ID: 964706549

View in Genome Browser
Species Human (GRCh38)
Location 3:159624755-159624777
Sequence CCTTGGGGCCCTGGATCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964706549_964706556 7 Left 964706549 3:159624755-159624777 CCCAGAGATCCAGGGCCCCAAGG 0: 1
1: 0
2: 2
3: 21
4: 253
Right 964706556 3:159624785-159624807 AGAAGAGCCTTCCAACGAAAAGG 0: 1
1: 0
2: 1
3: 8
4: 156
964706549_964706560 30 Left 964706549 3:159624755-159624777 CCCAGAGATCCAGGGCCCCAAGG 0: 1
1: 0
2: 2
3: 21
4: 253
Right 964706560 3:159624808-159624830 TTGTGAGTCACAGCACCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 210
964706549_964706559 29 Left 964706549 3:159624755-159624777 CCCAGAGATCCAGGGCCCCAAGG 0: 1
1: 0
2: 2
3: 21
4: 253
Right 964706559 3:159624807-159624829 GTTGTGAGTCACAGCACCTGAGG 0: 1
1: 0
2: 2
3: 23
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964706549 Original CRISPR CCTTGGGGCCCTGGATCTCT GGG (reversed) Intronic
900158248 1:1212026-1212048 CCGGGGGGCCCTGGGTCTCCTGG + Exonic
900387427 1:2416933-2416955 CCCTGGGGCTCTGGGGCTCTGGG + Intergenic
903672518 1:25045148-25045170 GTTTGGGTCCCTGGACCTCTGGG + Intergenic
904603008 1:31683966-31683988 CCTGGGGGCCCTTGAACTCCTGG + Exonic
904604141 1:31689769-31689791 CCTTTGGGCCCTGGCTTTCCAGG + Exonic
905732079 1:40304345-40304367 CCTTGGGGCCCTGGAATTCCGGG + Exonic
906142485 1:43542089-43542111 CCCTGGGACCCTGGGACTCTGGG + Intronic
907471162 1:54674317-54674339 CCTTTGTCCCCTGGTTCTCTGGG - Intronic
907654525 1:56328778-56328800 CCTTGGGGCTCTTAAGCTCTCGG + Intergenic
911119645 1:94282702-94282724 CCTCAGGGCCATGGACCTCTAGG - Intergenic
915214221 1:154329187-154329209 CCTTCGGAGCCAGGATCTCTGGG - Intronic
917578977 1:176354933-176354955 CCTAGGAGACCAGGATCTCTAGG + Intergenic
920880656 1:209877339-209877361 CCTTAGGGCTCAGCATCTCTTGG + Intergenic
921987306 1:221326386-221326408 CCTTTGAGCCCTGGATTTCGAGG - Intergenic
922062895 1:222108567-222108589 CCTTAGGGCTCTGTGTCTCTGGG - Intergenic
923167254 1:231377722-231377744 CCTTAGAGCCCTGGAGCCCTAGG + Intronic
924931832 1:248739226-248739248 CCTTGCAGCCCTGCACCTCTGGG - Intronic
1065505543 10:26426799-26426821 CCTGGGGGTCCTGGAGTTCTTGG + Intergenic
1068863528 10:61870666-61870688 TTTGGGAGCCCTGGATCTCTAGG + Intergenic
1069015649 10:63426273-63426295 CCTTGGGGCCCAGGAGTTCAAGG + Intronic
1069629896 10:69891227-69891249 CCTTAGTGCCCTGGAAATCTTGG + Intronic
1070275254 10:74999780-74999802 CTCTGGGGCACTGAATCTCTGGG - Intronic
1070664879 10:78336016-78336038 TCCTGGTGCCCTGGAGCTCTGGG + Intergenic
1073448848 10:103597511-103597533 GCATGGGGCCCTTGACCTCTAGG - Exonic
1076512905 10:131025062-131025084 CTTTGAGCACCTGGATCTCTGGG - Intergenic
1076978397 11:192547-192569 CCTGGGGGCTGTGGATCTATGGG - Intronic
