ID: 964706114

View in Genome Browser
Species Human (GRCh38)
Location 3:159620464-159620486
Sequence CTGGATAAAGAAATAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 612
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 557}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964706114 Original CRISPR CTGGATAAAGAAATAGACAA TGG Intronic
900930857 1:5736461-5736483 ATGGATAGATAGATAGACAAAGG + Intergenic
900977166 1:6025171-6025193 CAGGATAAAGATAAAGACAGTGG - Intronic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
901940971 1:12661417-12661439 ATTGATCAAGAAATAAACAAGGG - Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904102934 1:28048427-28048449 CTGCAAAAATAAATATACAAAGG + Intronic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904653233 1:32022566-32022588 CTGCATAAGGAACAAGACAATGG - Intronic
904787756 1:32995477-32995499 ATGGATAATGCAATAGCCAAAGG - Intergenic
904930452 1:34082678-34082700 GTGTATAAAGAAGTAGACATAGG + Intronic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906580744 1:46933657-46933679 CTGGAAAGAGAATCAGACAAGGG - Intronic
906602981 1:47145234-47145256 CTGGAAAGAGAATCAGACAAGGG + Intronic
907085875 1:51673535-51673557 CTGGAGAAAGCAAGAGAGAATGG + Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908168946 1:61485818-61485840 ATGGATTAAAAAATAGACAATGG + Intergenic
908439370 1:64138382-64138404 CCAGATAAAGAAAAAGACAACGG - Intronic
908901529 1:68961769-68961791 TTTGATAAAGGAATAGAAAAAGG - Intergenic
908965162 1:69752385-69752407 CTGGAAAGAGAAAGAGACAAAGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909404800 1:75276133-75276155 TTGGAGAAAGAATTAGACAAAGG - Intronic
909618697 1:77643043-77643065 CTGTACAAAAAAATAGAAAAAGG + Intronic
909928057 1:81461945-81461967 GTGGAGAAAGAGAGAGACAAAGG + Intronic
910097130 1:83536146-83536168 CAAGATAAAGAATAAGACAAGGG + Intergenic
910552513 1:88492134-88492156 CTGATTAGAGAAATAGACGAAGG + Intergenic
910978708 1:92936747-92936769 CTCAATAAAGCAATAGATAAAGG - Intronic
911250440 1:95570518-95570540 CTGGAAAAGGAGCTAGACAATGG + Intergenic
911870610 1:103093434-103093456 CTGGAAAAAAAAATCCACAAAGG + Intronic
912259128 1:108091939-108091961 CTGGATAAATGAGTAGAAAAGGG - Intergenic
913384642 1:118246107-118246129 CTGGAAAAAGAAACAGACATTGG + Intergenic
914779496 1:150772132-150772154 ATGGATTTAGAAATAAACAAAGG - Intergenic
914987255 1:152471791-152471813 GTGTAGAAAGAAATAGACATGGG - Intergenic
915019100 1:152762995-152763017 AAGGATGAAGAAAAAGACAAGGG + Intronic
915112502 1:153573409-153573431 CTGGATTAATATATAGATAATGG - Intergenic
915622322 1:157093128-157093150 CTAGAGAAAGAAAGAGAGAAAGG + Intronic
915769576 1:158406109-158406131 CTGGATAAAGAAAAATACCCAGG - Intergenic
916194640 1:162211776-162211798 CTGGTTAAGGAAACTGACAAGGG + Intronic
916477244 1:165181982-165182004 CAGGATATATAAATAGACAAAGG + Intergenic
916657465 1:166888959-166888981 CTGGATTGAGAAACGGACAATGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917786151 1:178459677-178459699 TTGGATACAGAAATAGAAGAAGG + Intronic
918172600 1:182011351-182011373 GTGTAGAAAGAAATAGACATAGG + Intergenic
918201446 1:182271023-182271045 CTGAATAAATAAATAAATAAGGG + Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919126061 1:193395304-193395326 CTGAATATGGAAACAGACAATGG + Intergenic
919361904 1:196607383-196607405 CTTGAGACAGAAATAGACAGAGG + Intronic
919530548 1:198713770-198713792 ATGGATAAAAGAATAGAGAAAGG - Intronic
919625154 1:199904233-199904255 CTGTAGAAAGAAGTAGACATGGG - Intergenic
919671153 1:200339397-200339419 CAGGATAATGAAATTGACCAGGG + Intergenic
919908174 1:202092720-202092742 ATGGAGAAAGAGGTAGACAATGG - Intergenic
920179745 1:204125226-204125248 CTGTTTAAAGGAATAGACTAGGG - Intronic
920514037 1:206571261-206571283 CCTGATGAAAAAATAGACAATGG - Intronic
920612173 1:207452397-207452419 ATGAATAAATAAATAGAGAAGGG + Intergenic
921640390 1:217545933-217545955 CTGGGTAAAGTGTTAGACAATGG + Intronic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922630093 1:227098067-227098089 CAGAATAAAGAATTAGACCAAGG - Intronic
922633437 1:227138633-227138655 CAGGATAGGGAAATAGACTAGGG + Intronic
922917264 1:229269222-229269244 CTGGAAGAAGAAATATACAAGGG - Intergenic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063041803 10:2348222-2348244 TTTGATAAAGAAAGAGAGAAAGG - Intergenic
1063549456 10:7016100-7016122 TTGGATATAGAAAGAGATAAAGG - Intergenic
1064142395 10:12801510-12801532 ATGGATAAACAAATAGAAGATGG - Intronic
1064427881 10:15245941-15245963 ATGGATAAAGAAAAACACAGAGG - Intronic
1064754284 10:18560491-18560513 ATGGAGAAAGGAATAGAAAATGG + Intronic
1064849792 10:19697824-19697846 ATGGACAAAGAAATAGGGAAAGG - Intronic
1065067013 10:21979634-21979656 CTGGATAAAGTAAGAAATAATGG + Intronic
1065112501 10:22453595-22453617 CTGGTTAAAGGAACAGTCAATGG + Intronic
1065138182 10:22693205-22693227 CTGGTTAAGGAAATTGACATTGG - Intronic
1065265583 10:23971756-23971778 CTGGATCAAGAAAAAGACCTGGG - Intronic
1065835546 10:29654911-29654933 CTGGATAGAAAAAAAGACAGGGG - Intronic
1066194448 10:33085198-33085220 GTTTATAAAGAAATAGAAAAAGG - Intergenic
