left 964704239 3:159601498-159601520 CCTTTGTTGGCAGTAGGATCAGG 0: 1
1: 0
2: 0
3: 8
4: 97
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704231_964704247 11 Left 964704231 3:159601484-159601506 CCCACCCACCCTAGCCTTTGTTG 0: 1
1: 0
2: 0
3: 12
4: 246
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704234_964704247 7 Left 964704234 3:159601488-159601510 CCCACCCTAGCCTTTGTTGGCAG 0: 1
1: 0
2: 0
3: 6
4: 120
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089
964704235_964704247 6 Left 964704235 3:159601489-159601511 CCACCCTAGCCTTTGTTGGCAGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG 0: 1
1: 1
2: 5
3: 76
4: 1089

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964704247 Original CRISPR AGGTATGCAGAGGGGGAGGA GGG Intronic
900252907 1:1680684-1680706 AGGGATGCTGGGGGTGAGGACGG - Intronic
900748089 1:4374865-4374887 AGGTAGGGAGAGGGGAAGAAAGG + Intergenic
900932892 1:5747825-5747847 AGGAATGGAGGGAGGGAGGAGGG + Intergenic
901453486 1:9350371-9350393 AGCTGTGCAGAGGAGGAGGCAGG + Intronic
901648981 1:10732635-10732657 TGGGATGCAGAGGCAGAGGAGGG + Intronic
901650819 1:10742224-10742246 AGCTGGGCAGAGGGGCAGGAAGG + Intronic
902099213 1:13971891-13971913 TGGAAGGCAAAGGGGGAGGAAGG - Intergenic
902394553 1:16125423-16125445 AGGGAGGCAGAGGAGGAGGGTGG + Intronic
902757491 1:18558494-18558516 AGGAAGGAAGAGGGGGAGAATGG + Intergenic
902778542 1:18690122-18690144 AGGTATGCAGTGGGCAAGGTAGG - Intronic
903019646 1:20385108-20385130 GAGTGTGCAGAGGGAGAGGAAGG - Intergenic
903057272 1:20644977-20644999 GGGGATACAGAGGGTGAGGAAGG - Intronic
903225913 1:21894226-21894248 AGCCATGCCCAGGGGGAGGAGGG + Intronic
903260958 1:22131781-22131803 AGGAATGCAGGGGGTGGGGAGGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903331650 1:22599874-22599896 AGGGAGGGAGTGGGGGAGGAAGG + Intronic
903723268 1:25421759-25421781 AGGGATGTAGGGAGGGAGGAAGG + Intronic
903986794 1:27234664-27234686 AGATAAACAGAGGAGGAGGAGGG + Exonic
904030790 1:27532323-27532345 AGGTCTTGAGAAGGGGAGGAAGG - Intergenic
904311808 1:29633978-29634000 AGGGAAGCAGATGGGGAGGGAGG + Intergenic
904594202 1:31632810-31632832 AGGTGTCCAGAGTAGGAGGACGG - Intronic
905629771 1:39512061-39512083 TGGGAAGCAGAGGGAGAGGAGGG - Intronic
905667988 1:39774129-39774151 TGGGAAGCAGAGGGAGAGGAGGG + Intronic
905753427 1:40486438-40486460 AGGGATGGAGGGAGGGAGGAAGG - Intronic
905975141 1:42168894-42168916 GGGTTTTCAGAGGGGGAGGCAGG - Intergenic
906248078 1:44291028-44291050 GAGGATGCAGTGGGGGAGGAAGG - Intronic
906478450 1:46185307-46185329 AGGTAAGCAGATGAGGAGGCTGG + Exonic
906627375 1:47335873-47335895 AGCTATGCAGAGGCTGAGGCAGG - Intronic
906669514 1:47644347-47644369 TGGAATGCAGAGAGGGAGGGTGG + Intergenic
906689780 1:47784902-47784924 CGGTATGGAGAGGGGGAGATGGG + Intronic
907437555 1:54459160-54459182 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
907448560 1:54526823-54526845 AGGAAGGCAAAGGGGAAGGAAGG - Intergenic
907462874 1:54615674-54615696 AGGGGTGCAGAGGGGAAGGGTGG + Intronic
908131768 1:61082056-61082078 AGGTCTGCAGCGGGGGTGGGGGG + Intronic
908257059 1:62311511-62311533 GGGTATGCAAAGGAGGAGGAGGG - Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908437526 1:64121202-64121224 AGGAAAGCAGGGGAGGAGGAGGG - Intronic
909738751 1:79001165-79001187 AGGAAGGGAGAGGGGGGGGAGGG + Intronic
910758356 1:90713379-90713401 GGGTGTGCAGCGGGGGAGGGAGG - Intronic
911037761 1:93568307-93568329 AGCAATGCAGATGGGGCGGATGG - Intronic
911188353 1:94925905-94925927 TGGAATGCAGGGAGGGAGGAAGG + Intronic
911301252 1:96177302-96177324 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
911595051 1:99790056-99790078 AGATATGCATAGAGGGAAGATGG - Intergenic
912302205 1:108529810-108529832 AGGAAGGCATAGGGGGAGGCAGG - Intergenic
912578943 1:110703229-110703251 GGGAATGCATAGGGGGAGGTAGG + Intergenic
912709614 1:111941045-111941067 AGGAAAGCAGCGGGGCAGGAGGG + Intronic
912775442 1:112503926-112503948 AGGAAGGCAGAGTGGGAGGGAGG + Intronic
913575268 1:120166635-120166657 AGGTAGAGAGAAGGGGAGGATGG + Intronic
913601059 1:120421471-120421493 AGGCAGGGAGAGAGGGAGGAAGG - Intergenic
913940343 1:125097966-125097988 AGGAATGGAGGGCGGGAGGATGG - Intergenic
914329383 1:146652082-146652104 AAGTAGGCTGAGGAGGAGGAGGG + Intergenic
914425467 1:147571795-147571817 AGGTATGCAGAGGTCTGGGAAGG - Intronic
914505001 1:148281203-148281225 ACGTATGAAGATTGGGAGGAAGG + Intergenic
914507563 1:148302945-148302967 ACGTATGAAGATTGGGAGGAAGG - Intergenic
914557574 1:148782275-148782297 AGGTAGAGAGAAGGGGAGGATGG + Intergenic
914615260 1:149347955-149347977 AGGTAGAGAGAAGGGGAGGATGG - Intergenic
915198203 1:154206254-154206276 AGGTATGCAGAGTTGGAAGGAGG - Exonic
915535475 1:156532947-156532969 AGGTATGCAGGGGCAGAGGCTGG + Intronic
915579428 1:156804643-156804665 AGGGAGGCAGAGGGGCAGGGAGG - Intergenic
915627060 1:157120521-157120543 AAGAATCCAGAGGGGTAGGAGGG - Intergenic
915914791 1:159934436-159934458 AGGTAGGCAGAGGCTGAGGGTGG + Exonic
915914878 1:159934826-159934848 TGGGATGCACAAGGGGAGGAAGG + Intronic
916202770 1:162287695-162287717 AGGTATGAAAATGGGGAGGGGGG - Intronic
916453249 1:164941886-164941908 AGGTATGCAGAGTGGTATAATGG - Intergenic
916743022 1:167662723-167662745 AGGAAGGAAGAGGAGGAGGAGGG + Intronic
916848001 1:168672948-168672970 AGGTATGTAGTGAGGGAGGAGGG - Intergenic
916976561 1:170086672-170086694 AGGGAAGGAGAGAGGGAGGAAGG - Intergenic
917168563 1:172143510-172143532 AGGGTGGGAGAGGGGGAGGAAGG - Intronic
917506731 1:175634173-175634195 AGGGAGGAAGATGGGGAGGAGGG + Intronic
917724299 1:177814283-177814305 AGGGCTGCCCAGGGGGAGGAGGG + Intergenic
917796840 1:178538780-178538802 AGGGCTGCAGAGGGGGAAGCTGG - Intronic
918118635 1:181518058-181518080 AAGGATGCAGATGGGGAGCAAGG + Intronic
918371466 1:183865610-183865632 AGACATGCAGAGGGGTTGGACGG + Intronic
918472145 1:184885534-184885556 TGGCCTGCAGAGGGGCAGGAGGG - Intronic
918474192 1:184905550-184905572 ATGTATGCACAGGGGCAAGAAGG - Intronic
918617086 1:186557461-186557483 AGGGAAGGAGAGGGGAAGGAAGG - Intergenic
919460146 1:197867097-197867119 AGGGAGGGAGGGGGGGAGGAAGG + Intergenic
919862943 1:201754321-201754343 AGGTGGGCAGAGGAGGAAGAAGG + Intronic
919921110 1:202166985-202167007 AGGCAAGGTGAGGGGGAGGAGGG - Intergenic
920251466 1:204624941-204624963 AGGGATGCTGAGGGTGAGGAAGG + Intronic
920509639 1:206541395-206541417 AGGGAGGCAGCTGGGGAGGAAGG + Intronic
920634436 1:207686019-207686041 AGGCAGGCAGAAGGGAAGGAGGG - Intronic
920698666 1:208201260-208201282 AGACATGCAAAGGGGGAGAATGG + Intronic
921303018 1:213768412-213768434 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
921650792 1:217675152-217675174 AGGTTTGTAGAGAAGGAGGATGG + Intronic
922009599 1:221568944-221568966 AAGTATGCAGAGGGTGCTGAGGG + Intergenic
922555902 1:226531720-226531742 AGGTGAGCAGAGGGAGAGGTTGG + Intergenic
922816656 1:228453930-228453952 AGGTATAAAGAGGGGGAGCAGGG - Intergenic
923052010 1:230395846-230395868 GAGCATGAAGAGGGGGAGGAGGG - Intronic
923093483 1:230756975-230756997 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
923230516 1:231982320-231982342 AGGAAGGCAGAGAGGGAGGGAGG - Intronic
923491282 1:234486188-234486210 TGGGATGCAGAGGTGGAGGAGGG - Intergenic
923905135 1:238376221-238376243 AAGCAGGCAGAGGAGGAGGAAGG + Intergenic
924259929 1:242219328-242219350 AGGTGTGGAGAGGAAGAGGAGGG + Intronic
924665143 1:246063622-246063644 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
924673636 1:246153422-246153444 AGGGAGGGAGAGGGGGAGGGAGG + Intronic
1062939005 10:1407820-1407842 AGTCATGCAGAGGGGAAGGAGGG - Intronic
1063225772 10:4013468-4013490 AGGGAGGGAGAGGGGGAGGGAGG - Intergenic
1063318894 10:5033876-5033898 AGGTATGCTGTGGAGGAGGAGGG - Intronic
1063370612 10:5520101-5520123 AGGTATGCAGCTGGGGAAGGAGG - Intergenic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063698022 10:8356517-8356539 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1064332852 10:14410016-14410038 AGGAAGGAAGTGGGGGAGGAAGG + Intronic
1064332860 10:14410040-14410062 AGGAAGGAAGTGGGGGAGGAAGG + Intronic
1064515143 10:16139143-16139165 AGGAAAGGAGAGGAGGAGGAGGG - Intergenic
1064862883 10:19846678-19846700 AGATATGCAGTGTGGGAAGAGGG + Intronic
1065078758 10:22107247-22107269 TGGTAGGGAGAGTGGGAGGATGG - Intergenic
1065145227 10:22761906-22761928 GGGGATGAAGAGGGGGAGGTGGG + Intergenic
1065169321 10:23010899-23010921 AGGGAAGAAGAGGGGAAGGAAGG - Intronic
1065811505 10:29447730-29447752 AGGAAAGGAGAGGGGAAGGAGGG - Intergenic
1066442202 10:35449531-35449553 AAGGCTGCAGAGGGGGAGGCTGG + Intronic
1066558007 10:36636649-36636671 AGGGATGGAGAGAGGGAGGGAGG + Intergenic
1066640477 10:37550126-37550148 AGGGATGGAGAGGGGGTGGGTGG - Intergenic
1067307969 10:45083357-45083379 AGGGAAGGAGAGAGGGAGGAAGG - Intergenic
1067703356 10:48589270-48589292 GGCTCTGCAGAGGGGAAGGAAGG - Intronic
1067807961 10:49406107-49406129 AGGAATGCAGAAGGGGTGAAGGG + Intergenic
1067808540 10:49409690-49409712 AGGGATGCAGGAGGGCAGGAAGG - Intergenic
1068550195 10:58399344-58399366 AGGTATACAATGGGGGAAGAGGG + Intergenic
1068638418 10:59373991-59374013 AGGAAGGAAGAGGTGGAGGAAGG + Intergenic
1068816494 10:61321023-61321045 AGTTAAGCAGTGGGAGAGGAAGG + Intergenic
1068830679 10:61491284-61491306 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1068864596 10:61881645-61881667 AGCTATGCAGAGGCTGAGGCAGG + Intergenic
1069157284 10:65046796-65046818 AAGTGTGTAGAGTGGGAGGAGGG + Intergenic
1069190585 10:65483138-65483160 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1069965402 10:72111077-72111099 ACCTTTGCAGAGGGGAAGGAGGG - Intronic
1070045309 10:72828489-72828511 GGGAATGCTGAGGGGGAGGAAGG - Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070366557 10:75742484-75742506 AGGTGTGCTGTGGGGGTGGATGG + Intronic
1070492470 10:76990588-76990610 AGGAATGAAGACAGGGAGGAAGG - Intronic
1070499303 10:77055475-77055497 AGGAAGGAAGAGAGGGAGGAAGG - Intronic
1071122732 10:82298265-82298287 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
1071179696 10:82968670-82968692 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1071921244 10:90352855-90352877 AAGTATGCAGAGGGTTAGGGTGG - Intergenic
1072275279 10:93816701-93816723 AGGTAGGGAGAGAAGGAGGAAGG + Intergenic
1072547872 10:96454439-96454461 AGGCATGCAGGAGGAGAGGAGGG - Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1072815773 10:98507657-98507679 AAGGATAGAGAGGGGGAGGACGG - Intronic
1073455934 10:103636772-103636794 AGGATTTCAGAGGGAGAGGAAGG - Intronic
1073485854 10:103818803-103818825 AGGTCTGGAGAAGGGGTGGAGGG - Intronic
1073527108 10:104193971-104193993 ACGGCTGCAGAGAGGGAGGATGG + Exonic