1077025756 11:439198-439220 CCCTGGGGCCCTGGAGTACTGGG - Intronic
1077273270 11:1691774-1691796 CCATGGGGCTCTGGAGCCCTGGG - Intergenic
1080416266 11:32072655-32072677 CCTGGAGGCCCTTGATATCTGGG - Intronic
1081477076 11:43444166-43444188 CCTTGGGGCCAGTGATCTCTAGG - Exonic
1083424500 11:62576092-62576114 CCTTGGCCCCCTGAATCTCCAGG - Exonic
1083547445 11:63559427-63559449 CCTGGGGACCCTGGATTCCTGGG - Intronic
1083896076 11:65620463-65620485 TCTTGGTGGCCTGCATCTCTGGG + Intronic
1084909076 11:72373058-72373080 CCTGCAGGCCCTGGAGCTCTGGG + Intronic
1084980894 11:72828229-72828251 CCCCAGGGCCCTGGATCGCTGGG - Intronic
1085152765 11:74265391-74265413 CCTTGGGGCCACAGAGCTCTGGG + Intronic
1086461929 11:87014621-87014643 CCTTGGGCCCTTGGATGCCTGGG - Intergenic
1087759807 11:102093417-102093439 GCTTGAGCTCCTGGATCTCTAGG + Intergenic
1088821619 11:113461926-113461948 CCATGGGAACCTGGATTTCTGGG - Intronic
1089602285 11:119623462-119623484 CCTGGGGGCTCTGGAGGTCTGGG + Intronic
1094856897 12:34406891-34406913 CCATGGGCCCCAGGAGCTCTGGG - Intergenic
1095096134 12:38150335-38150357 CAGTGGTGCCCTGGGTCTCTGGG + Intergenic
1100245187 12:92750647-92750669 CCTTCAGGTCCTGGACCTCTTGG - Intronic
1100598432 12:96091492-96091514 CCTTGAGGCCCTGTGTTTCTGGG + Intergenic
1104405275 12:128511656-128511678 CCTTGGGGTCCTGTCTCTCCTGG + Intronic
1106462255 13:29981446-29981468 CCTTGTGGCCCTTCATTTCTTGG + Intergenic
1107804963 13:44145052-44145074 CTTTGGGGGCCTAGGTCTCTAGG + Intronic
1108373880 13:49795632-49795654 CCTTGGAGACCTTAATCTCTGGG + Intergenic
1108594535 13:51938088-51938110 CCCTGGGACCCTGGGACTCTGGG - Intronic
1109203019 13:59451967-59451989 GCTTGGTGCCCTGGTGCTCTGGG + Intergenic
1110798522 13:79668572-79668594 CCTTGTGACCCTGGAGCTCAGGG + Intergenic
1110810756 13:79808500-79808522 CTTTGGGGCCCTGCATTTCCTGG + Intergenic
1113423263 13:110186393-110186415 CCTGGAGGCCCTGGATCCCCAGG - Exonic
1113498780 13:110756615-110756637 CCTTGTGGCCCTGGAACTGAAGG + Intergenic
1113594506 13:111521484-111521506 GCTTGGGGCTCTGGAGATCTGGG + Intergenic
1117521954 14:56559977-56559999 CCTTGGGGCCCTCGTCCACTGGG + Intronic
1117778057 14:59202309-59202331 CCTTGGGTCACTGTAACTCTGGG - Intronic
1118629739 14:67691744-67691766 CCTTGGAGGCCTAGATCCCTGGG + Intronic
1118822789 14:69355898-69355920 CCTTGGGGTGCTGGAACCCTGGG - Exonic
1118896250 14:69948151-69948173 CTTTGGGGCCCTGGAGCTTTGGG + Intronic
1118901232 14:69987562-69987584 CCCTGCGTCCCTGGACCTCTTGG + Intronic
1122017591 14:98809125-98809147 CCTTGGGACCCTGAAAGTCTTGG - Intergenic
1122279017 14:100610339-100610361 CTTTGGGCCTCTGGAGCTCTGGG + Intergenic
1122327354 14:100890646-100890668 CCTGGGGCCCCTGGCTCTCTGGG + Intergenic