1066678331 10:37912165-37912187 CTGGTTAAAAAACTGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067203926 10:44197830-44197852 CTGGGCAAAGCAAAAGACAAGGG + Intergenic
1067243746 10:44518359-44518381 CTGAATGCAGAAATAGACGATGG - Intergenic
1067365925 10:45628608-45628630 CTGGATAAAGAATTACAGATTGG - Intronic
1067548130 10:47211208-47211230 GAGGAGAAAGAAATAGACAGGGG - Intergenic
1069046774 10:63751339-63751361 CTAGATGAAGAAATAGTCCAAGG - Intergenic
1069308678 10:67005535-67005557 CTGAAGAAAGGAATAGATAAGGG + Intronic
1069718953 10:70538100-70538122 CTGGTTAAGGACAGAGACAAGGG - Intronic
1070472574 10:76797826-76797848 AAGGAAAAAGAAATAGTCAATGG - Intergenic
1070629600 10:78075686-78075708 GTGTAGAAAGAAATAGACATAGG - Intergenic
1071053959 10:81487180-81487202 CAGGAGAAAGAAAGAGAGAAGGG + Intergenic
1071136346 10:82458540-82458562 CTGGAGAATGAAGTAGAAAAAGG + Intronic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1072533460 10:96341360-96341382 CTGGAGAAAGAACCACACAAAGG - Intergenic
1072914691 10:99530717-99530739 CTGGAAAAAGAAAAGGAGAAAGG - Intergenic
1073080543 10:100857488-100857510 CTGGAGAAAGAAAAAGAAATGGG - Intergenic
1073482350 10:103794531-103794553 CTGTGCAAGGAAATAGACAAAGG + Intronic
1074642178 10:115398689-115398711 CAGGCAAAAGAAATAAACAAAGG - Intronic
1074679833 10:115894002-115894024 CAGGATGAGGAAAGAGACAAGGG + Intronic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1077765814 11:5158976-5158998 CTGGTGAAAGAAATAGAAGAGGG - Intronic
1077931849 11:6741056-6741078 AAGGATAAAGAAATGGAAAAAGG + Intergenic
1078151644 11:8764665-8764687 CTGGATAAAGAATTAGAAAAGGG + Intronic
1078265156 11:9749943-9749965 CTGGAAAGAGAAAAAGACCACGG + Exonic
1079578758 11:22035619-22035641 ATGAATAAAGGAAGAGACAAAGG - Intergenic
1079621724 11:22563909-22563931 CTGGACATAGGAATGGACAAAGG - Intergenic
1080348057 11:31347769-31347791 CTTGATAATGAGAGAGACAAAGG + Intronic
1080545937 11:33318495-33318517 ATAGATGAAGAAACAGACAAAGG - Intronic
1080591361 11:33725668-33725690 CAGGAATAAGAAATAGTCAAGGG + Intronic
1080845051 11:36019736-36019758 CTGGATACAGAAAGAAACAAAGG + Intronic
1081365225 11:42226770-42226792 ATGGATAATGAAATACATAAAGG + Intergenic
1081668817 11:44932092-44932114 ATGGATAGAGACATAGACAAGGG - Exonic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1082969872 11:59008799-59008821 CTGGATAACAAAAAAGATAAGGG + Intronic
1083467648 11:62859414-62859436 GTGTAGAAAGAAATAGACATGGG - Intronic
1086023452 11:82260834-82260856 ATGGAAAAAGAAATAGCAAATGG - Intergenic
1086291102 11:85310229-85310251 CTGAGCAAAGAATTAGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086661195 11:89420707-89420729 CTGAAGAAAGAACTAAACAAAGG + Intronic
1087034455 11:93741940-93741962 CTGAAGGCAGAAATAGACAAAGG - Exonic
1087058976 11:93960098-93960120 CTGGAGAAATAAAAAGCCAAGGG + Intergenic
1088161560 11:106877700-106877722 CTGGACACAGGAATGGACAAAGG + Intronic
1088551505 11:111018118-111018140 CTGAAAAAAGAAAAAGAAAAAGG - Intergenic
1088617031 11:111641162-111641184 CAGGAAAATGAGATAGACAATGG - Intronic
1088829738 11:113525143-113525165 ACGAATAAAGGAATAGACAATGG + Intergenic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1092865028 12:12752886-12752908 CTGGCTAAACAGATAGAGAAGGG - Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093527764 12:20122642-20122664 CTGGAAAGGGAAATAGGCAAAGG - Intergenic
1093937290 12:25014814-25014836 GTGGATTAGGAAATAGACATAGG - Intergenic
1094200510 12:27790644-27790666 CTTGAAAAAGAGATGGACAATGG - Intronic
1095622279 12:44271904-44271926 ACTGATAAAGAAATGGACAAAGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095854263 12:46843245-46843267 TTGCATATAGAAAGAGACAATGG - Intergenic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096660726 12:53122719-53122741 GTGTAGAAAGAAATAGACATGGG - Intronic
1097089309 12:56493579-56493601 CTGTAGAAAGAAGTAGACATAGG - Intergenic
1097594008 12:61605166-61605188 CTATTTAAAGAAATGGACAAAGG - Intergenic
1097655715 12:62360043-62360065 CTTGACAATGAAAAAGACAAGGG - Intronic
1098424271 12:70341512-70341534 CAGAATAAATAAATAAACAATGG - Intronic
1098426367 12:70369182-70369204 CTGGATAAAGAGATATAAATTGG - Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1099537747 12:83865742-83865764 CTGAGTAAAGAAATAGAATATGG - Intergenic
1099673282 12:85722541-85722563 CTGTATAAGAAAATAGAAAAAGG + Intergenic
1099843841 12:88004167-88004189 CTGCATAAAGAAGTAAAGAACGG - Intronic
1099971449 12:89504214-89504236 GTGGAGAAAGAAGTAGACATAGG + Intronic
1100949572 12:99831256-99831278 TTTGATAAAGAAATATATAATGG - Intronic
1102625677 12:114233664-114233686 ATGGATAAATTGATAGACAAAGG + Intergenic
1103574701 12:121868821-121868843 TTCGATTAAGAAATAGGCAAAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106008056 13:25789957-25789979 CTGGCAAAAGAAATGGAGAAAGG + Intronic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1107041620 13:35954909-35954931 ATGCTTAAAGAAATAGAAAAAGG + Intronic
1107627955 13:42309727-42309749 CTAGATAAAGTTATAGAAAAGGG - Intronic