1073543929 10:104333627-104333649 AGGCATCCAGAGAGGAAGGAAGG - Exonic
1074145930 10:110717335-110717357 AGGGAGGAGGAGGGGGAGGAGGG - Intronic
1074699932 10:116083897-116083919 ATGTTTGCAGAGTGGCAGGAGGG - Intronic
1074724457 10:116293706-116293728 AGGGATGCAGAGGAAAAGGAAGG + Intergenic
1074827958 10:117228358-117228380 AGGGAGGAAGAGGGGAAGGAAGG - Intergenic
1074832897 10:117262275-117262297 AGGTATTCAGTGAAGGAGGAAGG + Intronic
1074857399 10:117483567-117483589 GGCTATGCAGAGGGACAGGAGGG + Intergenic
1075056470 10:119222596-119222618 AGGGAGGCAGAGCAGGAGGAGGG - Intronic
1075549155 10:123379427-123379449 GGGAATGCAGAGGGAGAGGGAGG - Intergenic
1075552497 10:123402415-123402437 AGGAAAGAAGAGAGGGAGGAGGG + Intergenic
1075704095 10:124488657-124488679 AAGGATGCAGAAGGGGAGGTGGG + Intronic
1076007976 10:126963560-126963582 AGGGAAGGAGAGGGAGAGGAGGG - Intronic
1076141705 10:128084556-128084578 AGGCATGCAGCTGGTGAGGATGG - Exonic
1076210262 10:128635028-128635050 AAGTAAGGAAAGGGGGAGGAAGG + Intergenic
1076296122 10:129386297-129386319 AGGAAGGCAGAGAGGGAGGGAGG + Intergenic
1076548268 10:131260454-131260476 AGGGATGCAGAGGGTCAGCAAGG + Intronic
1076558669 10:131346862-131346884 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558682 10:131346909-131346931 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076558695 10:131346956-131346978 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
1076673275 10:132134727-132134749 AAGTATGCAGATGGAGAGGGCGG - Intronic
1076723696 10:132403861-132403883 AGGTGGGCAGATGGGGATGAGGG + Intronic
1076823254 10:132952563-132952585 AGGTGTGCAGAGAGAGAGGGCGG + Intergenic
1077025164 11:436809-436831 AGGTGAGCAGAGGGTGAGCAGGG + Intronic
1077303174 11:1856418-1856440 AGGTCTGCAGAGGAGCAGGGCGG - Intronic
1078386578 11:10898355-10898377 AGGGCTGGAGAGGAGGAGGAGGG + Intergenic
1078579448 11:12527210-12527232 AGGAAGGCAAAGAGGGAGGATGG + Intronic
1078806082 11:14706110-14706132 AGGGAAGGAGAGGGGGAGAAAGG - Intronic
1080005929 11:27406345-27406367 AGATGTGGAGAGGGTGAGGAAGG - Intronic
1080279473 11:30539966-30539988 TGGGTTGCACAGGGGGAGGAAGG - Intronic
1080434037 11:32223500-32223522 AGGCAAGAAGAGGGGAAGGAAGG + Intergenic
1080467492 11:32511407-32511429 AGGATTCCAGAGAGGGAGGAGGG + Intergenic
1080582723 11:33657141-33657163 AAGCAAGCAGAGAGGGAGGAAGG + Intronic
1080941391 11:36922154-36922176 AGGTATGCAAGGAGGGAAGAGGG - Intergenic
1081102664 11:39024444-39024466 AGGCAAGCAGGGAGGGAGGAAGG - Intergenic
1081230137 11:40576150-40576172 AGGTCTGTAGAGAGGGATGAAGG + Intronic
1081557199 11:44175786-44175808 AGGGATGGAGAGAGGGAGAAAGG + Intronic
1081636726 11:44726880-44726902 AGGTTTGGGGAGGGGGAGGGAGG + Intronic
1081802263 11:45868080-45868102 AGGCATGGAGAGGGTGAGGCTGG + Intronic
1082763622 11:57149364-57149386 AGGAAGGAAGAGGGGAAGGAAGG + Intergenic
1083819590 11:65160660-65160682 AGGTATGAAGAGAGAGAGGAAGG + Intergenic
1084596757 11:70121118-70121140 AGCTCTGCACCGGGGGAGGAGGG - Intronic
1084920326 11:72464436-72464458 AGGGAAGGGGAGGGGGAGGAGGG - Intergenic
1084928663 11:72535902-72535924 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
1085023378 11:73222680-73222702 AGGTGGGCAAAGAGGGAGGAGGG - Intronic
1085052030 11:73384850-73384872 ATGAATGCTGAGGGGGAGGTGGG + Intronic
1085313352 11:75529082-75529104 ACGGAGGCAGAGGGGTAGGAAGG - Intergenic
1085502665 11:77037987-77038009 AGGGAGGAGGAGGGGGAGGAGGG + Intronic
1085983678 11:81757371-81757393 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1086517092 11:87625269-87625291 AGGGAAGCAGAGGGAGAAGAGGG - Intergenic
1086629369 11:88998121-88998143 AGGAAGGAAGAGGGGGAGGGAGG + Intronic
1086826217 11:91502112-91502134 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1087044078 11:93829928-93829950 AAGTTTGCAGAAGGTGAGGAAGG + Intronic
1087307085 11:96500654-96500676 TGGTATGCAGTGGAGAAGGAGGG - Intronic
1087508792 11:99062806-99062828 ATGTATCAAGAGTGGGAGGAGGG - Intronic
1087518817 11:99203020-99203042 AGGCAGGCAGAGAGGGAGGGAGG + Intronic
1087518821 11:99203036-99203058 AGGGAGGAAGAGAGGGAGGAAGG + Intronic
1088122439 11:106385998-106386020 AGGCATGGACAGAGGGAGGAAGG - Intergenic
1088455004 11:110024117-110024139 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1088749971 11:112835184-112835206 AAGGAAGAAGAGGGGGAGGAAGG - Intergenic
1089019972 11:115203355-115203377 AGGAAGGCAGAGGGGAGGGAAGG + Intronic
1089177373 11:116558435-116558457 AGGGTTACAGAGGCGGAGGAGGG + Intergenic
1089402661 11:118173281-118173303 AGGCATGGAGAAGGGAAGGAAGG - Intronic
1089490774 11:118882489-118882511 AGGTGTGAAGAGGGGAAAGAGGG + Intergenic
1089577936 11:119459954-119459976 AGGTGGGGAGAGGGAGAGGAGGG + Intergenic
1089736479 11:120553331-120553353 AGGAAGGAAGAGTGGGAGGAGGG + Intronic
1089751153 11:120652082-120652104 AGGTCTGCACGTGGGGAGGATGG + Intronic
1089759757 11:120714780-120714802 ATGTAGGGAGAGGGGGAGGTGGG + Intronic
1089848375 11:121476703-121476725 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1090226152 11:125073336-125073358 AGCTATGCACAGCGGGAGGCGGG + Intronic
1090475086 11:127013044-127013066 AGGGATGGAGAGAGGAAGGAAGG + Intergenic
1090477056 11:127032688-127032710 ATGTAAGCAGTGGGGGAGGGAGG - Intergenic
1090505369 11:127306879-127306901 GGGTAGGGAGAGGGGGAGGAAGG - Intergenic
1090507006 11:127326496-127326518 GAGTATGCTGAGGAGGAGGAGGG - Intergenic
1090670616 11:128942773-128942795 AGGTGAGGAGAGGGGGAGGGAGG - Exonic
1090712788 11:129402964-129402986 AGGTATTCAGATGAGGAGAATGG + Intronic
1090727862 11:129543898-129543920 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1090877838 11:130806804-130806826 AGCTGTGCAGGGTGGGAGGAGGG - Intergenic
1091309126 11:134560422-134560444 AGGTATGGAAAGGGGGATGAAGG - Intergenic
1092071348 12:5633911-5633933 AGGCATGCATATAGGGAGGAGGG - Intronic
1092241542 12:6839139-6839161 AGGTAAGGAGCGGGGTAGGAAGG + Exonic
1092802899 12:12188357-12188379 AGATGGGCAGAGAGGGAGGAAGG + Intronic
1092986612 12:13851922-13851944 GAGTAGGCAGAGGAGGAGGAGGG + Intronic
1092998249 12:13971488-13971510 AGGCACGCAGAGGAGGAAGAGGG - Intronic
1093066185 12:14660930-14660952 CGGTATCCAGAGAGGCAGGAAGG - Intronic
1093778609 12:23107087-23107109 AGGGAGGCAGAGGGGAAGTAGGG + Intergenic
1094362849 12:29649017-29649039 ATGTGGGCAGAGGTGGAGGATGG - Intronic
1094573117 12:31659361-31659383 AGGTAAGGAGACAGGGAGGACGG + Intronic
1095540676 12:43305359-43305381 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1095658087 12:44695053-44695075 AGGAAGGAAGAGAGGGAGGAAGG + Intronic
1095724444 12:45436274-45436296 AGGCAGGCAGAGGAGTAGGAAGG - Intronic
1095840443 12:46685923-46685945 AGGTCTGCAGTGGGTGATGAAGG + Intergenic
1095947711 12:47763298-47763320 TGGGATGGAGAGAGGGAGGATGG + Intronic
1096566826 12:52488975-52488997 AGAGATTCTGAGGGGGAGGAAGG - Intronic
1096910266 12:54976507-54976529 AGGAATGCAGAAGGGCAGGAGGG + Intronic
1097196071 12:57243082-57243104 AGGGATGGGGAGGGGGTGGAGGG - Intergenic
1097369457 12:58758942-58758964 AGGTGGGGGGAGGGGGAGGATGG - Intronic
1097584025 12:61493718-61493740 AGCTGTGCAGAGGAGGAGTATGG - Intergenic
1098008985 12:66030571-66030593 AGGAAAGGAGAGGGGAAGGAAGG - Intergenic
1098280087 12:68853835-68853857 AGGTAGGAAGAGGAGAAGGAAGG + Exonic
1098358023 12:69629435-69629457 AGGTAGGGAGTGGGGGAGCAGGG - Intergenic
1098526952 12:71497391-71497413 AGGGATGGAGGGAGGGAGGAAGG + Intronic
1098544819 12:71700096-71700118 ACTGATGGAGAGGGGGAGGAAGG - Intronic
1098980511 12:76951055-76951077 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1099331321 12:81292442-81292464 AAGTACGCTGAGGAGGAGGAAGG - Intronic
1099922506 12:88976981-88977003 AGGGAGGCAGAGGAGGAGGTCGG + Intergenic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1100065708 12:90641477-90641499 AGGCATGGAGGGAGGGAGGAAGG + Intergenic
1100370702 12:93966697-93966719 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
1100953120 12:99875039-99875061 AGGTAGACAGAGGGGGAGAGAGG + Intronic
1101408905 12:104453271-104453293 AGGAAAGGAGAGAGGGAGGAAGG - Intergenic
1102501188 12:113353654-113353676 AGGTAGGAAGAGAGGGAGGGAGG - Intronic
1102503151 12:113366786-113366808 AGGGAGGGAGAGGAGGAGGAGGG - Intronic
1102759678 12:115374601-115374623 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1102893219 12:116578308-116578330 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1102913675 12:116737563-116737585 AGGCAGGGAGAGGGGAAGGAAGG + Intronic
1102913687 12:116737607-116737629 AGGTAGGAAGAAGGGAAGGAAGG + Intronic
1103030220 12:117606667-117606689 AGGCAGGCAGGGAGGGAGGAAGG - Intronic
1103366827 12:120389753-120389775 AGGAAGGAAGAGAGGGAGGAGGG + Intergenic
1104191088 12:126482471-126482493 AGGGAGGAAGTGGGGGAGGAGGG - Intergenic
1104191098 12:126482494-126482516 AGGGAGGGAGAGGGGAAGGAGGG - Intergenic
1104668771 12:130666698-130666720 AGGAAGGGAGAAGGGGAGGAAGG + Intronic
1104668780 12:130666725-130666747 AGGGAAGAAGAGGGGAAGGAGGG + Intronic
1105548020 13:21365916-21365938 AGGCAGACAGAGGGGAAGGAAGG - Intergenic
1105725270 13:23157119-23157141 AGGCATGCAGAGTGGTAGAATGG + Intergenic
1107281842 13:38745568-38745590 AGGTCAACAGAGGGGGAGAAAGG - Intronic
1107337370 13:39369594-39369616 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1107543239 13:41412824-41412846 AGGGAGGCAGTGTGGGAGGAAGG + Intergenic
1107553875 13:41500752-41500774 GGCCATGCAGAGGGGGTGGATGG - Intergenic
1107814208 13:44229680-44229702 AGGTAGGGAGTGGGGCAGGAAGG - Intergenic
1107932297 13:45316280-45316302 AGAGAGGAAGAGGGGGAGGAGGG + Intergenic
1108030877 13:46228280-46228302 GGGTTTGCAGAATGGGAGGATGG + Intronic
1110490327 13:76096039-76096061 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
1110593361 13:77290695-77290717 AGCTAAGGAGAGGGTGAGGAAGG + Intronic
1110603451 13:77403277-77403299 AGGTAAGAAGACGGGGAGGGGGG - Intergenic
1110641510 13:77830170-77830192 AGGGAAGAAGGGGGGGAGGAAGG - Intergenic
1110721453 13:78766892-78766914 AGGATTGCAGAGGGGGAGACTGG + Intergenic
1110889793 13:80684720-80684742 AGGTAGGGAGTGAGGGAGGAAGG - Intergenic
1110912478 13:80981325-80981347 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
1111048441 13:82846831-82846853 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1111247454 13:85558935-85558957 AGGCATGGAAAGGGAGAGGAAGG - Intergenic
1112382992 13:98910862-98910884 AAGTATGCAGAGGGAGGGGTGGG - Intronic
1112520610 13:100091623-100091645 AGGTTTGCAGAGGTGGAGGGAGG - Intronic
1112649709 13:101381591-101381613 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1113049999 13:106200202-106200224 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1113309172 13:109113345-109113367 AGGAAGGAAGAGAGGGAGGAAGG + Intronic
1113663073 13:112120222-112120244 AGGAATGGAGGGAGGGAGGAAGG + Intergenic
1113673974 13:112195796-112195818 AGGAAGGAAGAGGGGAAGGAGGG - Intergenic
1113674103 13:112196303-112196325 AGGAATGAAGAGAGAGAGGAAGG - Intergenic
1113726149 13:112603829-112603851 AGGAAAGCAGAGAAGGAGGAAGG + Intergenic
1114216327 14:20660289-20660311 AGCGATGCAGAGGGAGAGGAAGG - Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1114477477 14:23007083-23007105 AGCTAGGCAGAGGCGGAGGCGGG + Intronic
1114516991 14:23306822-23306844 AGGGAGGGAGAGAGGGAGGAAGG - Exonic
1115761492 14:36581907-36581929 AGGCATGGAGAGGGGGCGGGGGG + Intronic
1116556453 14:46316335-46316357 AGGTATTCAGAGGGCAATGAAGG - Intergenic
1116808821 14:49519908-49519930 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1116927158 14:50651365-50651387 GGGTATTTACAGGGGGAGGAAGG + Intronic
1117412286 14:55461374-55461396 GGGCATGCAGAGGGAGTGGAGGG - Intergenic
1118110714 14:62715813-62715835 AGGAAGGCAGAAAGGGAGGAAGG + Intronic
1119055055 14:71410902-71410924 AGGTATGGAGGGAGGGGGGAAGG - Intronic
1119382610 14:74238940-74238962 AGGTGTGCAGAGGGTGATGTAGG - Intergenic
1119421421 14:74509921-74509943 AGGTAGGCAGGGGTGGGGGAAGG + Intronic
1119657178 14:76425520-76425542 AGGGAGGAGGAGGGGGAGGAAGG - Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1119922591 14:78460135-78460157 AGAGATGCAGAGTGGGAGGTAGG + Intronic
1120228509 14:81817945-81817967 AGGGATGGAGAGGGGGAGGACGG - Intergenic
1120291450 14:82577015-82577037 AGGTAAGAGGAGGGAGAGGATGG + Intergenic
1120635313 14:86943863-86943885 AGGCAGGCAGAGAGGAAGGAAGG - Intergenic
1120873756 14:89360413-89360435 AGGTAAAAAGAGAGGGAGGAAGG + Intronic
1121176755 14:91896381-91896403 AGGAATGAAGAGGGGAGGGAAGG - Intronic
1121885695 14:97540705-97540727 GGGTATGCAAAGGGGGTGAAGGG - Intergenic
1122293814 14:100693921-100693943 GGGTACGCAGAAGGGGTGGACGG - Intergenic
1122299890 14:100725597-100725619 AGGGAGGGAGAGGGGTAGGAGGG - Intergenic
1122667351 14:103340560-103340582 AGGTAAACATTGGGGGAGGAGGG + Exonic
1122828666 14:104384713-104384735 AGGTAGGCAGAGGGGGTGGGTGG + Intergenic
1123467877 15:20529619-20529641 GGGTATGCAGAGGGGCAGAACGG + Intergenic
1123650235 15:22471423-22471445 GGGTATGCAGAGGGGCAGAACGG - Intergenic
1123728192 15:23124828-23124850 GGGTATGCAGAGGGGCAGAACGG + Intergenic
1123740641 15:23280265-23280287 GGGTATGCAGAGGGGCAGAACGG - Intergenic
1123746357 15:23322293-23322315 GGGTATGCAGAGGGGCAGAACGG + Intergenic
1124278624 15:28345610-28345632 GGGTATGCAGAGGGGCAGAACGG + Intergenic
1124304076 15:28565998-28566020 GGGTATGCAGAGGGGCAGAACGG - Intergenic
1124439158 15:29674696-29674718 AGGCATGCCGGGGGGGCGGAGGG + Intergenic
1124532958 15:30522470-30522492 GGGTATGCAGAGGGGCAGATCGG - Intergenic
1124639638 15:31389498-31389520 ATGTAAACACAGGGGGAGGAGGG - Intronic
1124765699 15:32485174-32485196 GGGTATGCAGAGGGGCAGATCGG + Intergenic
1124803702 15:32860222-32860244 AGGTAGGAAGGGAGGGAGGAAGG + Intronic
1125513951 15:40307712-40307734 AGGCAGGCAGAAGGGCAGGAAGG + Exonic
1125895279 15:43296732-43296754 AAGAAAGGAGAGGGGGAGGAAGG + Intronic
1126765462 15:52007107-52007129 AGGTAGGAAGTGGGGTAGGAAGG - Intronic
1127072075 15:55296886-55296908 AGGTATGGATAGGTGCAGGAGGG + Intronic
1127410961 15:58706643-58706665 AGGTCTGCAGAGGAGGAAGGGGG + Intronic
1127552458 15:60054221-60054243 AGGGTTGAAGAGGGAGAGGAGGG + Intronic
1128430645 15:67590402-67590424 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1129020495 15:72513688-72513710 AGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129020524 15:72513746-72513768 AGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129020534 15:72513766-72513788 AGGGAGGGAGAGGGGGAGGGAGG - Intronic
1129406621 15:75323503-75323525 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1129748353 15:78040914-78040936 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1129914361 15:79255206-79255228 AGGGATGAGGAGGGGGATGAGGG - Intergenic
1130093107 15:80837646-80837668 AGGAAGGCAGATGGGGAAGAAGG - Intronic
1130286031 15:82555391-82555413 AGGGATGCACTGGGGAAGGAGGG - Intronic
1130608618 15:85339997-85340019 AGGGATTCAGAGGGGAAAGAGGG - Intergenic
1130721091 15:86386238-86386260 AGGGAGGAGGAGGGGGAGGAGGG - Intronic
1130817457 15:87452998-87453020 GGGTATGCAAAGGGGAATGAAGG - Intergenic
1131096662 15:89659514-89659536 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1131248541 15:90816562-90816584 AGGTGTGAAGAGGGGGTTGATGG + Intergenic
1131388791 15:92030381-92030403 AGCTCTGCAGTGGGGAAGGATGG + Intronic
1131460040 15:92611279-92611301 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
1132092379 15:98956918-98956940 AGGGATGGAGAGGGGCAGCAGGG + Intronic
1132311770 15:100862500-100862522 ACGTATGCAGCCGGGGAAGATGG - Intergenic
1132491530 16:234543-234565 AGGTCGGGAGAGGAGGAGGAGGG + Exonic
1132599459 16:767469-767491 TGGTATGGCGAGCGGGAGGAGGG + Exonic
1132676296 16:1122666-1122688 AGGTATGGAGAGGGCAAGCAGGG - Intergenic
1133389563 16:5398675-5398697 AGGTTGACAGTGGGGGAGGAAGG + Intergenic
1133589673 16:7230011-7230033 AGGGAGGAAGAGGGGAAGGAAGG + Intronic
1133604963 16:7377965-7377987 AGGTATGGAGAGGAAGAGCACGG + Intronic
1133698284 16:8285873-8285895 AGGTAAAAAGAGAGGGAGGATGG - Intergenic
1133882363 16:9794928-9794950 AAGGATGAAGAGGAGGAGGAGGG + Intronic
1133964084 16:10518880-10518902 AGGGATGAAGAGAGGAAGGAAGG - Intergenic
1134031003 16:10992262-10992284 AGGGATGCGGATGGGGAAGATGG - Intronic
1134302832 16:13006965-13006987 AGGTATGCAGAAGGTGTCGAGGG - Intronic
1134452685 16:14373182-14373204 AGGTATGGAGTTGGGGAGCAGGG + Intergenic
1134556890 16:15173239-15173261 AGGGAAGCATAGGGGAAGGATGG + Intergenic
1134805123 16:17117880-17117902 GGGTATGCAGAAGTGGGGGAAGG - Exonic
1134917469 16:18084957-18084979 AGGGAAGCATAGGGGAAGGATGG + Intergenic
1135510349 16:23077575-23077597 AGGTAGGGAGAGATGGAGGAGGG - Intronic
1135591915 16:23711119-23711141 GGGGATGCAGCAGGGGAGGAAGG + Intronic
1135728193 16:24873228-24873250 AGGAATGGAGAGAGGGAGGGAGG + Intronic
1135740258 16:24969309-24969331 AGGAAAGGAGAGAGGGAGGAGGG - Intronic
1135922495 16:26663637-26663659 AGGAATGAAGATGGGGAGGGAGG + Intergenic
1135939525 16:26809449-26809471 AAGGATGAAAAGGGGGAGGAAGG + Intergenic
1136375259 16:29861635-29861657 AGGCATGCTTAGAGGGAGGATGG - Intronic
1136519137 16:30785159-30785181 AAGTAAGGAGAAGGGGAGGATGG + Intronic
1136589061 16:31206309-31206331 AGGGAGGGAGAGGGGGAGGGAGG - Intergenic
1136935598 16:34461046-34461068 AGAAATGAAGAGAGGGAGGAGGG - Intergenic
1136964220 16:34887524-34887546 AGAAATGAAGAGAGGGAGGAGGG + Intergenic
1137875921 16:51996708-51996730 TGGTTTAAAGAGGGGGAGGAGGG - Intergenic
1138215506 16:55201561-55201583 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1138249484 16:55491042-55491064 AGGCAAGCAGAGGGGGAAGAAGG - Intronic
1138498401 16:57423075-57423097 AGGGATGGAGAGAGGAAGGAAGG + Intergenic
1138938417 16:61759452-61759474 GGGGATGGAGAAGGGGAGGATGG + Intronic
1138991616 16:62397122-62397144 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139317483 16:66086174-66086196 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1139613642 16:68076031-68076053 AGGTGTGGAGAGGGGGAGCAGGG + Intronic
1140004178 16:71058852-71058874 AAGTAGGCTGAGGAGGAGGAGGG - Intronic
1140015435 16:71177753-71177775 AAGTAATCAGATGGGGAGGAAGG - Intronic
1140469632 16:75206844-75206866 AGGTCTGCTGGGGGTGAGGAAGG + Intronic
1140655139 16:77132368-77132390 GGGGATGGGGAGGGGGAGGAGGG - Intergenic
1140828066 16:78726100-78726122 AGGGAGGCAGAGAGGGAGGGAGG - Intronic
1140912633 16:79467845-79467867 AGGAAGGGAGAGGGGGAGAAAGG + Intergenic
1140914041 16:79478968-79478990 AGGTATGCTGAGGTGGTGCACGG - Intergenic
1140944635 16:79756500-79756522 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1141003565 16:80331151-80331173 AGGGATGCTGGAGGGGAGGAGGG - Intergenic
1141093561 16:81147145-81147167 AGGTATACAGAGGGAGGGGATGG + Intergenic
1141167291 16:81669126-81669148 AGGTATGAAGTGGGTGTGGAAGG - Intronic
1141167331 16:81669312-81669334 AGGTATGAAGTGGGTGTGGAAGG - Intronic
1141167353 16:81669403-81669425 AGGTATGAAGTGGGTGTGGAAGG - Intronic
1141472489 16:84248689-84248711 AGGGAGGCAGAGGAGGACGAAGG - Intergenic
1141602224 16:85133799-85133821 AGGGGTGCAGAGGGGGAGGTGGG + Intergenic
1141603113 16:85138016-85138038 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1141734610 16:85844043-85844065 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1141854924 16:86674258-86674280 AGGGATGGAGAGGGGTTGGAGGG - Intergenic
1142259996 16:89038224-89038246 AGGCATGCAGGGGGTGAGGCTGG + Intergenic
1142526298 17:543952-543974 AGGAAGGGAGAGTGGGAGGAAGG + Intronic
1142526305 17:543976-543998 AGGAACGGAGAGAGGGAGGAAGG + Intronic
1142653665 17:1374839-1374861 AGGGATGCAGAGGGGGTTGGGGG - Intronic
1142661843 17:1435866-1435888 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
1142729171 17:1839745-1839767 AGCTACTCAGAGGGTGAGGAGGG - Intronic
1143637898 17:8176811-8176833 AGGCATGCAGAGGAGGGGAAGGG - Intergenic
1143683638 17:8496205-8496227 AGGGACGCAGAGGGGCAGCAGGG + Intronic
1143766725 17:9142573-9142595 AGGTTTGAAGAGGGCGGGGAAGG + Intronic
1144439503 17:15268812-15268834 AAGAAGGCAGAGGGGAAGGAAGG + Intergenic
1144499719 17:15775511-15775533 AGGAAAGAAGAGAGGGAGGAAGG - Intergenic
1144873622 17:18385037-18385059 AGAGAGGCAGAGGGGGAGAAAGG + Intronic
1144947254 17:18976271-18976293 AGATTTGCAGAATGGGAGGAGGG - Intronic
1145120852 17:20258304-20258326 TGGTTGGCAGAGGGAGAGGATGG + Intronic
1145158851 17:20560764-20560786 AGAGAGGCAGAGGGGGAGAAAGG - Intergenic
1145964463 17:28906988-28907010 TGGTATTCTGAGGAGGAGGAGGG + Exonic
1146001658 17:29133962-29133984 AGGGATGGAGTGGAGGAGGAAGG + Intronic
1146599135 17:34198694-34198716 AGGAAGGCAGGGAGGGAGGAAGG + Intergenic
1146712461 17:35054542-35054564 AGGAATGGAGAGGTGGGGGAGGG - Intronic
1146784793 17:35710205-35710227 GGGAAAGCAGAGGGGAAGGATGG - Intronic
1146820894 17:35982977-35982999 AGGGATGAAGGGAGGGAGGAAGG - Intergenic
1147002926 17:37377852-37377874 GGGTGAGCAGAGGGGGAGGAGGG - Intronic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147439084 17:40436513-40436535 AGGCATGCAGCTGGGGAGTAAGG + Intergenic
1147511895 17:41076960-41076982 AGGAAAGAAGAGAGGGAGGAAGG + Intergenic
1147583296 17:41638657-41638679 AGGGGTGCAGAGGGGAAGAAAGG - Intergenic
1147986966 17:44312369-44312391 AGGGTGGCAGATGGGGAGGAAGG - Intronic
1148255197 17:46125030-46125052 AGGTAGGGAGGGAGGGAGGAGGG + Intronic