1108380908 13:49853260-49853282 CTGGATATAAAAATAGAGGATGG - Intergenic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109434284 13:62278445-62278467 CTGTACAAAGAGATACACAATGG - Intergenic
1110009159 13:70309770-70309792 CTGGATAAAATAATCCACAAGGG + Intergenic
1110216413 13:73029502-73029524 CTGGAAGAAGAGAGAGACAAAGG - Intergenic
1110478130 13:75941824-75941846 CTGGATAAAGAAATAAACCCAGG - Intergenic
1110675226 13:78234878-78234900 ATGGAAAAAGAAATATAAAATGG - Intergenic
1110724664 13:78806489-78806511 CTGGATAAAGAAAGAAAAAGTGG + Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1111106028 13:83646736-83646758 GTTGAAGAAGAAATAGACAAAGG - Intergenic
1111329978 13:86752723-86752745 AAGGATATAGAAATAGATAAAGG + Intergenic
1111598186 13:90437208-90437230 CTGGATATAGAATTATACATAGG + Intergenic
1112078684 13:95941551-95941573 CTGAATAAAGCAAAAGATAAAGG + Intronic
1112972296 13:105274565-105274587 CTGTCTGAAGAAAGAGACAAAGG + Intergenic
1113370587 13:109721688-109721710 CTGGATTAAAAAATAGACTATGG - Intergenic
1114169308 14:20255807-20255829 CTGAATAAATAAACAGAAAAGGG + Intergenic
1114813996 14:25934489-25934511 ATGGAGAAAGAAATATAGAAAGG + Intergenic
1114874382 14:26697638-26697660 CTGGATAGAGAAATTGCCAGAGG + Intergenic
1114906382 14:27132644-27132666 CTGGAGAAAGATATTTACAAAGG - Intergenic
1115167369 14:30464102-30464124 GTGGATAGAAAAATAGAAAAGGG - Intergenic
1115486457 14:33915556-33915578 CTGGATAGTGAGATAGACCATGG + Intergenic
1115708959 14:36028986-36029008 ATGGAAAAAGAAATAAATAATGG - Intergenic
1115847074 14:37550143-37550165 TTGAATAAGGAAATATACAAAGG - Exonic
1116548238 14:46198657-46198679 GTGGTTAAAAATATAGACAATGG - Intergenic
1116723164 14:48527109-48527131 CTCCATTAAAAAATAGACAAAGG - Intergenic
1116764639 14:49054931-49054953 CTGCAGTAGGAAATAGACAAGGG - Intergenic
1118897320 14:69955922-69955944 CTGGAGAAAGAAAAAGCCGATGG - Intronic
1119105696 14:71921486-71921508 ATGAATAAAGAAATATACAATGG + Intergenic
1119841367 14:77795572-77795594 GTGTAGAAAGAAATAGACATGGG - Intergenic
1119910266 14:78343692-78343714 CTGGTTAAAGCCAGAGACAAAGG + Intronic
1120164080 14:81175532-81175554 CAGGATAAAAAAATACAAAAAGG + Exonic
1120309710 14:82814022-82814044 CTGTAGAAAGAAGTAGACATGGG - Intergenic
1121847211 14:97183407-97183429 CAGGTTAAAGAATAAGACAAAGG + Intergenic
1122012619 14:98763674-98763696 ATGGATATAAAAATTGACAAAGG + Intergenic
1125334027 15:38610052-38610074 GAGGATAAAGACACAGACAATGG - Intergenic
1126168863 15:45677236-45677258 ATGGATAGATAGATAGACAAAGG - Intronic
1126182689 15:45801324-45801346 CTGGATAAAGAAGTAGGAAGAGG - Intergenic
1126214844 15:46143254-46143276 CTGGAAAAAGAAAGAAACAAAGG + Intergenic
1126381537 15:48052795-48052817 CTGGAGAAATAAAAAAACAATGG + Intergenic
1127280713 15:57489427-57489449 AGGGGTAAAGAAATAGAAAATGG + Intronic
1127832762 15:62765315-62765337 CTGGAAAAAGAAAAAAAAAAAGG - Intronic
1129127703 15:73458700-73458722 GGGGATAAAGAAATGGACAAAGG + Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130166887 15:81470699-81470721 CTGGAAAAGGTAAAAGACAAAGG - Intergenic
1130899596 15:88197288-88197310 CTGTAGAAATAAAAAGACAAGGG - Intronic
1131066032 15:89435627-89435649 CTGGATAAAGGGACGGACAAAGG - Intergenic
1131110381 15:89761084-89761106 CTGGCTTAAGAAATAGATGAAGG + Intronic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1132037339 15:98496327-98496349 GTGGAAAAAGAAATCGAGAAAGG - Intronic
1132440643 15:101860882-101860904 GTGTAGAAAGAAATAGACATGGG - Intergenic
1133329239 16:4961327-4961349 CTGGAAAAAGTAAAAGAAAATGG - Intronic
1133543747 16:6785185-6785207 CTGGAGAAAAAAAATGACAAAGG + Intronic
1133954594 16:10430296-10430318 CTGGATAAAAAAATAGTGAATGG + Intronic
1135797044 16:25455949-25455971 AAGGAAAAAGAAATAGAAAATGG - Intergenic
1138174819 16:54887380-54887402 CGGGATATAGCATTAGACAAAGG + Intergenic
1138469872 16:57225610-57225632 CTAGAGAAAGAAATTGAAAATGG - Intronic
1138809837 16:60136572-60136594 CTAAATAAAGAACTATACAAAGG - Intergenic
1138835636 16:60431151-60431173 CTGGATCATGAAACAGATAAAGG + Intergenic
1140029189 16:71321032-71321054 ATGGAAAATAAAATAGACAAAGG - Intergenic
1141053016 16:80789691-80789713 CTGGATAAAGAAAATGTCCATGG + Intronic
1141306849 16:82872751-82872773 CTGGAGATAGAAATAGGGAATGG + Intronic
1141899321 16:86980206-86980228 TTGGATAGAGAGATAGATAATGG + Intergenic
1143284473 17:5779065-5779087 CTGGATTAAGAAACAGCAAAAGG - Intronic
1143599620 17:7935881-7935903 GGGGACAGAGAAATAGACAAAGG + Intronic
1143789838 17:9285660-9285682 CTGGTTAAATAAATACAAAAAGG + Intronic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1144596698 17:16575890-16575912 CTGGGTAAAGAACTTGACCATGG + Intergenic
1145101133 17:20078838-20078860 CTGGAGAGAGAAGTAGACTAAGG + Intronic
1145282738 17:21479589-21479611 CAGGAAAAAGACAGAGACAAAGG - Intergenic
1146562818 17:33886181-33886203 CTGGCTGAAGAGATGGACAAAGG + Intronic
1148657048 17:49292925-49292947 ATGGATAATGAAATAGTCAGAGG + Intronic
1151174552 17:72276395-72276417 CTGACTAAAGCAATCGACAAAGG - Intergenic
1151432289 17:74071638-74071660 CTGGTTAAAGAAAAAGTCTAGGG - Intergenic