1148774162 17:50085224-50085246 AGGAAGGAAGAGAGGGAGGAAGG + Intronic
1148876889 17:50693305-50693327 AAATATGCAGTGGAGGAGGAGGG + Exonic
1149693578 17:58598732-58598754 AGGTAACCTGAGTGGGAGGAAGG - Intronic
1149737645 17:59011055-59011077 AGCTATGCAGAGGCTGAGGCAGG + Intronic
1149992589 17:61391210-61391232 AGGGAGGCAGAGGAGGAGGAGGG + Intronic
1150235149 17:63586907-63586929 ATCTATGCAGAGGGGGATGGAGG - Intronic
1150290799 17:63980461-63980483 AGGGATGGGGTGGGGGAGGAGGG + Intergenic
1151385610 17:73753530-73753552 CAGGAGGCAGAGGGGGAGGAAGG + Intergenic
1151825991 17:76524661-76524683 AGGTACGAGGAGGAGGAGGATGG - Intergenic
1151969228 17:77449402-77449424 AGGAATCCAGAGGCAGAGGAGGG + Intronic
1152091457 17:78249864-78249886 AGGGAGGCATAGAGGGAGGAGGG + Intergenic
1152508982 17:80772457-80772479 AGGCATGTGGAGGGAGAGGAAGG - Intronic
1152575328 17:81137488-81137510 AGGAATGCAGAGGCGGCGGTGGG - Intronic
1152859082 17:82685211-82685233 AGGAATGGGGAGGGGGAGGGAGG + Intronic
1153515715 18:5899030-5899052 AGGTATGAAAAGGGTAAGGAAGG - Intergenic
1154031402 18:10756863-10756885 AGGGATGGAGATGAGGAGGAAGG + Intronic
1154063235 18:11083129-11083151 AGGTATGCAAAGGTAGAGAACGG - Intronic
1154991112 18:21599699-21599721 AGGGAGGAAGAGGAGGAGGAAGG - Intronic
1155066561 18:22273834-22273856 AGGAGGGAAGAGGGGGAGGAGGG - Intergenic
1155240125 18:23856857-23856879 AGGTATCCAGATGGGGAGGAGGG - Intronic
1156202606 18:34851735-34851757 AGATATGCAGACAAGGAGGAGGG - Intronic
1156513352 18:37660021-37660043 AGGAAGGCAGTGGGGGAGGGAGG + Intergenic
1156721122 18:40071122-40071144 AGGAAGGCAAAGGGGGAGGGAGG - Intergenic
1157166053 18:45359377-45359399 AGAGAGGCAGAGGAGGAGGAGGG - Intronic
1157409146 18:47449215-47449237 AGGTAGGCCAAGTGGGAGGAAGG - Intergenic
1157602899 18:48905172-48905194 AGGGAAGGAGAGAGGGAGGAAGG + Intergenic
1157618727 18:49003211-49003233 GGGGAGGAAGAGGGGGAGGAGGG - Intergenic
1157850294 18:51042368-51042390 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
1157863158 18:51159756-51159778 AGGGATGCAGAGGGCAGGGACGG + Intergenic
1157924529 18:51748895-51748917 ACCTAGGCAGAGGGTGAGGATGG - Intergenic
1158153112 18:54394441-54394463 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1158758883 18:60360354-60360376 AGGAAGGGAGAGGGGGAAGAAGG - Intergenic
1158931483 18:62328201-62328223 AGGAAGGGAGAGAGGGAGGAGGG + Intronic
1159324067 18:66892774-66892796 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1159445034 18:68531569-68531591 AGGTAGGTAGAGAGGGAGGGAGG + Intergenic
1159460383 18:68715344-68715366 AGTTATGCTGAGGGTGAGGTAGG + Intronic
1159527894 18:69617435-69617457 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1159547000 18:69852084-69852106 AGATATGAGGAGGGAGAGGAAGG - Intronic
1160017158 18:75153851-75153873 AGCCATGCAGAAGGGGAGTATGG - Intergenic
1160135826 18:76270939-76270961 AGGTATGGAGAGAAGGTGGACGG - Intergenic
1160222497 18:76987494-76987516 AGGAAGGAAGAGAGGGAGGAAGG - Intronic
1160448681 18:78947133-78947155 AGGGAGGAGGAGGGGGAGGAAGG + Intergenic
1160498597 18:79389942-79389964 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1160544320 18:79642496-79642518 AGGAATGCAGAGGTGGATGGTGG + Intergenic
1160582871 18:79897628-79897650 GGGTATGTGGAGGAGGAGGAGGG - Intronic
1160823607 19:1069229-1069251 AGGCATGGCGAGGGGCAGGATGG + Intronic
1161139585 19:2639691-2639713 AGGCAGGGAGTGGGGGAGGAGGG + Intronic
1161329029 19:3677787-3677809 AGGGATGCAGGGAGGGAGGGAGG + Intronic
1161638120 19:5401951-5401973 AGGGAGGCAGGGGGGAAGGAGGG + Intergenic
1161913929 19:7214909-7214931 AGGGAGGGAGAGGGGAAGGAAGG - Intronic
1162072958 19:8165882-8165904 AGGGAGGGGGAGGGGGAGGAGGG + Intronic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162338971 19:10080024-10080046 AGGAATGGAGGGAGGGAGGAAGG + Intergenic
1162473166 19:10884552-10884574 AGGCAAGCACAGGGGGAGGGGGG - Intronic
1162530025 19:11230618-11230640 GAGGATGCAGAGGTGGAGGAGGG + Intronic
1162950568 19:14069839-14069861 AGGAAGCCAGAGGGGAAGGAAGG + Intergenic
1163402897 19:17105036-17105058 AGGGATGAACAGGGGGAGCATGG - Intronic
1163415571 19:17184540-17184562 AGCTATGCAGAGGAGAGGGACGG + Intronic
1163593636 19:18208300-18208322 AGGGAGGCAGAGGGGAGGGATGG + Exonic
1163703185 19:18797105-18797127 AGGAAGGGAGAGGGGGAGGGAGG - Intergenic
1163720986 19:18898235-18898257 TGGCAGGCAGAGGGGGACGAGGG + Intergenic
1163758902 19:19122390-19122412 AGGAATCTAGAGGGGGATGAAGG + Intronic
1164064770 19:21706422-21706444 AGGGATGCACAGGATGAGGAAGG + Intergenic
1164441120 19:28281695-28281717 AGGAATGAAGAGGGAGAAGAGGG - Intergenic
1164441771 19:28284751-28284773 AGGAAGGTAGAGGGGAAGGAGGG + Intergenic
1164476499 19:28579650-28579672 AGAAGTGCAGAGGGTGAGGAAGG + Intergenic
1164800234 19:31069749-31069771 AGGTATGCAGAAGAGAAGGAAGG + Intergenic
1164925578 19:32127614-32127636 AGGAAAGGAGAGAGGGAGGAAGG + Intergenic
1165639118 19:37369261-37369283 AGGACTGCAGAGCAGGAGGAAGG + Intronic
1165670276 19:37672407-37672429 AGGGATGGAGGGAGGGAGGAAGG + Intronic
1165762482 19:38329793-38329815 AGGAATGAAGAGGGAGACGATGG + Intergenic
1165789785 19:38484411-38484433 AGGGAGGGAGAGGGGAAGGAAGG - Intronic
1165935201 19:39384735-39384757 AGGTGGGTTGAGGGGGAGGAGGG - Exonic
1166546750 19:43638884-43638906 AGGGATAGAGAGAGGGAGGAAGG + Intronic
1166751382 19:45165379-45165401 AGGTCTGCAGAGGTGGGTGAGGG - Intronic
1166832270 19:45645701-45645723 AGGGATGCAGAGGGATTGGAAGG + Intergenic
1166975331 19:46602069-46602091 AGCACTGCAGAGGAGGAGGAGGG + Intronic
1167279148 19:48556415-48556437 GGGTTAGCAGACGGGGAGGAGGG + Intronic
1167286681 19:48602343-48602365 AGGGATGCAGAGGAGGAAGCAGG + Intronic
1167379155 19:49128642-49128664 AGTTATGGAGACAGGGAGGAAGG - Intronic
1167487735 19:49772984-49773006 AGGGATGCGGAGGAGGAGGTGGG + Intronic
1167577581 19:50325217-50325239 AGATATGCAGAGGGGTGGGAGGG + Intronic
1167789716 19:51666669-51666691 AGGTAGGAAGGGAGGGAGGAAGG + Intergenic
1167978255 19:53250669-53250691 AGGGATGGAGGGTGGGAGGAGGG + Intronic
1168411267 19:56141610-56141632 AGAAATGCTGAGGGAGAGGACGG + Intronic
1168532032 19:57137813-57137835 AGGAATGGAGAGAGGGAGGGAGG + Intronic
1168587352 19:57604171-57604193 AGGTGGGGAGATGGGGAGGAGGG + Intronic
1168725049 19:58576396-58576418 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1168725055 19:58576420-58576442 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
925148328 2:1598166-1598188 CGGCGTGCAGAGGGGAAGGAGGG + Intergenic
925166694 2:1719981-1720003 AGGGATGCAGAGAGAGAGGGAGG + Intronic
925166711 2:1720064-1720086 AGGGATGCAGAGAGAGAGGGAGG + Intronic
925166717 2:1720088-1720110 AGGGATGCAGAGAGAGAGGGAGG + Intronic
925166723 2:1720112-1720134 AGGGATGCAGAGAGAGAGGGAGG + Intronic
925166765 2:1720356-1720378 AGGGATGCAGAGAGAGAGGGAGG + Intronic
925166776 2:1720415-1720437 AGGGATGCAGAGAGAGAGGTGGG + Intronic
925299481 2:2800297-2800319 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
925507706 2:4586778-4586800 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
925659133 2:6183986-6184008 AGAAATGAAGAGAGGGAGGAAGG + Intergenic
926037898 2:9649346-9649368 AGCCCTGGAGAGGGGGAGGAGGG - Intergenic
926244636 2:11113688-11113710 AGGAAAGAAGAGAGGGAGGAAGG - Intergenic
926291976 2:11538824-11538846 AGGGATGGAGGGAGGGAGGAAGG - Intronic
926398097 2:12466891-12466913 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
926544891 2:14227178-14227200 AGGGAGGAAGAGGGGGTGGAAGG + Intergenic
926715403 2:15920112-15920134 AGGAAGGAAGAGAGGGAGGAGGG - Intergenic
927253377 2:21018389-21018411 AGATATGGAGAGGTGAAGGAAGG - Intronic
927617786 2:24617107-24617129 TGGTATGAAGTTGGGGAGGATGG + Intronic
927654312 2:24932645-24932667 AGGTGGACAGAGGGGGAGGGAGG + Intergenic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
927935268 2:27072388-27072410 AGGAATGGAGAAGAGGAGGAAGG + Intergenic
928742662 2:34373265-34373287 AGGGAAGGAGAGAGGGAGGAGGG - Intergenic
928822380 2:35377098-35377120 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
928872358 2:35995070-35995092 AGGTTTGGAGAGGGTGAAGAGGG - Intergenic
928915364 2:36464691-36464713 ATTTGTGCAGAGGAGGAGGAGGG + Intronic
929408408 2:41669180-41669202 AGGTAGGGAAAGGAGGAGGAAGG - Intergenic
929571795 2:43027351-43027373 AGCTAGGCAGAGGGGGTGGGGGG - Intergenic
929575215 2:43047372-43047394 AGGCATACAGAGTGGTAGGACGG - Intergenic
929590186 2:43140471-43140493 GGGTCAGCAGAGGTGGAGGATGG - Intergenic
929591536 2:43150671-43150693 AGGGGTGCACAGAGGGAGGAAGG - Intergenic
929961675 2:46501480-46501502 ATGTATGCAGAGGAAAAGGATGG + Intronic
930253388 2:49061006-49061028 AGGTATGGGCAGGGGGAGAAAGG - Intronic
930272385 2:49272018-49272040 AGGAAGGGAGAGGGGGAGGGAGG - Intergenic
930409306 2:51003745-51003767 AGCAAAGGAGAGGGGGAGGAAGG + Intronic
930517341 2:52424515-52424537 AGGGAGGCAGCGAGGGAGGAAGG + Intergenic
930752197 2:54945047-54945069 GGGGAGGCAGAGAGGGAGGAGGG - Intronic
930786292 2:55274450-55274472 AGGAATGCAGGGAGGGAGGAAGG + Intergenic
930999029 2:57759322-57759344 TGGTATGCAAAGTGGGAGGGAGG + Intergenic
931261860 2:60626984-60627006 ATGAATGAAGAGGGGGAAGAAGG + Intergenic
931578143 2:63742272-63742294 AGGAAGGGAGAGAGGGAGGAAGG + Intronic
931710748 2:64988037-64988059 AGGGAGGGAGGGGGGGAGGAAGG + Intergenic
931853722 2:66279874-66279896 AGCTATGCAGTGGGAGAGAAAGG - Intergenic
932259041 2:70311490-70311512 AGGTGTGCAGAGGGGTTGGGGGG + Intergenic
932369346 2:71174571-71174593 AGAGCTGCAGAGGGGAAGGAGGG + Intergenic
932455060 2:71844249-71844271 AGGGATGCAGGGGTGGAGGAAGG - Intergenic
932486822 2:72089226-72089248 AGAGATGAAGAGAGGGAGGAAGG + Intergenic
932989401 2:76767658-76767680 TGCTATGCAGAGTGGGAGCATGG - Intronic
933195842 2:79388630-79388652 AGCAATGTAGAGTGGGAGGAGGG - Intronic
933251553 2:80034804-80034826 TAGAATGCAGTGGGGGAGGAAGG + Intronic
933403266 2:81825886-81825908 AGGGAAGAAGAGAGGGAGGAAGG - Intergenic
933994457 2:87657647-87657669 AGGAATGAAGAGTGGGAGAAAGG + Intergenic
934124181 2:88870619-88870641 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
934564550 2:95331040-95331062 AGGCAGGCAGAGGGGCAGCAAGG + Intronic
934780759 2:96968376-96968398 TGGTTTGCAGGGCGGGAGGAGGG - Intronic
934970734 2:98762078-98762100 AGTTATGCTGATGGGGAGCAAGG + Intergenic
935081764 2:99804891-99804913 AGGTATACAGAGTGGGAAAATGG + Intronic
935255402 2:101305713-101305735 AGGGAGGGAGAGGGAGAGGAGGG + Intronic
935998332 2:108798686-108798708 AGGCGTGGAGAGGAGGAGGAAGG - Intronic
935998342 2:108798794-108798816 AGGTGTGGAGAGGAGGAGGAAGG - Intronic
936092518 2:109510561-109510583 TGGGCTGCAGAGGGTGAGGATGG - Intergenic
936095797 2:109529313-109529335 AGGAGTGCAGAGGAGGAGGAAGG + Intergenic
936299399 2:111293266-111293288 AGGAATGAAGAGTGGGAGAAAGG - Intergenic
936381881 2:111993603-111993625 AGGTTTGGAAAAGGGGAGGAAGG + Intronic
936458969 2:112697333-112697355 AGGGATGGAGAGAGGGAGGGAGG - Intergenic
936679848 2:114757342-114757364 AAGTAGGGAGAGGGGGAGGGAGG + Intronic
936846380 2:116839985-116840007 AGGGATGCAGGGAGGGAGGGAGG + Intergenic
936886788 2:117319906-117319928 AGGAAGGCAGAGAGGAAGGAAGG + Intergenic
936999068 2:118446690-118446712 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
937025980 2:118697363-118697385 AGTGAGGCACAGGGGGAGGAAGG + Intergenic
937072271 2:119073326-119073348 AGGCAGGCAGGGAGGGAGGAAGG + Intergenic
937282186 2:120726162-120726184 AGAGATGGAGAGGGGGAGCAGGG + Intergenic
937384721 2:121418459-121418481 AAGCATGCAGAGGGGGACAAGGG + Intronic
937843637 2:126553518-126553540 GGGTATGCTGAGGTAGAGGAGGG - Intergenic
937927227 2:127176633-127176655 AGATGTGTAGATGGGGAGGAGGG + Intergenic
937955026 2:127417280-127417302 AGGTGTGCAGAGGGGGACTGAGG - Intergenic
937972973 2:127564557-127564579 AGGTGTGTGGAGGGGCAGGACGG + Intronic
938120431 2:128629180-128629202 AGGAAGGCAAAGGGGGTGGAAGG - Intergenic
938302668 2:130228210-130228232 AGGTTCCCAGAGGAGGAGGAGGG - Intergenic
938554158 2:132408655-132408677 AGGGAGGGAGAGGGGGAGGAAGG + Intergenic
938588122 2:132711803-132711825 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
938671151 2:133588270-133588292 AGGTAGGGAGAGAGGGAGGGAGG - Intergenic
938671217 2:133588482-133588504 AGGTAGGAAGAGAGGGAGGGAGG - Intergenic
938711825 2:133981730-133981752 CGGCATGCAGAGGTGGAGGCCGG - Intergenic
938927320 2:136055833-136055855 ATGGATGCAGCGGGAGAGGAAGG - Intergenic
939485093 2:142801575-142801597 AGGGATGAAGTGGGGGATGAAGG + Intergenic
940815575 2:158293941-158293963 AGGGAGGGAGAGGGGAAGGAAGG - Intronic
941339319 2:164287006-164287028 AGGAAGGAAGAGGGGGAGGGAGG + Intergenic
941479232 2:165985296-165985318 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
941799982 2:169648558-169648580 AGGTATGCAGATGGCTAGCAAGG + Intronic
941800427 2:169653307-169653329 AGGTGAGAAGAGGGAGAGGAGGG + Intronic
942068925 2:172297839-172297861 AGGTAAGCAGAGGGGGAGGAGGG - Intergenic
942760775 2:179394793-179394815 AGGTATGTAGGGAAGGAGGATGG + Intergenic
942893596 2:181021607-181021629 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
943300180 2:186188577-186188599 AGGCATGTAGAGGTGGAGGGAGG - Intergenic
944580176 2:201125543-201125565 AGGCAAGCAGAGGGACAGGAGGG + Intronic
944882149 2:204024279-204024301 GAGTATGAAGTGGGGGAGGAGGG + Intergenic
945148481 2:206763556-206763578 AGGTTTTTAGAAGGGGAGGAGGG - Intronic
945918137 2:215726205-215726227 AGGAAGGCAGAGAGGGAGGGAGG + Intergenic
945960894 2:216133887-216133909 AGGTAGGCAGGGGTGTAGGAGGG + Intronic
946552972 2:220823513-220823535 AGGTAGGGAGGGAGGGAGGAGGG - Intergenic
947016255 2:225623231-225623253 AGGCAGGCAGAGGAGTAGGAAGG + Intronic
947029932 2:225782570-225782592 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
947029997 2:225782836-225782858 AGGTATGGAGGAAGGGAGGACGG - Intergenic
947133370 2:226952813-226952835 AGGGAGGGAGAGGGGGTGGAGGG + Intronic
947300990 2:228688693-228688715 AGGGGTGCAGAGGAGCAGGAAGG - Intergenic
947678447 2:232007084-232007106 AGGTGGGCAGAAGGGGAGCAGGG + Intronic
947693401 2:232161448-232161470 AGTAATGGAGAGAGGGAGGAAGG - Intronic
947996631 2:234533534-234533556 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
948550808 2:238772112-238772134 AGCTATGCCGAGGGGGAGAGTGG - Intergenic
948601734 2:239111425-239111447 AGCTCTGCAGAGGCTGAGGAGGG - Intronic
948660110 2:239501748-239501770 AGGGAGGGAGAGGGGTAGGAGGG + Intergenic
1168798606 20:629209-629231 TGGGAGGCAGAGGAGGAGGACGG + Intergenic
1168896605 20:1328155-1328177 AGTTGTGCAGAGAGGGAGTAAGG + Intronic
1168955083 20:1828973-1828995 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1168996200 20:2135045-2135067 AAGTCTCCAGAGGGGGAGTAGGG + Intronic
1169280978 20:4266667-4266689 AAGAATGGAGAGGGGGAAGAAGG + Intergenic
1169481845 20:5989732-5989754 AGGTATGCAGATGGGTAGAAGGG + Intronic
1169867952 20:10219889-10219911 AGCTATGCAGGAGGTGAGGAGGG - Intronic
1170171223 20:13415233-13415255 AGGAAACCAGAGGGAGAGGAAGG + Intronic
1170438481 20:16353802-16353824 AGGTATCCATATGGGGTGGAAGG + Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1170714081 20:18817227-18817249 TGGGATGCAGGGGGTGAGGAAGG + Intronic
1170953352 20:20956264-20956286 AGGGATGCAAGGGAGGAGGAAGG + Intergenic
1171151848 20:22834618-22834640 AGGAAGGCAGAGAGGGAGGGAGG - Intergenic
1171185586 20:23121900-23121922 GGGGCTGCAGAGGGGGAGGGTGG + Intergenic
1171209948 20:23309373-23309395 AGGAAGGCAGGGGAGGAGGAGGG - Intergenic
1171214125 20:23339991-23340013 AGGAATGCAGAGGGCAAGGCTGG + Intergenic
1171366661 20:24629484-24629506 AGGGAGGCAGAGGAGGAGGAAGG + Intronic
1171769733 20:29313451-29313473 AGGTAGGCTGACGGGAAGGAGGG + Intergenic
1172632260 20:36386361-36386383 AGGAAGGTAGAGAGGGAGGAGGG + Intronic
1172649289 20:36491637-36491659 GGGTATGCTGAGGGGGTGGGAGG + Intronic
1172777144 20:37414441-37414463 AGGAAGGCAGAGGTGGGGGAAGG - Intergenic
1172919801 20:38472036-38472058 GGGTATTGAGAGAGGGAGGAGGG - Intergenic
1172948172 20:38704323-38704345 CCCTATGCAGAGGGGCAGGATGG + Intergenic
1173289459 20:41701720-41701742 AGCTATGCGGAGGGAGAAGAAGG - Intergenic
1173461204 20:43244780-43244802 AGATATGCTGAGGGGGTGGACGG - Intergenic
1173578567 20:44129902-44129924 AGGAATGCAGAGGGCCAGCAGGG + Intronic
1173697935 20:45037300-45037322 ATGTGTGCAAAAGGGGAGGAAGG + Intronic
1173735500 20:45358532-45358554 AGGAAGGGAGAGGGGGAGGAAGG + Intergenic
1173751801 20:45482274-45482296 GAGTATGGAGAGGGGGAGGATGG - Intergenic
1173759275 20:45545587-45545609 AGGTGAGGACAGGGGGAGGAGGG + Intronic
1173866167 20:46313862-46313884 AGGTAGGGAGAGGGAAAGGAGGG - Intergenic
1174151878 20:48491772-48491794 AGGCAAACAGAGGGAGAGGAAGG - Intergenic
1174194796 20:48765615-48765637 AGTCATGCAGAGGAGGAGGACGG + Intronic
1174200507 20:48803503-48803525 AGGTATGTACAGGGAGAGGGAGG + Intronic
1174200638 20:48804341-48804363 AGGGAGACAGAGGGGGAGCATGG + Intronic
1174217832 20:48930812-48930834 CGGTATACAGAGGGAGAGGCAGG + Intronic
1174408952 20:50321378-50321400 AGGTAAGCAGAGGAGGATGTGGG - Intergenic
1174793657 20:53503696-53503718 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1175227651 20:57454110-57454132 AGGAATGGAGGGAGGGAGGAAGG + Intergenic
1175302558 20:57953145-57953167 AGGAATGCAGAGTTGGGGGAAGG - Intergenic
1175392547 20:58636229-58636251 AGGAAGGAAGGGGGGGAGGAAGG + Intergenic
1175566902 20:59987377-59987399 AGGAAAGCAGAGAGGAAGGAGGG - Intronic
1175812376 20:61865140-61865162 AGGGATGCAGGGTGGCAGGAGGG - Intronic
1175934718 20:62509516-62509538 AGGTGTGGAGGGGTGGAGGATGG - Intergenic
1175935021 20:62510341-62510363 AGGGTTGGAGAGGTGGAGGATGG - Intergenic
1175935065 20:62510455-62510477 AGGGGTGGAGAGGTGGAGGATGG - Intergenic
1175935128 20:62510640-62510662 AGGGATGGAGAGGTGGAGGGTGG - Intergenic
1175935174 20:62510749-62510771 AGGGATGGAGAGGTGGAGGATGG - Intergenic
1175984073 20:62755476-62755498 AGGGATGGAGGGAGGGAGGATGG - Intronic
1176057144 20:63154843-63154865 AGGGAGGGAAAGGGGGAGGAGGG - Intergenic
1176383978 21:6127845-6127867 AGGGAGGCAGAGAGGGAGGGAGG + Intergenic
1177304301 21:19292857-19292879 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1177457192 21:21355508-21355530 AGGGAGGGAGAGAGGGAGGAGGG + Intronic
1178379125 21:32093533-32093555 AGGAAGGAAGAGGGGAAGGAAGG - Intergenic
1178379284 21:32094379-32094401 AGGGATGGAAAGGCGGAGGAGGG + Intergenic
1178439896 21:32590309-32590331 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1178466495 21:32853360-32853382 AGGAATGCAGTGGGGCAGGGAGG + Intergenic
1178699569 21:34821492-34821514 CGGTTTGCAGAGGGGGAGAAGGG + Intronic
1178816567 21:35935473-35935495 AGGAATGCAGAGGAGGTGGAGGG - Intronic
1178947421 21:36959782-36959804 AGGTATGTGGAGGGTGAGCAAGG - Intronic
1178974718 21:37210899-37210921 AGGGAGGGGGAGGGGGAGGAAGG + Intergenic
1179508930 21:41859503-41859525 GGGTCTGCAGACGGGGAGGAAGG - Intronic
1179713110 21:43274359-43274381 GGGTGTGCAAAGGGGAAGGACGG - Intergenic
1179739496 21:43410393-43410415 AGGGAGGCAGAGAGGGAGGGAGG - Intergenic
1180595713 22:16971878-16971900 AGGAATGCAGAGGCCCAGGAAGG - Intronic
1181116119 22:20633379-20633401 AGTTGGGCAGAGAGGGAGGAGGG - Intergenic
1181333358 22:22111605-22111627 AGAGATGCAGAGAGGGAGGGTGG - Intergenic
1181465362 22:23107931-23107953 AGGCCTGCTGCGGGGGAGGAAGG + Intronic
1181526909 22:23495076-23495098 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1181544906 22:23597171-23597193 AGGGATGGAGGGAGGGAGGAAGG - Intergenic
1181678404 22:24473089-24473111 AGGTATACAGAGAAGTAGGAGGG + Intergenic
1181897147 22:26120396-26120418 AGGGATGAAGAGAGGGAGGGAGG + Intergenic
1182235208 22:28869766-28869788 AGTAATGCAGAGGGGGAGGGAGG + Intergenic
1182297225 22:29316624-29316646 AGGAGAGCAGAGGCGGAGGATGG - Intronic
1182441692 22:30368377-30368399 AGGTAGGCAGAGGGTCAGGTAGG - Intronic
1182718217 22:32376875-32376897 AGAGATGCAGAGAGGGAGGGCGG - Intronic
1182769141 22:32781096-32781118 AGGGATGCAGAGAAGGAAGAAGG - Intronic
1183085436 22:35483885-35483907 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1183508032 22:38220208-38220230 AGGTGTGGAGGGGGAGAGGAGGG + Exonic
1184025439 22:41852180-41852202 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1184033542 22:41908286-41908308 AGCTGTGCAGAGCTGGAGGAGGG - Intergenic
1184073141 22:42159024-42159046 AGGTATGCATACGGGGGGAAGGG + Intergenic
1184271622 22:43387707-43387729 AGGTGAGCAGAGGCAGAGGAAGG + Intergenic
1184409380 22:44317781-44317803 TGCTATGCTGCGGGGGAGGACGG - Intergenic
1184700911 22:46171937-46171959 AGGTTTGCAGAGGGGCCTGAAGG + Intronic
1184719700 22:46303956-46303978 ATGTCTGCAGAGGGGTAGGCTGG - Intronic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185372519 22:50467638-50467660 AGGGAGGAAGAGGGGGATGAGGG - Exonic
949219015 3:1607191-1607213 AGGTAGGAAAAGGAGGAGGAGGG + Intergenic
949508016 3:4744873-4744895 AGGGAGACAGAGAGGGAGGAAGG - Intronic
949914190 3:8944645-8944667 AGGAAAGCAGAGAGGGAGGGAGG + Intronic
950126662 3:10513926-10513948 AGGGATGCAGAGACGGAAGAGGG + Intronic
950969619 3:17173295-17173317 AGATATGCAGAGGCACAGGATGG + Intronic
951354461 3:21647353-21647375 AGGAAGGGAGAGGGGGAGGGAGG - Intronic
951355298 3:21659840-21659862 ATGTAGGCAGAGGGAGGGGAAGG - Intronic
951703875 3:25524613-25524635 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