1151690297 17:75679965-75679987 GTGGAGAAAAAAATAAACAAGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153286686 18:3462714-3462736 CTGGATAAGGACAGAAACAATGG - Intergenic
1155513934 18:26605074-26605096 AAGGAAAAAGAAACAGACAAAGG + Intronic
1156107127 18:33676530-33676552 CTTGATTAAGAAATAGGAAAGGG - Intronic
1156760336 18:40581587-40581609 TTGGATACGGAAGTAGACAAAGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158197542 18:54905600-54905622 CTGGATTCACAAATATACAATGG - Intronic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158728830 18:60000935-60000957 CTGGATAAATAAGGAAACAAAGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159392973 18:67818665-67818687 ATGGAGAATGAAAGAGACAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160098635 18:75900166-75900188 TTTGAAAAACAAATAGACAAAGG - Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1161905429 19:7152928-7152950 CTGGAGAAAGAAACAGAAAAGGG + Intronic
1161908188 19:7173272-7173294 TTCGCTAAAGAAATAAACAAAGG + Intronic
1162119644 19:8455559-8455581 CTGGTTAAAGAAAAAGGTAATGG + Exonic
1162595201 19:11623269-11623291 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1162887163 19:13704134-13704156 GTGTAGAAAGAAATAGACATGGG + Intergenic
1163229545 19:15991218-15991240 GTAGACATAGAAATAGACAAAGG + Intergenic
1163278150 19:16298767-16298789 CTGGAAATAGAAAGTGACAATGG + Intergenic
1163724887 19:18917168-18917190 CTGGAAAAAGAAAAAAAAAAAGG - Intronic
1163907108 19:20157238-20157260 GTGTAGAAAGAAATAGACATGGG - Intergenic
1164073505 19:21791387-21791409 CTGGAAAAACAGATAGAAAAGGG - Intergenic
1164122797 19:22283602-22283624 GTGTAGAAAGAAATAGACATGGG + Intergenic
1164689173 19:30195899-30195921 ATGGATAAAATAATAGTCAATGG + Intergenic
1164733618 19:30524391-30524413 CTGGTTAAAGAGAAAGACACAGG + Intronic
1165727522 19:38123651-38123673 GTGTAGAAAGAAATAGACATGGG - Intronic
1165889259 19:39100777-39100799 ATGGAGAAAGAAATAGACCTCGG - Exonic
1167055531 19:47109472-47109494 CTGGAGAAAGAATTTTACAAAGG + Intronic
1167275052 19:48532725-48532747 ATGGGTAAAGAAATAGAAAATGG + Intergenic
1167284683 19:48592494-48592516 CTGGATGGACAGATAGACAAAGG + Intronic
1167808630 19:51809015-51809037 CTGGAAAAACAGATAGAAAAGGG - Intronic
1167882849 19:52476477-52476499 CTGGAAAAACAGATAGAAAAGGG - Intronic
1168338048 19:55607607-55607629 CGGGATAAAGAGATAGACCTGGG + Intronic
925336901 2:3105361-3105383 CTGTAGAAAGAAGTAGACATAGG - Intergenic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926038426 2:9653503-9653525 ATGCATATGGAAATAGACAAAGG - Intergenic
926277120 2:11412717-11412739 CTGGATAAAGCAAGGGACCAAGG + Intergenic
926895457 2:17682554-17682576 CTGGGAAAAGAAATATCCAAAGG + Intronic
926997221 2:18749094-18749116 CTTCATAAAGAAATAGTGAAAGG - Intergenic
927768045 2:25831358-25831380 TTGGTTAAAGAAATAAACACAGG + Intronic
927978832 2:27359847-27359869 CTGTAGAAAGAAGTAGACATGGG + Intergenic
928145347 2:28769602-28769624 CTGCAGAAAGAAATGAACAATGG + Intronic
928695224 2:33842247-33842269 GTAGAGTAAGAAATAGACAAGGG - Intergenic
928867726 2:35937388-35937410 CTGGATAAAGTAATTAATAAAGG - Intergenic
929092313 2:38231326-38231348 CTGGAGAGAGAAAGAGAAAAAGG - Intergenic
929729731 2:44475247-44475269 CTGAATAAAGGAATATAGAATGG + Intronic
930409058 2:51000267-51000289 CAGGATAAGGACATAGAGAATGG - Intronic
930931108 2:56885251-56885273 CTAGATATAGAAGTGGACAATGG + Intergenic
930948171 2:57102007-57102029 CTGGAAAAAGAAATAACAAATGG - Intergenic
930977860 2:57486342-57486364 GTGGAAAGAGAAATAGGCAAAGG - Intergenic
931570448 2:63663574-63663596 CTGGCTATAGAAATGGAGAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933454039 2:82498960-82498982 ATTGATAAAGAAATAGATGAGGG + Intergenic
933598403 2:84305439-84305461 CTAGATAAAGAGATACACAGAGG - Intergenic
934044654 2:88162728-88162750 GTGGCTAAAGAAATAGCTAATGG - Intergenic
934616985 2:95778133-95778155 CAAGAAAAATAAATAGACAAAGG - Intergenic
934643908 2:96046426-96046448 CAAGAAAAATAAATAGACAAAGG + Intergenic
934837325 2:97602520-97602542 CAAGAAAAATAAATAGACAAAGG + Intergenic
935330148 2:101971219-101971241 GTGGATATACAAAAAGACAATGG - Intergenic
935370119 2:102336688-102336710 CTGGATGAAGAAAAAAAAAAAGG - Intronic
935468449 2:103428333-103428355 CTGGTTTAAGAAATAAGCAAAGG - Intergenic
936533923 2:113296360-113296382 CGTGAGAAAGAAATACACAAGGG - Intergenic
936783152 2:116058648-116058670 CAGGACAAAGATGTAGACAAAGG - Intergenic
937079020 2:119127039-119127061 CTGGAAAAAGAAAAAAAGAAAGG - Intergenic
937079024 2:119127080-119127102 CTGGAAAAAGAAAAAAAGAAAGG - Intergenic
937858564 2:126690521-126690543 CTGGGTAAATAAATATACATAGG + Intronic
938929486 2:136074194-136074216 CTGGAAAAACAGATAGAAAAGGG - Intergenic
939053890 2:137338828-137338850 ATGGAGAAAGACAAAGACAAAGG + Intronic
939464984 2:142545384-142545406 CTGGAAAAATAAATAAATAAAGG - Intergenic
939832679 2:147091660-147091682 CTGGATAAAGTAGAAGCCAAGGG - Intergenic
939922202 2:148129781-148129803 CTGAATAAGTGAATAGACAAAGG + Intronic
940127181 2:150339472-150339494 CTTGATGAAGAAATAGTAAATGG - Intergenic
941973986 2:171383409-171383431 TTGAATAAAGAAATAGAAACAGG + Intronic
942039542 2:172044959-172044981 GAGGATACAGAAATAAACAAAGG + Intronic
942096438 2:172538669-172538691 GTGTAGAAAGAAGTAGACAAGGG + Intergenic
942549584 2:177100979-177101001 CTGGATAAAGAAATCCCAAAAGG + Intergenic
942683451 2:178505726-178505748 TTGGGTAAAGCAATAGAAAATGG - Exonic
943285367 2:185991677-185991699 CTGGAGAAAGAGAAAGACACTGG + Intergenic
944868200 2:203882841-203882863 CTGGAAAAAAAAATAGTGAATGG + Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945795173 2:214353974-214353996 CTCAATAAAGATATACACAAAGG + Intronic
945850393 2:214999224-214999246 CTGGATCTAGAACTAGGCAAAGG + Intronic
945895557 2:215477717-215477739 TTGGATAAAGAAATGCAGAAAGG - Intergenic
946042269 2:216792480-216792502 CTGAATGAATTAATAGACAAAGG + Intergenic
1168825666 20:811893-811915 CTGAGAAAAGAAATAGACACAGG + Intergenic
1169102399 20:2962487-2962509 CTTGATAAATTAATAGAAAATGG - Intronic
1169441697 20:5639053-5639075 CTGTAGAAAGAAGTAGACATAGG - Intergenic
1169463697 20:5819160-5819182 CTGAATTAAGAAGTAGACACTGG - Intronic
1169626604 20:7578400-7578422 CCAGATAAAGAACTAGATAAAGG - Intergenic
1169997732 20:11577273-11577295 CAGGAGGAAGAAATAGACAAGGG - Intergenic
1170125945 20:12964327-12964349 CTTTATTAAGACATAGACAAAGG - Intergenic
1170151813 20:13234322-13234344 CTGGGTAAAGAAATATACCATGG - Intronic
1170622856 20:18009976-18009998 GTGTAGAAAGAAATAGACATGGG - Intronic
1171094712 20:22320731-22320753 CTGGCTAAACACATAGCCAAGGG - Intergenic
1171536162 20:25892577-25892599 CTGGAGACAGAAATAGAGGAAGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1171951998 20:31428028-31428050 GTGTAGAAAGAAATAGACATGGG + Intergenic
1171956762 20:31469835-31469857 GTGTAGAAAGAAATAGACATGGG - Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173253058 20:41374764-41374786 CTCGACTCAGAAATAGACAATGG - Intergenic
1173473014 20:43338247-43338269 GTGTAGAAAGAAATAGACATAGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174714049 20:52737837-52737859 CTAGATAAACAAACAGACAGAGG + Intergenic
1174843358 20:53920341-53920363 CAGGGTACAGAAATAGAGAAAGG + Intergenic
1176926060 21:14750324-14750346 ATGGAATAAGAAATGGACAAAGG + Intergenic
1177108594 21:16994695-16994717 ATGGAAAAAGAAATGGAAAATGG - Intergenic
1177160914 21:17547004-17547026 CTAGAGAAAGAAATGTACAAGGG - Intronic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177423658 21:20895030-20895052 CAGGATAAAGACAGAGAGAAAGG - Intergenic
1177556094 21:22690543-22690565 GTGGATATAGAAACAGACAATGG - Intergenic
1177781605 21:25628011-25628033 CTGAAGAAATAATTAGACAAGGG + Intergenic
1178113369 21:29392576-29392598 GTGTAGAAAGAAATAGACATAGG - Intronic
1178215723 21:30595586-30595608 CTGGATTTAGAAATTGACAAAGG - Intergenic
1178343409 21:31805110-31805132 CTGGATAGAAAAAGAAACAAAGG - Intergenic
1178956199 21:37024332-37024354 CTGGACATAGGAATAGGCAAAGG - Intergenic
1179224065 21:39437012-39437034 GAGGATATAGCAATAGACAAAGG - Intronic
1179438964 21:41380130-41380152 GTGGAGAAAGAGATACACAAAGG + Exonic
1179606657 21:42520613-42520635 GTCGATATAGAAATAGAGAAGGG + Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181370828 22:22415478-22415500 GTGAAAAAGGAAATAGACAAAGG + Intergenic
1182390161 22:29987205-29987227 CTGGACAAAGAAACAGAAACTGG - Intronic
1182751228 22:32643788-32643810 GTGCTTAAAGAAAGAGACAAGGG + Intronic
1183022631 22:35039548-35039570 TTGGCTAAAGAAATAGAAGATGG - Intergenic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950623603 3:14227512-14227534 CTGGAAAAACAGATAGAAAAGGG + Intergenic
952952382 3:38535450-38535472 CAGGAAAAAGAAATAGAAATAGG - Intronic
955198033 3:56823630-56823652 ATGGCAAAAGAAATACACAAGGG - Intronic
956049431 3:65231620-65231642 CAGGAGATAGAAATAGACCATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956809519 3:72850855-72850877 ATGGATGTAGAAATAGAAAAGGG - Intronic
957505905 3:81120157-81120179 ATGGATAAAGAAATTGTCAGTGG + Intergenic
957697776 3:83664801-83664823 AAGGACAAAGAAACAGACAAAGG + Intergenic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960597984 3:119424152-119424174 CTGAATTAAAAAATAGGCAAGGG - Intergenic
961709098 3:128813304-128813326 CTGGACAAGGAAACAGAGAAAGG - Intronic
962400240 3:135052393-135052415 CTGGTTAGAGAAAGAGAAAAAGG + Intronic
962788052 3:138785426-138785448 CTGTAGAAAGAAGTAGACATAGG + Intronic
964509653 3:157437021-157437043 TTGGACAACGAAATAGACAATGG + Exonic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965205718 3:165717800-165717822 CTGGAAAAAGAAAAAAAAAAAGG - Intergenic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
966264897 3:178027988-178028010 CTGGATATAAGAATAGAGAAAGG + Intergenic
967261235 3:187644575-187644597 CTGGCTAAAGCAATTAACAAAGG - Intergenic
967381177 3:188860031-188860053 TTAGATTAAGATATAGACAAAGG + Intronic
967580997 3:191154012-191154034 ATGGAAATAGAAATAGAGAAGGG - Intergenic
968247746 3:197170797-197170819 CTGGATATAGGAACAGGCAAAGG - Intronic
969922784 4:10556774-10556796 CTGGTTAAAGAAAAGGAGAAGGG + Intronic
970132597 4:12887701-12887723 CTGGGGAAAGGAATAGAGAAAGG + Intergenic
971402674 4:26290890-26290912 CTGGTTTAAGAAATAAATAAAGG - Intronic