951811472 3:26705421-26705443 AGATTTGCAGAGGGGGAGTTAGG + Intronic
951959481 3:28300717-28300739 AGGCAGGGAGAGAGGGAGGAAGG - Intronic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952345124 3:32476638-32476660 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
952481315 3:33764513-33764535 TGGGAAGCTGAGGGGGAGGATGG + Intergenic
952552851 3:34498512-34498534 AGGAATGCTGAGGTGGAGCAGGG + Intergenic
952590149 3:34942640-34942662 AGGGAGGCAGAGAGAGAGGAAGG - Intergenic
952821181 3:37487303-37487325 AGGGATTCTGAGGGGGAGGAAGG + Intronic
952849270 3:37714285-37714307 AGGAACCCAGAGGAGGAGGAAGG - Intronic
952930829 3:38360007-38360029 AGGTTTGGAGAGGTAGAGGAGGG - Intronic
952952285 3:38534425-38534447 AGCTATGCAGAGGCTGAGAATGG - Intronic
953170193 3:40500164-40500186 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
953241302 3:41151710-41151732 AGGTAGGCAGAGTGGGAGCTTGG - Intergenic
954196818 3:49001969-49001991 AGTTATGCAGAGAGAGAGGCAGG - Intronic
954743739 3:52774886-52774908 ATGTTTGCACAGGGGGAGGGTGG - Intergenic
955730902 3:61985299-61985321 TGGCATGCAAAGGGAGAGGAGGG - Intronic
955888489 3:63625648-63625670 AGGGGTGCAGAGGGAGAGGGTGG - Intergenic
956012924 3:64850730-64850752 AGAGTTGCAGAGAGGGAGGATGG + Intergenic
956103396 3:65791597-65791619 AGGCAGGAAGAGGTGGAGGATGG + Intronic
956321160 3:67998400-67998422 ATGCATGCAGTGGGGGAGGGTGG - Intergenic
956975148 3:74570206-74570228 ATGTATATGGAGGGGGAGGAGGG + Intergenic
957218784 3:77355220-77355242 GGGTATGCAGATGGGAAGAAGGG - Intronic
957416921 3:79917401-79917423 AGGGAAGCAGGGAGGGAGGAAGG + Intergenic
958019420 3:87979066-87979088 AGGGAGGGAGGGGGGGAGGAAGG + Intergenic
958117109 3:89234763-89234785 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
958117152 3:89234932-89234954 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
958648112 3:96899257-96899279 AGATATACATAGGGGGAAGATGG - Intronic
959314737 3:104788858-104788880 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
959324504 3:104919861-104919883 TGGTATGCTGAGGTGGAGGTGGG + Intergenic
959351969 3:105276979-105277001 AAGCATGCAGAGAGAGAGGAGGG + Intergenic
960051841 3:113246803-113246825 AGGTATCCAGAGAGGGAGAAAGG - Intronic
961101127 3:124200099-124200121 AGGTATGCAGTGTGAGAAGATGG + Intronic
961174046 3:124819718-124819740 AGGTATGCTGGGAGGGAGGGAGG - Exonic
961336456 3:126182767-126182789 AGGTATGGAGCAGGAGAGGAGGG + Intronic
961396798 3:126599238-126599260 AGGCAGGGAGAGGGGAAGGAAGG - Intronic
961554099 3:127685782-127685804 AGGGATGGAAAGAGGGAGGAAGG - Intergenic
961994426 3:131226638-131226660 AGGCATGCAGAGTGGGATAATGG + Intronic
962351798 3:134661744-134661766 AGGAAGGAAGAGGGGAAGGAAGG + Intronic
962619917 3:137167997-137168019 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962619926 3:137168021-137168043 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962619935 3:137168045-137168067 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
962685598 3:137844959-137844981 AGGGAGGGAGAGGGAGAGGATGG - Intergenic
962821741 3:139055018-139055040 AGGTGTGCAGAGGGGGAAGACGG + Intronic
963060706 3:141222492-141222514 AGGTATGATGGGAGGGAGGAAGG + Intergenic
963309026 3:143687993-143688015 AGGAAGGGAGAGAGGGAGGAGGG - Intronic
963327340 3:143877116-143877138 AGGTGTGGGGAGGGGGAGGAGGG - Intergenic
963602535 3:147390744-147390766 AGGCATGAAGAGGGCGAGGGCGG - Intronic
963631206 3:147732394-147732416 AGAGATGCAGGTGGGGAGGAAGG - Intergenic
963922144 3:150916160-150916182 AGGCAGGGAGAAGGGGAGGAAGG - Intronic
964215684 3:154278910-154278932 AGTTATGCAGGGTGGCAGGATGG - Intronic
964557736 3:157958763-157958785 TGGTATGCAGGGGGCGAAGAGGG + Intergenic
964704247 3:159601518-159601540 AGGTATGCAGAGGGGGAGGAGGG + Intronic
965039051 3:163482723-163482745 AGGGAGGAAGAGAGGGAGGAAGG - Intergenic
965054066 3:163691967-163691989 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
965737401 3:171836037-171836059 AGGGATGGAGAGGGGGAGATTGG + Intergenic
966258916 3:177951607-177951629 AAGTATGTAAAGGGCGAGGATGG - Intergenic
966439233 3:179925293-179925315 AGCTAGGCAGATGGGGAGTAGGG - Intronic
967032818 3:185624163-185624185 AAGCATGCAGGGAGGGAGGAAGG - Intronic
967054279 3:185815087-185815109 ATGTATGCAGTGTGGGAGGAGGG - Intronic
967232678 3:187355191-187355213 AGGAAGGCAGAAAGGGAGGAAGG - Intergenic
967277373 3:187789902-187789924 AGGAAGGAAGAGGGGAAGGAGGG + Intergenic
967972996 3:195012868-195012890 AGGTGGGCAGTGGGAGAGGATGG + Intergenic
968433338 4:572314-572336 GTGTATGCAGAGGGATAGGACGG + Intergenic
968441709 4:627716-627738 AGGAAGGGAGACGGGGAGGATGG - Intronic
968896591 4:3407581-3407603 AGGTACGCAGATGGGGACAAGGG - Intronic
968947352 4:3672243-3672265 AGGGAGGCAGAGGGGGAGGGAGG - Intergenic
968960517 4:3740921-3740943 AGGGATGAAGCAGGGGAGGAGGG + Intergenic
968991657 4:3917373-3917395 AGGGAGGGAGGGGGGGAGGAAGG + Intergenic
969281663 4:6174859-6174881 GGGTGGGCAGAGGGTGAGGAAGG - Intronic
969337492 4:6520222-6520244 AGATGTGCAGAGGAGGAGGGAGG + Intronic
969370330 4:6727664-6727686 AGGACAGGAGAGGGGGAGGAGGG - Intergenic
969481408 4:7448863-7448885 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481466 4:7449024-7449046 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969481535 4:7449202-7449224 AGGGAGGAAGAGAGGGAGGAAGG - Intronic
969717914 4:8877359-8877381 AGGAAGGAAGAGGGGGTGGAAGG + Intergenic
970690343 4:18612660-18612682 AGAAAGGCAGAGAGGGAGGAAGG + Intergenic
971351965 4:25863060-25863082 AGGGAGGCAGAGGGGAGGGAGGG - Intronic
971361198 4:25940112-25940134 AGGGATGGAGAGGTGCAGGAAGG + Intergenic
972004527 4:34083160-34083182 AGGAATGAAGGGAGGGAGGAAGG - Intergenic
972103136 4:35447461-35447483 AGGAAGGAAGAGGAGGAGGAAGG + Intergenic
972103212 4:35447764-35447786 AGGAAGGAAGAGGAGGAGGAAGG + Intergenic
972103225 4:35447811-35447833 AGGAAGGAAGAGGAGGAGGAAGG + Intergenic
972637186 4:40894888-40894910 AGGGATGCAGAGAGAGATGAGGG - Intronic
973739687 4:53907798-53907820 AGGGATGAAGAGGTAGAGGAGGG - Intronic
973900472 4:55464943-55464965 AGATATGTAGAGAGGGGGGAAGG - Intronic
974351694 4:60755836-60755858 ACATAAGCAGTGGGGGAGGAAGG + Intergenic
975156087 4:71074647-71074669 AGGAAGGAAGAAGGGGAGGAAGG + Intergenic
975687233 4:76929180-76929202 AGGAAGGGAGAGGAGGAGGAAGG + Intergenic
975936077 4:79582512-79582534 TGGTGTGAAGAGGAGGAGGATGG + Intergenic
976120571 4:81776244-81776266 GGGTAGGGAGAGGGTGAGGATGG + Intronic
976321787 4:83725177-83725199 AGGGAAGCAGAGAGGGAGAAAGG - Intergenic
976336322 4:83892161-83892183 AGGAATAAAGAGAGGGAGGAAGG - Intergenic
976830922 4:89312951-89312973 AGGGAGGCAGAGAGGAAGGAAGG - Intergenic
976873161 4:89821273-89821295 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
977085436 4:92591060-92591082 ACCTATGCAGCGGGGTAGGAGGG - Intronic
977271823 4:94926112-94926134 AGGGAGGCAGGGAGGGAGGAAGG - Intronic
977307299 4:95341561-95341583 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
977370401 4:96127136-96127158 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
979101094 4:116615462-116615484 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
980081622 4:128350598-128350620 GGGGATGCAGGGTGGGAGGAAGG - Intergenic
980096236 4:128494004-128494026 AAGAAGGAAGAGGGGGAGGAGGG - Intergenic
981092165 4:140743014-140743036 AGGGATGGAGGGAGGGAGGAAGG + Intronic
981783856 4:148455875-148455897 AGGGATGGAGGGAGGGAGGAAGG - Intergenic
982581757 4:157187938-157187960 AGGTAGGCAGTGGGGGAGGGTGG - Intergenic
982882005 4:160731679-160731701 AGGGATGGAGGGAGGGAGGAAGG - Intergenic
983561277 4:169104135-169104157 AGGAATGCACTGGGGGAGGGAGG + Intronic
983683837 4:170384515-170384537 AGGGAAGCAGAGAGGGAGGGAGG - Intergenic
983917828 4:173311510-173311532 TGGAATGCAAAGGGGGAGCAAGG + Intronic
983928904 4:173432290-173432312 AGGGAGGGAGGGGGGGAGGAAGG - Intergenic
984154069 4:176172802-176172824 AGGGATGAAGAGAGAGAGGAAGG + Intronic
984270999 4:177548590-177548612 GGGTATGCTGATGGGAAGGAGGG + Intergenic
985249404 4:188008210-188008232 AGGAATGCAGAGGTAGAGGAGGG - Intergenic
985756632 5:1723376-1723398 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
985851589 5:2392474-2392496 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
986105776 5:4658120-4658142 TGGGAGGCAGAAGGGGAGGATGG - Intergenic
986192032 5:5506278-5506300 GAGTATGCTGAGGAGGAGGAGGG - Intergenic
987388182 5:17350252-17350274 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
987723839 5:21671749-21671771 AGGAATGGAGGGAGGGAGGAAGG - Intergenic
987960178 5:24796956-24796978 AGGAAGGCAGGGGGGAAGGAGGG - Intergenic
988112903 5:26846633-26846655 AAGTAGGCTGAGGAGGAGGAGGG + Intergenic
988463598 5:31465759-31465781 AGGGAGGAAGAGAGGGAGGAGGG - Intronic
989007058 5:36826805-36826827 AGGAATGGAGGGAGGGAGGAAGG + Intergenic
990306128 5:54495561-54495583 AGGTATGAAGAGGAGGAGGTCGG - Intergenic
990524126 5:56608068-56608090 AGGGATGCAGACAGAGAGGATGG + Intergenic
991646783 5:68808276-68808298 AGGGAGGAAGAGAGGGAGGAAGG + Intergenic
991653622 5:68881718-68881740 AGGCATGGAGAGAGGGAGGGAGG - Intergenic
991952007 5:71955357-71955379 AGAAACGCAGAGGGAGAGGAGGG - Intergenic
992185319 5:74238899-74238921 GGGTGTGCAGAGGGGGAAAAGGG + Intergenic
992605048 5:78447811-78447833 GGGGAGGGAGAGGGGGAGGAGGG - Intronic
993058192 5:83007223-83007245 AGATGTGCAGATGGGGAAGACGG - Intergenic
993439350 5:87936759-87936781 AGGAAGGGAGAGGGGGAGGAGGG - Intergenic
994198866 5:96949945-96949967 AGGAAAGGTGAGGGGGAGGATGG - Intronic
994682166 5:102901841-102901863 AGGGAAGGAGAGAGGGAGGAAGG + Intronic
995055202 5:107751809-107751831 GGTGATGCAGAGGAGGAGGAAGG + Intergenic
995826437 5:116304985-116305007 GGGCATGCAGAGGGGCAAGAGGG - Intronic
996043484 5:118843340-118843362 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
996583534 5:125058537-125058559 AGGACTGGAAAGGGGGAGGAGGG + Intergenic
997855655 5:137370168-137370190 AGGTAGGCAGCGGGTGAGAAGGG - Intronic
998204816 5:140150953-140150975 TGGTATGCAGCGGGGATGGAGGG - Intergenic
999661305 5:153866127-153866149 AGGTATAGAGAGGAGCAGGAAGG - Intergenic
999812809 5:155144005-155144027 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
1000102459 5:158029652-158029674 AGGTAGGGAGAGGGGAAGGGAGG - Intergenic
1001003810 5:168031798-168031820 AGGGAGGGAGAGAGGGAGGAAGG + Intronic
1001205589 5:169759819-169759841 AGGGATTCAGAGTGGGAGGAGGG + Intronic
1001591803 5:172870757-172870779 AGGCAGGCAGGCGGGGAGGAAGG - Intronic
1002130933 5:177081253-177081275 AGGAAAGAAGAGGGGGAGGGAGG + Intergenic
1002193502 5:177490644-177490666 AGGGAGGCAGGGAGGGAGGAGGG + Intronic