971941316 4:33219423-33219445 CTCTATAAAGGAATAGAAAATGG + Intergenic
971964415 4:33534168-33534190 ATTGATAAACAAATAGAGAAAGG + Intergenic
972577932 4:40369006-40369028 CTGGATAAGGAAATGTAAAAAGG - Intergenic
973020218 4:45195626-45195648 CAGGATTAACACATAGACAAAGG - Intergenic
974350735 4:60742827-60742849 CAGGACAGAGAGATAGACAAAGG + Intergenic
974497835 4:62656273-62656295 TTGAATAAAGAAATTGGCAAAGG - Intergenic
974690887 4:65296858-65296880 CTGCATAATGATGTAGACAATGG + Intergenic
974839526 4:67285039-67285061 CTGGTTAAAGAACTAGCAAATGG - Intergenic
975742146 4:77439781-77439803 CATGGTTAAGAAATAGACAAAGG - Intergenic
976045491 4:80941817-80941839 CAGGAAGAAGAAAGAGACAAGGG + Intronic
977137125 4:93319359-93319381 CTAAATTAAGAAATTGACAAGGG - Intronic
977171036 4:93762918-93762940 CTGGATAAAGAAAATGGCAGAGG + Intronic
978421165 4:108534203-108534225 GAGGATAAAGAAAGAGACAGTGG - Intergenic
979592763 4:122499141-122499163 CTGGAAGAATAAATAGATAATGG - Intergenic
979623060 4:122817447-122817469 CTAAACAAAGTAATAGACAAAGG - Intergenic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981352609 4:143750298-143750320 ATATATAAAGAAATAGACACTGG - Intergenic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982113853 4:152080647-152080669 CTAAATAAAGAAAGAGAGAAAGG + Intergenic
982147042 4:152406202-152406224 CTGTATAAAGAACTAATCAATGG + Intronic
982813183 4:159852519-159852541 ATAGATAAAGACATAGACATAGG - Intergenic
982832164 4:160076041-160076063 CTGGATAAAGGAGTCAACAAAGG + Intergenic
983507254 4:168567338-168567360 CTCTATGAAGAAGTAGACAAAGG + Intronic
983603493 4:169557630-169557652 CTGGTTAAAAAAAGAAACAAAGG + Intronic
983873398 4:172848495-172848517 CTGGATGAATGAATAGACAGGGG + Intronic
984250262 4:177323688-177323710 CTGGATAGAGTAGTACACAATGG + Intronic
984501230 4:180561899-180561921 CTGGAGAAAGAAATATTAAATGG + Intergenic
986195052 5:5530667-5530689 CTGGAAAAAGAAATAACTAATGG + Intergenic
986383800 5:7211231-7211253 TTGGATAAAGTGATAGAAAATGG - Intergenic
986904385 5:12476220-12476242 TTGAATATAGAAGTAGACAATGG - Intergenic
986953898 5:13126534-13126556 ATGGATTAAGAAATATATAATGG - Intergenic
988459857 5:31425024-31425046 GTGGATAAAGTAATATACTAGGG - Intronic
988607338 5:32690167-32690189 AGGGATAAGGAAATAGAAAAAGG - Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989354293 5:40524770-40524792 ATGGACAAATAAATAGATAAAGG + Intergenic
989498889 5:42142401-42142423 CTGGATACAGAAAGAGAAAGAGG + Intergenic
990177679 5:53126189-53126211 CTGGATGAAGAAATAGTAGATGG - Intergenic
991261620 5:64674818-64674840 ATTGATAAATAAATAGACAGCGG + Intergenic
991441683 5:66657009-66657031 CTGCAAAAATAAATAGATAAAGG - Intronic
991656312 5:68907375-68907397 TTGGAGAAAAAAATAGAGAATGG - Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
991922556 5:71671317-71671339 ATGGATAAAGAAAGAGAGGAAGG - Intergenic
992232011 5:74672753-74672775 CTGGGAAATGTAATAGACAAAGG - Intronic
994725518 5:103430636-103430658 CTGCAGAAAAAAATAGACACAGG + Intergenic
995027994 5:107446869-107446891 CAGGATATATAAATACACAAAGG + Intronic
995482037 5:112603103-112603125 CTGGATAAATAAATATGGAAAGG - Intergenic
995943886 5:117618790-117618812 CTGGCTAAAGAATTAAATAAAGG + Intergenic
996408730 5:123132188-123132210 TTGGCTCAAGTAATAGACAAAGG - Intronic
997466026 5:134088692-134088714 CAGGATCAAGAAATAGAGCATGG + Intergenic
999520717 5:152348245-152348267 CTGGAAAAAGATAAACACAAAGG - Intergenic
1000540420 5:162532120-162532142 CTAGAAAAAGAAAAACACAAAGG + Intergenic
1000718822 5:164680513-164680535 CTGGATCAGGAAAAAGACATGGG + Intergenic
1000729712 5:164818372-164818394 CTAGATTAAGAAATAGATCATGG - Intergenic
1001722700 5:173869617-173869639 CTGGACAAAGAAACAGACACAGG + Intergenic
1003651989 6:7969240-7969262 CTGGATAAATGAATAAACAAAGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1004939921 6:20545054-20545076 CTCGTTAAAGAACTATACAAAGG - Intronic
1005184728 6:23152725-23152747 CTGGAGATATAAATATACAAAGG - Intergenic
1005196306 6:23288152-23288174 CTGGGGAAAGAAGTAGAGAAGGG + Intergenic
1005315825 6:24601942-24601964 CTGGATATAAAAGCAGACAATGG - Intronic
1005411570 6:25553718-25553740 CTGGATAAAGACAAAGTTAATGG - Intronic
1005794681 6:29347480-29347502 GAGGATAAAGAAACAGAAAAGGG - Intergenic
1006214245 6:32426125-32426147 CTGGATATAGAAACAGACAATGG + Intergenic
1006228787 6:32564302-32564324 CTGGAAAAACAGATAGAAAAGGG - Intronic
1006245051 6:32726045-32726067 ATAGACAAAGAAAAAGACAATGG + Intergenic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1008106240 6:47443740-47443762 CTGTAGAAAGAAGTAGACATAGG - Intergenic
1008549749 6:52616913-52616935 CTGGATAAAGAAATAAATTAAGG + Intergenic
1009819639 6:68783497-68783519 CTAGGTAAACAAAAAGACAAGGG + Intronic
1010190007 6:73185528-73185550 CAGGAAAAAGAAATAGCAAATGG + Intronic
1010342530 6:74771675-74771697 ATGAATAAAGAAATATATAATGG - Intergenic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1010436052 6:75832408-75832430 CTGGAAAAAAAAATACATAATGG - Intronic
1010794374 6:80102514-80102536 CTATTTAAAGAAATGGACAAAGG - Intergenic
1010847343 6:80725483-80725505 CTGGATAATGAAATCTTCAAGGG + Intergenic