1002489108 5:179561319-179561341 AAGTGTGCTGAGGGAGAGGAGGG + Intronic
1002527873 5:179824975-179824997 GGGGGTGCAGAGTGGGAGGAAGG + Intronic
1002589471 5:180279590-180279612 TGGTAGGCAGAGGGGGTTGAGGG - Intronic
1002663844 5:180808837-180808859 AAGTCTGCAGTGGGGGGGGAGGG - Exonic
1002902623 6:1422879-1422901 GGGAGTGCAGAGGGGGAGGGTGG + Intergenic
1003134462 6:3423597-3423619 AGGAATGCAGGGAGGGAGGGAGG + Intronic
1003226077 6:4207148-4207170 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1003255706 6:4472998-4473020 AGGAAGGCAGAGTTGGAGGATGG - Intergenic
1003278989 6:4675922-4675944 ACGGATGCGGAGGGGGAGGTGGG + Intergenic
1003429003 6:6022000-6022022 AGGCATGCACAGAGGGAAGATGG + Intergenic
1003582845 6:7358160-7358182 AGGAAGGCAGATGGGCAGGAGGG - Intronic
1003682104 6:8266534-8266556 AGGCATGGAGAGGTGGAGGTGGG + Intergenic
1003712133 6:8603824-8603846 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
1003980741 6:11387669-11387691 AGGAATGCAGTGAGGAAGGAAGG - Intergenic
1004107215 6:12677139-12677161 AGGGATGGAGGGAGGGAGGAAGG - Intergenic
1004131223 6:12921709-12921731 AGGAATGAAGAAGGGAAGGAAGG + Intronic
1004239596 6:13907996-13908018 AGGTAGGAAGGGAGGGAGGAAGG - Intergenic
1004248987 6:14007027-14007049 AGGGATGCGGAGGGGTGGGACGG - Intergenic
1004419937 6:15460198-15460220 AGGTCTGAGGAGGGGAAGGATGG + Intronic
1004842883 6:19606853-19606875 AGGAAAGGAAAGGGGGAGGAAGG + Intergenic
1005571627 6:27151066-27151088 AGGTATGAAGATGAGGGGGAAGG - Intergenic
1005875186 6:30006138-30006160 AGGTAAGCAGCGGGGAAGCAGGG + Intergenic
1006098988 6:31674014-31674036 AGCTAAGCAGAGGGTGGGGAGGG - Intergenic
1006116167 6:31777188-31777210 GGCTCAGCAGAGGGGGAGGAAGG + Exonic
1006190493 6:32204658-32204680 AGGTATTTAGCAGGGGAGGAAGG - Intronic
1006967605 6:38004455-38004477 AGGGATGGAGAGGGGGAGAGGGG - Intronic
1007823429 6:44579318-44579340 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1007869004 6:45010816-45010838 ATATATTCAGAGGGTGAGGAGGG + Intronic
1008057036 6:46955837-46955859 AAGGCAGCAGAGGGGGAGGAGGG + Intergenic
1008489231 6:52068058-52068080 AGATATGGAAAGGAGGAGGAAGG + Intronic
1009569277 6:65361213-65361235 AGGTGGGGAGTGGGGGAGGAAGG + Intronic
1009784576 6:68318242-68318264 AAGTGTGCAGTGTGGGAGGAAGG - Intergenic
1010091474 6:71987716-71987738 AGATATGTAGACTGGGAGGAAGG + Intronic
1010330356 6:74616456-74616478 AAGGATGGAGAGTGGGAGGATGG - Intergenic
1010376461 6:75176262-75176284 CGTGATGCAGTGGGGGAGGAAGG + Intronic
1010386365 6:75284853-75284875 AGGGAGGGAGAGAGGGAGGAGGG + Exonic
1010800480 6:80168721-80168743 AGGAAGGAAGAGGGGGAGGGAGG + Intronic
1011379176 6:86724237-86724259 TGGAATGCAGAGTGGGAAGAAGG - Intergenic
1011406695 6:87022854-87022876 AGGAAGGCAGAGAGGGAGGGAGG + Intergenic
1011445250 6:87432461-87432483 AGGAATGGAGAGGGGGAGGCAGG - Intronic
1011497981 6:87955175-87955197 AGGCATGGTGAGAGGGAGGAAGG - Intergenic
1011563480 6:88647742-88647764 AGGAAGGGAGAGAGGGAGGAGGG + Intronic
1011855718 6:91688384-91688406 AGGTATGAAGAGAGGGAAGGAGG - Intergenic
1011855724 6:91688411-91688433 AGGAAGGCAGAGAGGAAGGAAGG - Intergenic
1012830564 6:104199492-104199514 AGGCATACAGAGGGGTATGATGG + Intergenic
1013987555 6:116213826-116213848 AGGTAAGTAGAAGGGGTGGAAGG + Intronic
1014073051 6:117205085-117205107 TGGTATGCAGTGGGGGAGGTGGG - Intergenic
1014434448 6:121405838-121405860 AGGTATGCGGTGGGGGATGCGGG - Intergenic
1014804833 6:125817970-125817992 AGGAAGGGAGACGGGGAGGAAGG - Intronic
1015026632 6:128541305-128541327 AGGCAGGGAGAGAGGGAGGAAGG - Intergenic
1015825873 6:137311210-137311232 TGGGATGCTGAGAGGGAGGATGG + Intergenic
1016244377 6:141965382-141965404 AGGTATGCAGGTGTGGAGCAGGG - Intergenic
1017352470 6:153458821-153458843 AGCTATGCAAAGGGGGAGAGAGG + Intergenic
1017790287 6:157792119-157792141 AGGAAGGCAGGGAGGGAGGAAGG - Intronic
1017995895 6:159531426-159531448 AGGGATGCAGCGTGGGATGAGGG + Intergenic
1018066819 6:160130514-160130536 TGGGATGCAGAGGGTTAGGAAGG + Intronic
1018078744 6:160240195-160240217 AGGTAGGGAGAGGGGCAGGTAGG + Intronic
1018352537 6:162975825-162975847 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1018671162 6:166178458-166178480 AGGAAGGCAGAGTAGGAGGAGGG + Intergenic
1019030010 6:169001801-169001823 GGGCATGCAGAGGAGGAGGGGGG + Intergenic
1019266366 7:119522-119544 AGGTCTGCAGAGGCCGAGGCTGG - Intergenic
1019320789 7:414403-414425 AAGGAGGAAGAGGGGGAGGAGGG - Intergenic
1019419303 7:943249-943271 AGGAAGGGAGAGGAGGAGGAAGG + Intronic
1019551779 7:1606779-1606801 GGGGAAGAAGAGGGGGAGGAGGG - Intergenic
1019901971 7:4028019-4028041 AGGTAAGAAGGGGAGGAGGAAGG + Intronic
1020057732 7:5129823-5129845 AGCTGTGCACAGGGGCAGGAAGG - Intergenic
1020169790 7:5836180-5836202 AGCTGTGCACAGGGGCAGGAAGG + Intergenic
1020255668 7:6501968-6501990 AGGTATGCTGGGTGGGTGGATGG - Exonic
1020522356 7:9207559-9207581 ATGTGTGCAGAAGGAGAGGATGG - Intergenic
1021894222 7:25219128-25219150 AGGTAGGAAGAGGGAGAAGAAGG - Intergenic
1022162634 7:27726948-27726970 AGGGAGGCAGGGAGGGAGGAGGG + Intergenic
1022180295 7:27912551-27912573 GGTGATGCAGAGAGGGAGGAAGG + Intronic
1022337304 7:29433856-29433878 AGGAAGGGAGAGGGGGAGGAAGG + Intronic
1022690710 7:32649716-32649738 AGGAAGGCAGAGAGGGAGGGAGG + Intergenic
1022727767 7:32996453-32996475 AGCTATGCAGTGGGGCAGCATGG - Intronic
1022993288 7:35729212-35729234 TGCTCTGCAGAGTGGGAGGAGGG + Intergenic
1023128396 7:36977704-36977726 AGGTGTTTAGAGGGGAAGGAGGG + Intronic
1023347431 7:39285845-39285867 AGATATGAGGATGGGGAGGAAGG - Intronic
1023654493 7:42406391-42406413 AGAAATGCAGAGGGAAAGGAAGG - Intergenic
1023834974 7:44062623-44062645 ACGTATGGAGTGGGGGAGGGTGG + Intronic
1023850333 7:44146442-44146464 AGGTGTGCGGAGGAGGAGGGTGG - Exonic
1023892994 7:44406918-44406940 AGGTATGCAGAGCAGGAGCAAGG + Intronic
1023931460 7:44708874-44708896 AGGTCAGAAGAGGGAGAGGAGGG + Exonic
1024298398 7:47864648-47864670 AGGGAAGGAGAGAGGGAGGAAGG - Intronic
1024373900 7:48617283-48617305 AGGGATGGAGAGGAGGAGGAAGG - Intronic
1024471959 7:49774538-49774560 AGGTGTGCAGTGCGGGAGGCTGG - Intronic
1024988023 7:55212851-55212873 GGGGATGCACAGGGCGAGGAGGG + Intronic
1025045818 7:55691188-55691210 AGCTATGCAGTGGGGCAGCATGG + Intergenic
1025855053 7:65269326-65269348 AGGCACGCAGTTGGGGAGGAGGG + Intergenic
1025871065 7:65434660-65434682 AGGTATGCAGAGTGCTATGAAGG - Intergenic
1025981774 7:66413017-66413039 TGGGAGGCCGAGGGGGAGGATGG - Intronic
1025992854 7:66508708-66508730 AGGGAGGCAGAGAGGGAGGGAGG - Intergenic
1026104442 7:67409992-67410014 AGGAAGGCAGAGAGGGAGGGAGG - Intergenic
1026178235 7:68016417-68016439 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1026589150 7:71680713-71680735 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1026833011 7:73621760-73621782 AGGAAGGGAGAGAGGGAGGAAGG - Intronic
1027159227 7:75790246-75790268 AGGTATGGAGGGAGGGAGGGAGG - Intergenic
1027688962 7:81317673-81317695 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1028128204 7:87139470-87139492 TGGTATGCAGTGAGGAAGGAAGG - Intergenic
1028284436 7:88978779-88978801 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1028567322 7:92246752-92246774 ATGCATCCAGATGGGGAGGATGG - Intronic
1029348629 7:99997221-99997243 AGGGAAGGAGAGAGGGAGGAAGG - Intergenic
1029457660 7:100679221-100679243 AGGGCTGCTGAGGGGGTGGATGG + Intergenic
1029584809 7:101463614-101463636 AGGAAGGAAGAGGGGGAGGGAGG - Intronic
1029607841 7:101609728-101609750 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
1029607854 7:101609760-101609782 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
1029607867 7:101609792-101609814 AGGGAGGCAGGGAGGGAGGAAGG - Intergenic
1029690519 7:102178286-102178308 AGCTAACCACAGGGGGAGGAAGG + Intronic
1029694628 7:102204629-102204651 GGCTATGCAGAGAGGGAGGAGGG + Intronic
1030309825 7:108058030-108058052 AGCTGTGCAAAGGCGGAGGAAGG + Intronic
1030316436 7:108119604-108119626 AGGAAGGCAGAGGGGGAGGGAGG + Intronic
1030345470 7:108428562-108428584 AGGAAGGCAGAGGAGGAGAAAGG + Intronic
1030365517 7:108641532-108641554 AGGAAGGAAGAGGGGGAGGGAGG - Intergenic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1032057554 7:128695979-128696001 AGGAAGGCAGGGAGGGAGGAAGG - Intergenic
1032432524 7:131873435-131873457 AGGCAAGCAGAGAGGAAGGAAGG - Intergenic
1032489441 7:132313107-132313129 AGGTAGGCAGAGAGGGAGGTTGG - Intronic
1032520939 7:132544534-132544556 AAGTGTGCAGAGGGTGAGGGGGG + Intronic
1032990619 7:137390856-137390878 ACCAATGCATAGGGGGAGGATGG + Exonic
1034160807 7:148993220-148993242 AGGGATGCAGAGGGGAATGGCGG - Intergenic
1034271785 7:149806649-149806671 AGGGAGGCAGAGGGGCAGAAGGG - Intergenic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1035391165 7:158506020-158506042 AGGGCTGCAGAGGGTGAGGAGGG + Intronic
1035412418 7:158655727-158655749 AGCCAGGCAGATGGGGAGGACGG - Intronic
1035658793 8:1331412-1331434 AGGTTTGCAAAGGGGAGGGACGG - Intergenic
1035732062 8:1860325-1860347 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035732084 8:1860392-1860414 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035732102 8:1860456-1860478 GGGCATGGAGAGGAGGAGGAGGG - Intronic
1035754596 8:2022122-2022144 AGGTGGGCTGAGAGGGAGGAAGG + Intergenic
1036264028 8:7260739-7260761 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036265324 8:7268361-7268383 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036266625 8:7275983-7276005 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036267931 8:7283605-7283627 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036269235 8:7291227-7291249 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036298662 8:7555853-7555875 AGGAATGCAGTAGGGGAGCAGGG - Intergenic
1036299967 8:7563503-7563525 AGGAATGCAGTAGGGGAGCAGGG - Intergenic
1036301272 8:7571148-7571170 AGGAATGCAGTAGGGGAGCAGGG - Intergenic
1036302571 8:7578797-7578819 AGGAATGCAGTAGGGGAGCAGGG - Intergenic
1036316068 8:7719278-7719300 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036317376 8:7726926-7726948 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036318684 8:7734574-7734596 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036319991 8:7742221-7742243 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036321300 8:7749869-7749891 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036322609 8:7757517-7757539 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036323915 8:7765165-7765187 AGGAATGCAGTAGGGGAGCAGGG + Intergenic
1036352126 8:8019141-8019163 AGGAATGCAGTAGGGGAGCAGGG - Intergenic
1036353424 8:8026789-8026811 AGGAATGCAGTAGGGGAGCAGGG - Intergenic