1011000759 6:82585519-82585541 CTGGAGGAAGAAGTAGAGAAAGG - Intergenic
1011098030 6:83688174-83688196 CTGAATAAGGAAATAACCAAGGG - Intronic
1011228322 6:85132190-85132212 CTGCAAAAAAAAATACACAATGG - Intergenic
1011354001 6:86454696-86454718 CTGGATAAAGAGATATACAGGGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011680216 6:89776039-89776061 CTGCATTAAGTTATAGACAAAGG + Intronic
1011708131 6:90023934-90023956 CTGAATTAAGACATATACAAAGG + Intronic
1011845416 6:91557720-91557742 TAGGATGAAAAAATAGACAAAGG + Intergenic
1011961547 6:93096658-93096680 GTTGAGAAAGAAAGAGACAAAGG - Intergenic
1012185879 6:96216405-96216427 CTGGATAAAAAAAAACACAGAGG + Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1012960982 6:105621498-105621520 CAGGTTAAAGAAACAAACAAGGG + Intergenic
1013800156 6:113932401-113932423 CTGTAGAAAGAAGTAGACATAGG + Intergenic
1014552500 6:122804886-122804908 CTGGAAAAAGAAACACAAAAAGG - Intronic
1014765962 6:125407134-125407156 CTGGCAGAAGACATAGACAAAGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014887255 6:126796917-126796939 ATGGAAAAAGAATTAGAGAATGG - Intergenic
1015662487 6:135590831-135590853 CTGGAGCAAGCAATAGAGAATGG + Intergenic
1016429843 6:143971712-143971734 CTGGTTAAAGAAATTGTCAAGGG + Intronic
1017157910 6:151338955-151338977 CTGGATAAAGCAAGAATCAATGG - Intronic
1017292395 6:152754881-152754903 CTGAATAAAGACATTCACAATGG - Intronic
1018583358 6:165328263-165328285 GTGACTAAAGAAAAAGACAAAGG + Intronic
1019208395 6:170382846-170382868 CTTGAAAAAGAAAAAGAAAATGG + Intronic
1020150576 7:5678838-5678860 CTGGATAAATTAAGAGGCAAAGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020905254 7:14055906-14055928 CTGGATGAAGAAACAGACTGTGG + Intergenic
1021290692 7:18840703-18840725 CAGGAGAAAGAGATAGACACTGG - Intronic
1021792659 7:24221590-24221612 AAGGATATACAAATAGACAATGG + Intergenic
1021872819 7:25019823-25019845 GTGTAGAAAGAAATAGACATGGG + Intergenic
1022060908 7:26794265-26794287 GTGGCTAAAGGAATAGACTAGGG + Intronic
1022534470 7:31087231-31087253 CTGAGTACAGAAGTAGACAAGGG - Intronic
1022592101 7:31673387-31673409 CTGAAAATAGAAACAGACAATGG - Intergenic
1022611942 7:31884672-31884694 ATGGATAAAGAGCTAGAGAAAGG - Intronic
1023181722 7:37491723-37491745 TTGTAGAAAAAAATAGACAAAGG - Intergenic
1023201416 7:37701216-37701238 CTGGAGAAAGAAAGAGACTTAGG - Intronic
1023573287 7:41595174-41595196 CTTCATTAAGAAATAGAAAAGGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1025851024 7:65243931-65243953 GTGTAGAAAGAAATAGACATGGG - Intergenic
1026788008 7:73313817-73313839 CTGGAGAAAGAAATGGACACTGG + Intronic
1027724518 7:81787443-81787465 CTGGTGAATGAAATAGGCAAAGG + Intergenic
1027893893 7:84015587-84015609 CTGGATAAAATAATACACTAAGG - Intronic
1028444765 7:90908915-90908937 GTGGATAGAAAAATTGACAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029024116 7:97396849-97396871 CTCCTTAAAGAAATATACAAAGG - Intergenic
1029099550 7:98117362-98117384 TTGAATAAAGAAATAAACAGAGG - Intronic
1029967463 7:104755015-104755037 TTGTATACAGAAATAGTCAATGG - Intronic
1030211016 7:106995799-106995821 CTGGATAAAGTAAAATACACGGG - Intergenic
1030280780 7:107772905-107772927 CTGGATACAAAATTAGAAAATGG - Intronic
1030914985 7:115302055-115302077 AAGGAAAAAGAAATAGTCAAAGG - Intergenic
1030993719 7:116332703-116332725 CTGGATAAAGAAATATTATAAGG - Intronic
1031103282 7:117508159-117508181 CTAGGTAAACAATTAGACAAAGG - Intronic
1031365644 7:120897540-120897562 CTGGATAAAGAGAGAATCAAGGG - Intergenic
1031719473 7:125153310-125153332 CAGGATATAGAAACACACAAGGG - Intergenic
1032807004 7:135365522-135365544 CTAGATAAAGAAACAGACTCAGG + Intronic
1033061080 7:138108219-138108241 GTGAAGAAAGAACTAGACAAAGG + Intronic
1033140268 7:138820382-138820404 ATGGATAATGCAAAAGACAAAGG - Intronic
1033423318 7:141221568-141221590 TTAGAATAAGAAATAGACAATGG + Intronic
1034242195 7:149619117-149619139 ATGAATAAATAAATAGACACTGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035412686 7:158657760-158657782 CTGTAGAAAGAAGTAGACATGGG + Intronic
1035814333 8:2522811-2522833 CTGGGTAAGGAAATAGAGAGTGG + Intergenic
1036000857 8:4602045-4602067 ATGAATATAGAAATAGATAAAGG + Intronic
1037568455 8:20137772-20137794 CTGGAAAATGAAGTAAACAAAGG + Intergenic
1037698984 8:21255215-21255237 CAGAATAAAGAAATAGAAAAAGG - Intergenic
1037826171 8:22161945-22161967 CTGGATAAGGAAACAGGCCAGGG - Intronic
1038332611 8:26621141-26621163 ATAGATAAAGAAATAGAATAAGG + Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038799518 8:30736823-30736845 CTGTATAAAGAATAATACAATGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1040027666 8:42796601-42796623 GTGTAGAAAGAAATAGACATAGG - Intergenic
1040126205 8:43740444-43740466 GTGTAGAAAGAAATAGACATAGG - Intergenic
1040387339 8:46922379-46922401 CTGGATAAGGAAACAGACTCAGG + Intergenic
1040482604 8:47840390-47840412 CTGGATCCTGAAATAGAAAAAGG + Intronic
1041152127 8:54945329-54945351 CTTGATGAAGAAATGGAGAAGGG - Intergenic
1041476253 8:58270055-58270077 CTGGATATAGAATTATACATTGG + Intergenic
1042007023 8:64192621-64192643 CTTGAGAAAGAGATAGAAAAAGG + Intergenic
1042086077 8:65110335-65110357 CTAGAAAAAGAAATAGGAAAGGG + Intergenic
1043210270 8:77505233-77505255 GTGGATAAAGAAAGGGACAAAGG - Intergenic
1043611352 8:82067130-82067152 TTGGAAAAGGAAATAGAAAAGGG + Intergenic
1043784684 8:84383827-84383849 CTGGATAAATAAATGAGCAAAGG + Intronic
1043963749 8:86447822-86447844 CTGGATAAGGAAATATAAAAGGG - Intronic
1044481576 8:92696173-92696195 ATTGATAAAGAAATAACCAAAGG - Intergenic
1044530525 8:93301811-93301833 CCAGAAAAAGAAATAGAAAACGG + Intergenic
1044579964 8:93814999-93815021 TTGTATAAAGAAATAGAGAAAGG + Intronic
1044661091 8:94591963-94591985 GTGTAGAAAGAAATAGACATGGG + Intergenic
1044768555 8:95604417-95604439 ATGGAGAAAGAAAAAGTCAAGGG - Intergenic
1045856917 8:106774976-106774998 CTTCATTAAAAAATAGACAAAGG - Intergenic
1046035775 8:108839696-108839718 CTGAAAAAAGAAATAGGAAAAGG + Intergenic
1046269120 8:111870274-111870296 GTGGACAAAGGAATAGAAAATGG - Intergenic
1046587620 8:116167262-116167284 CTTGATGAAGAAGTGGACAAAGG - Intergenic
1046813346 8:118556660-118556682 CTGGTGATAGAAATAGACATGGG + Intronic
1046930748 8:119839469-119839491 CTGGCTAAAGAGATAGGTAATGG - Intronic
1047081214 8:121462998-121463020 CTCGATTAAAAAATAGGCAAAGG + Intergenic
1047112867 8:121810096-121810118 CTGGAAATGGAAATGGACAAAGG + Intergenic
1047300610 8:123610611-123610633 CAGGCTGAAGAAATAGATAAAGG + Intergenic
1047805493 8:128355312-128355334 GTGGAGGGAGAAATAGACAAAGG - Intergenic
1048716848 8:137280705-137280727 ATGGATAAATAAATAGGTAAAGG - Intergenic
1049044111 8:140136149-140136171 CTTAAAAAAAAAATAGACAAGGG + Intronic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050109856 9:2203219-2203241 CAGGAGAAAGAAAGAGAAAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051879538 9:21825963-21825985 CTGATTAAAAAAATAGGCAAAGG - Intronic
1052322030 9:27177789-27177811 CCTGATAAAAAAATGGACAAAGG - Intronic
1052367354 9:27627853-27627875 ATTGAAAAAGAAACAGACAACGG - Intergenic
1052635282 9:31095356-31095378 CTATATAAAGAAATAGATACTGG + Intergenic
1052764110 9:32622808-32622830 ATGGATAAACAAATACACATTGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055269340 9:74539698-74539720 CTGGATAAGGGAATAAAGAATGG + Intronic
1055600448 9:77911942-77911964 CTGGATAAGGAAATAAACCGAGG + Intronic
1056023140 9:82462672-82462694 CTGGAGGAAGATATAGCCAAAGG + Intergenic
1056935272 9:90911408-90911430 CTGGATAAAAAAGAAGAAAAGGG - Intergenic
1057087080 9:92221059-92221081 CTGCAGAAAGTAAAAGACAAAGG + Intronic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1058185108 9:101845634-101845656 CTACATAAAGAAATAGGCACGGG - Intergenic
1058194940 9:101961250-101961272 CTGGAAAAATAAATAGTTAAAGG - Intergenic
1058390741 9:104492424-104492446 CTGTACAAAGAAATAAACACAGG + Intergenic
1058699873 9:107591131-107591153 CTGGGTACAGAACTAGAAAATGG - Intergenic
1058762416 9:108147815-108147837 CTGAGTAAAGAAAAAAACAAGGG + Intergenic
1058911780 9:109526808-109526830 ATGGATAAATAAGTAGACAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059211518 9:112515492-112515514 GTGTAGAAAGAAATAGACATGGG + Intronic
1059622201 9:116019059-116019081 TTGGATAAAGAAACAACCAATGG - Intergenic
1060377707 9:123132398-123132420 AAGGCTAAAGAAATACACAAAGG - Intronic
1060386027 9:123229347-123229369 CTCAATAAAGAAATAGAAGAGGG + Intronic
1185481875 X:452319-452341 GTGGATAAATAGATAGATAATGG - Intergenic
1185815440 X:3150915-3150937 TTAGATAAAGAACTAGACAAAGG - Intergenic
1186218650 X:7326266-7326288 CTGGATAAAGAGATTGGCAGAGG - Intronic
1186428270 X:9482703-9482725 CTGGCTATAGAGATAGAAAAAGG - Intronic
1189670625 X:43404647-43404669 CAGGATAAGGAAACAGACTAGGG + Intergenic
1190722432 X:53161099-53161121 CTGGAAAAACAAATAAAGAAGGG - Intergenic
1191029630 X:55954365-55954387 CTTCACAAAAAAATAGACAAAGG + Intergenic
1192103838 X:68294021-68294043 GTGGATAACTAAATAGGCAATGG - Intronic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193227571 X:79002222-79002244 CTGATTAAAGAAATAGGCCAAGG + Intergenic
1193276819 X:79598605-79598627 CTGGACAAATAAATAGAGAAGGG - Intergenic
1193960447 X:87918511-87918533 CTGGACACAGGGATAGACAATGG + Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194484139 X:94466160-94466182 CTGGACATAGAAACAGGCAAAGG + Intergenic
1194525606 X:94973305-94973327 CTGGACACAGAAATGGGCAAAGG - Intergenic
1195703415 X:107721716-107721738 CTGGAAAAGGAAATACAAAAAGG + Intronic
1195896004 X:109746885-109746907 ATGGATAAATAAATAGATATGGG + Intergenic
1196213013 X:113016557-113016579 CTGGATAATAAAATATATAAAGG - Intergenic
1196630572 X:117934528-117934550 ATGGATAAAGAATTGGAGAATGG + Intronic
1196981258 X:121216079-121216101 AAGGATAGACAAATAGACAAAGG - Intergenic
1197921669 X:131601198-131601220 CTGGATAAAGAAAAACACAATGG - Intergenic
1199212516 X:145230205-145230227 ATGTATAAAAAAACAGACAAAGG + Intergenic
1199374603 X:147092461-147092483 CTGGAGCAAGAAATACAAAAGGG - Intergenic
1200274002 X:154714728-154714750 CTGGATAAGGAAAGAAACAGAGG + Intronic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1201523909 Y:14909522-14909544 ATGGATAAATGAATAGATAATGG + Intergenic