1037121071 8:15287650-15287672 AGATGTGGAGAGGGGGATGAGGG + Intergenic
1037691722 8:21186440-21186462 ATGTAAGCAGAGGGAGATGAGGG - Intergenic
1037743493 8:21625644-21625666 TGGTGTGAAGAGGGGGAGGACGG + Intergenic
1037957307 8:23069551-23069573 AGGTAGGGGGAGGGGGAGGGAGG - Intergenic
1038150915 8:24942027-24942049 AGGAAGGAAGAGGGGGAGGGCGG - Intergenic
1038156723 8:24998516-24998538 AGGTAGGCCGAGAGGCAGGAAGG - Intergenic
1038193954 8:25349114-25349136 AGGGAAGCAGAGAGGGAGGGTGG + Intronic
1038544325 8:28413506-28413528 AGGGATGGAGGGAGGGAGGAAGG - Intronic
1039166554 8:34687757-34687779 AGAAATGCAGAGGGAGAGGCGGG - Intergenic
1039698695 8:39940729-39940751 TGGGATGAATAGGGGGAGGAGGG - Intronic
1039880475 8:41622297-41622319 AGGGCTGCAGAGGGGCAGGGTGG + Exonic
1039986575 8:42452708-42452730 AGAGATGAAGAGGAGGAGGAGGG + Intronic
1040032025 8:42833370-42833392 AGGTATGGAGAGGGTGATCAAGG + Intergenic
1040349456 8:46549675-46549697 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1040951735 8:52944038-52944060 AGCTATGTGGAGGGGGAGAAGGG + Intergenic
1041148876 8:54911171-54911193 AGGTATGGTGTGGAGGAGGAAGG - Intergenic
1041420364 8:57661118-57661140 AGGAAGACAGAGGGGGAGGAGGG + Intergenic
1041444160 8:57931832-57931854 AGGAAGGCAGAGAGGGAGGGAGG + Intergenic
1041482648 8:58340458-58340480 AGGGATGGAGGGAGGGAGGAAGG - Intergenic
1042036667 8:64540946-64540968 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
1042101991 8:65283885-65283907 AGGAAGGGAGAGGGGAAGGAGGG + Intergenic
1042356740 8:67836590-67836612 AGGAAGGCAAAAGGGGAGGAAGG - Intergenic
1043058110 8:75466493-75466515 AGGGAGGGAGAGAGGGAGGAAGG - Intronic
1043493879 8:80779083-80779105 AGGAAGGAAGAGGGGGAGGGAGG - Intronic
1044231964 8:89788817-89788839 AGGGAGGCAGGGAGGGAGGAAGG + Intronic
1044307671 8:90656795-90656817 AGGACTGCACAGGGGGTGGAAGG + Intronic
1045437446 8:102178487-102178509 AGGTAAGGAGAGGAGGAGGCAGG - Intergenic
1046027613 8:108744483-108744505 AGGTATGAAGAAGGGCAGGTAGG + Intronic
1046111355 8:109729788-109729810 AAGGAGGAAGAGGGGGAGGAGGG + Intergenic
1046774760 8:118152439-118152461 AGGTAGGGAGGGAGGGAGGAAGG - Intergenic
1047207935 8:122818484-122818506 AACTAGGCAGAGAGGGAGGAGGG - Intronic
1047581645 8:126223056-126223078 TGGTTTGCAGAGGGAGAGGAAGG + Intergenic
1048219048 8:132524788-132524810 AGGGATGAAGAGGAGGCGGAGGG - Intergenic
1048366370 8:133742350-133742372 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1048382957 8:133884316-133884338 AGGAAGGAAGGGGGGGAGGAAGG + Intergenic
1049004287 8:139845009-139845031 AGGGCTGGAGAGGGGGCGGATGG - Intronic
1049122041 8:140747695-140747717 AGGGAGGAGGAGGGGGAGGAAGG + Intronic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049122069 8:140747772-140747794 AAGGAGGAAGAGGGGGAGGAAGG + Intronic
1049154108 8:141056493-141056515 AGGTAGGCAGGGAGGGACGAGGG + Intergenic
1049182564 8:141230546-141230568 GGGTAAGCAGCGGGGGAGGTAGG + Intronic
1049227805 8:141466027-141466049 TGGTCTGTAGAGGGGCAGGAAGG + Intergenic
1049660313 8:143816889-143816911 AGGTAGGCAGAGGGGCAGGGTGG - Exonic
1049997627 9:1046962-1046984 AGGGAGGCAGAGGGGGAAGGGGG + Intergenic
1050172454 9:2836132-2836154 AGGTAGGGAGAGAGGAAGGAGGG - Intronic
1050725187 9:8641325-8641347 AGGTATAAAGATGGGGAGAAAGG + Intronic
1050882687 9:10722570-10722592 AGGAATTTAGAGGAGGAGGAAGG + Intergenic
1051796130 9:20872537-20872559 AGGCATGCAGAAGAGGAGGAGGG - Intronic
1051865858 9:21681563-21681585 AGGAAGGAAGAGGGAGAGGAAGG + Intergenic
1052193080 9:25680062-25680084 AGGGATGAAGAGAGGGAGAAAGG + Intergenic
1052231038 9:26153325-26153347 AGGTATGAAGAAAGGAAGGAAGG + Intergenic
1052231047 9:26153365-26153387 AGGAAAGAAGAGAGGGAGGAAGG + Intergenic
1052352662 9:27473317-27473339 AGGGAGGCAAAGGGGGAGGGTGG + Intronic
1052526153 9:29622107-29622129 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1052584157 9:30403168-30403190 AGGAAGGAAGAGAGGGAGGAAGG - Intergenic
1052903767 9:33817125-33817147 AGGGAGGGAGAGAGGGAGGAGGG - Intergenic
1052930061 9:34048795-34048817 AGGGAAGGAGAGGGAGAGGATGG + Intronic
1053540619 9:38970082-38970104 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1053623046 9:39840463-39840485 AGGTATACAGAGGGGCATAATGG - Intergenic
1053881825 9:42602765-42602787 AGGTATACAGAGGGGCATAATGG + Intergenic
1053890848 9:42691526-42691548 AGGTATACAGAGGGGCATAATGG - Intergenic
1054220849 9:62410228-62410250 AGGTATACAGAGGGGCATAATGG + Intergenic
1054229865 9:62498944-62498966 AGGTATACAGAGGGGCATAATGG - Intergenic
1054625520 9:67393824-67393846 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1054868866 9:70030842-70030864 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1054948581 9:70823955-70823977 AGGAATGCAATGGGAGAGGAGGG + Intronic
1055334966 9:75224170-75224192 AGGCATGCAGAGGGGAAATATGG - Intergenic
1055565851 9:77568004-77568026 AGGGAGGAAGAGGAGGAGGAAGG + Intronic
1055730308 9:79273930-79273952 AGGTAAGGAGGGAGGGAGGAAGG + Intergenic
1055914530 9:81387333-81387355 AGGAATGCAGGGAGGGAGGCAGG + Intergenic
1056032449 9:82567222-82567244 AGGGATGAAGGGAGGGAGGAGGG + Intergenic
1056329438 9:85509655-85509677 AAGGATGCAGAGGTGGAGGCTGG - Intergenic
1056348677 9:85725463-85725485 TGCTACGCATAGGGGGAGGATGG + Intronic
1056768649 9:89460902-89460924 ACATATGCCGAAGGGGAGGACGG + Intronic
1057083165 9:92187906-92187928 AGGGACCCAGAGGGAGAGGAAGG - Intergenic
1057565023 9:96159966-96159988 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1057805208 9:98215031-98215053 AGGATTGGATAGGGGGAGGAGGG - Intronic
1057907959 9:98996976-98996998 ATGTCTTCAAAGGGGGAGGATGG - Exonic
1058022484 9:100103644-100103666 AGGAAAGCAGGGGGAGAGGAGGG + Intronic
1058095041 9:100850330-100850352 AGGTGTGGAGGGTGGGAGGAGGG + Intergenic
1058421244 9:104835360-104835382 AGGTCTGCAGTGGAGGAGGGTGG - Intronic
1058785928 9:108386769-108386791 AGGCATGAAGAGGGAGAGGTGGG + Intergenic
1059072416 9:111152796-111152818 AAGGAGGCAGAGGAGGAGGAAGG + Intergenic
1059099728 9:111458626-111458648 AGGGTTGGAGAGGGAGAGGAGGG + Intronic
1059700983 9:116775464-116775486 AGGGAGGCAGATGGGGAAGAAGG + Intronic
1060551305 9:124486647-124486669 AGGTCTCCAGATGAGGAGGAAGG - Intronic
1060720936 9:125976874-125976896 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061180622 9:129023172-129023194 GGGAATGCAGGGAGGGAGGATGG + Intronic
1061260576 9:129478683-129478705 AGGGAGGGAGTGGGGGAGGAAGG + Intergenic
1061275781 9:129568857-129568879 AGGGAGGAGGAGGGGGAGGAGGG + Intergenic
1061847210 9:133394486-133394508 AGGGATGCAGAGGGGAGGCAGGG - Intronic
1061899699 9:133666565-133666587 AGGAGGGAAGAGGGGGAGGAAGG - Intronic
1061903177 9:133683417-133683439 TGGTTTGCAGAAGGGGAGGGGGG - Intronic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062322211 9:135995848-135995870 AGGAAGCCAGAGGGAGAGGATGG + Intergenic
1062480911 9:136750953-136750975 AGGGAAGGAGAGAGGGAGGAGGG + Intergenic
1062588691 9:137263392-137263414 AGGAGGGCGGAGGGGGAGGAGGG - Intronic
1062646364 9:137550599-137550621 GGGGATGCAGCTGGGGAGGAGGG + Intergenic
1203585776 Un_KI270747v1:2136-2158 ACAGATGCAGAGAGGGAGGATGG + Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185574932 X:1163750-1163772 AGGAAGGAAGAGAGGGAGGAAGG + Intergenic
1185777559 X:2817092-2817114 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1186020100 X:5245333-5245355 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1186071055 X:5821192-5821214 AGCTAGGCAGAGGAGTAGGATGG - Intergenic
1186838443 X:13460948-13460970 AGGGAGGGAGAGAGGGAGGAAGG + Intergenic
1186920682 X:14276090-14276112 AGGTTTGCAGAGAGGAAGGATGG - Intergenic
1187127672 X:16469301-16469323 ACCCAAGCAGAGGGGGAGGAGGG + Intergenic
1187245616 X:17550696-17550718 AGGTGGGCAGAGGGGGAAGTGGG - Intronic
1187715890 X:22102208-22102230 AGGATAGCAGAGGGGAAGGAGGG - Intronic
1189000444 X:36938457-36938479 AAGAAGGCAGAGGGGTAGGATGG - Intergenic
1189176285 X:38960607-38960629 AGGGATGGAGAGAGGGATGAAGG - Intergenic
1189262036 X:39686220-39686242 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1190340795 X:49293880-49293902 AGCTACTCAGAGGCGGAGGAGGG + Intronic
1190644262 X:52510259-52510281 AAGGATGGAGAGGGGGAGGAAGG - Intergenic
1191714697 X:64186223-64186245 AGGTAGGGAGAGGGGAAAGAGGG + Exonic
1191882648 X:65857989-65858011 AGGAAGACAGAGAGGGAGGAAGG - Intergenic
1192180272 X:68911971-68911993 AGGTCTGGGGAGGAGGAGGATGG - Intergenic
1192302665 X:69921955-69921977 AGGTATGTGGAGGAGGAGGGAGG - Intronic
1192531961 X:71895665-71895687 AGGAATGGAGGGAGGGAGGAAGG + Intergenic
1194013667 X:88592351-88592373 AGGTATACATAGTGGTAGGATGG + Intergenic
1195937621 X:110140532-110140554 AGGGTTGTAGAGTGGGAGGAAGG + Intronic
1196144980 X:112306626-112306648 AGTTATGAAGAGGGGAAAGATGG + Intergenic
1196650057 X:118159313-118159335 AGGGATGGAGGGAGGGAGGAAGG + Intergenic
1196749760 X:119105302-119105324 AGGAATGAAGACGGGGAGGTAGG - Intronic
1196831297 X:119777548-119777570 ATGTAAGGAGAGGGAGAGGAAGG + Intergenic
1196887573 X:120262634-120262656 AGGGAGGGAGAGGAGGAGGAAGG - Intronic
1197462456 X:126759164-126759186 AGGGAGGGAGAGAGGGAGGAAGG - Intergenic
1197818721 X:130524611-130524633 TGGTATGCCTAGGGGAAGGAGGG - Intergenic
1197872230 X:131071265-131071287 AGGTAAGTAGAGGGGGAGAAAGG - Intronic
1197917274 X:131549737-131549759 AGGGATGCAGTGGTGAAGGAAGG + Intergenic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1199680285 X:150219760-150219782 AGGTCTGCGGAGGCAGAGGAAGG + Intergenic
1199895817 X:152127290-152127312 GGGTATGGAGAGAGGGAAGAGGG - Intergenic
1201146171 Y:11066714-11066736 AGGGAGGGAGAGGGAGAGGAAGG + Intergenic
1201146249 Y:11066972-11066994 AGGGAGGCAGAGGGAGAGGGAGG + Intergenic
1201146501 Y:11067781-11067803 AGGGAGGGAGAGGGAGAGGAAGG + Intergenic
1201146578 Y:11068005-11068027 AGGGAGGGAGAGGGAGAGGAAGG + Intergenic
1201146583 Y:11068021-11068043 AGGAAGGGAGAGGGAGAGGAAGG + Intergenic
1201438430 Y:13984947-13984969 TGGTATGCAGGGAGGGAGGGAGG - Intergenic
1201446143 Y:14057761-14057783 TGGTATGCAGGGAGGGAGGGAGG + Intergenic
1201461533 Y:14230782-14230804 AGGGAGACAGAGAGGGAGGAAGG + Intergenic
1201524691 Y:14919392-14919414 AGGGAGGCAGGGAGGGAGGAAGG + Intergenic
1201698508 Y:16854194-16854216 AGTTATGGAGGGAGGGAGGAAGG - Intergenic
1202231784 Y:22666266-22666288 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1202304258 Y:23451580-23451602 GAGTATACAGAGGAGGAGGATGG + Intergenic
1202311374 Y:23529899-23529921 AGGAAGGGAGAGAGGGAGGAAGG + Intergenic
1202559428 Y:26140695-26140717 AGGAAGGGAGAGAGGGAGGAAGG - Intergenic
1202566552 Y:26219011-26219033 GAGTATACAGAGGAGGAGGATGG - Intergenic