1122871884 14:104642531-104642553 CCTTGGGGCCTCTGGTCTCTGGG - Intergenic
1123102718 14:105816444-105816466 CCTTGGGGACATGGACCACTGGG - Intergenic
1123990673 15:25680923-25680945 CAGTGGGGTCCTGGATCTGTAGG + Intronic
1126111416 15:45177209-45177231 CCTTGGGTACCTGGGGCTCTGGG - Intronic
1126694648 15:51315653-51315675 CCTTGAGGGCCTGGATGTATAGG - Intronic
1128074185 15:64816218-64816240 CCCTGGGGCCCTGGGCCACTAGG + Intronic
1128114563 15:65097105-65097127 GCCTGGCCCCCTGGATCTCTGGG - Intronic
1129002612 15:72346878-72346900 TCTTAGGGCCCTGGATTCCTTGG - Intronic
1129424256 15:75453108-75453130 CCTTGGGGTCTTAGCTCTCTGGG - Intronic
1131259483 15:90881140-90881162 CCTAGGGCCCCTGGGGCTCTTGG + Intronic
1131563226 15:93462352-93462374 CCTTGAAGCCTTGGTTCTCTTGG + Intergenic
1132688402 16:1171725-1171747 CCTGGAGTCCCTGGAGCTCTGGG + Intronic
1133240758 16:4412982-4413004 TCTTTGGGCCCTGGATGGCTGGG - Intronic
1133708238 16:8376054-8376076 CTTTGGAGCACTGGATATCTGGG - Intergenic
1134062113 16:11205603-11205625 CCCTGGAGCCCTGGACCTCATGG - Intergenic
1134132177 16:11657364-11657386 CCTTGGGGACCTGGGGCTCCTGG - Intergenic
1137044333 16:35642012-35642034 CCACGGGGCCCTGGCTCTCCTGG - Intergenic
1139751409 16:69111129-69111151 CCCTAGGACCCTGGATTTCTAGG + Intronic
1141434201 16:83989975-83989997 CCTAGGGCTCCTGGATCTCCAGG - Intronic
1141687670 16:85579553-85579575 CCTGCTGGCCCTGGATCTCCAGG - Intergenic
1142192752 16:88725434-88725456 CCTTGGGGCCCAGGGTGTCCTGG + Exonic
1142353032 16:89588454-89588476 CCTAGGCTCCCTGGATCTCCGGG - Intronic
1142465825 17:137038-137060 CCTGGGGGCTGTGGATCTATGGG - Intergenic
1143236881 17:5409958-5409980 CCTCTGTGCCCTGGCTCTCTGGG - Intronic
1144782990 17:17817170-17817192 ACTTGGGGCTCTGGATTTCCTGG - Intronic
1145278206 17:21448728-21448750 CCCAGAGGCCCTGGATGTCTTGG + Intergenic
1145778927 17:27549302-27549324 CCCTGGGTCCCTGGGTCACTTGG + Intronic
1146225584 17:31063112-31063134 CCTTGGGCCCCTGTCTCTATTGG + Intergenic
1148152661 17:45405506-45405528 CCTGGGGTCCCTGGGTCTGTGGG + Intronic
1148872942 17:50669140-50669162 CTTTCGGGACCTGGATGTCTAGG - Exonic
1149322509 17:55495953-55495975 CCTTTGGCCCCTGGATCTTCTGG + Intergenic
1152095418 17:78269225-78269247 CCTTGGGCCCCTGGAACAATGGG + Intergenic
1152538400 17:80963196-80963218 GCCTGGGTCCCAGGATCTCTAGG + Intronic
1152962477 18:88096-88118 GCCTGGGTCCCAGGATCTCTGGG + Intergenic
1154204972 18:12328535-12328557 CCCCTGGGCCCTGGCTCTCTGGG - Intronic
1154500045 18:14991582-14991604 CCATGGGACCCTGGGCCTCTGGG + Intergenic
1155369205 18:25080104-25080126 CCTTGGGCCCCTCCATGTCTGGG - Intronic
1156244344 18:35283706-35283728 CGTTGGGGCCCTGCATTTCCTGG - Intronic
1157567369 18:48688660-48688682 ACTTGGGGCCCAGGGTCCCTTGG + Intronic
1157743581 18:50115167-50115189 CCTTGGGGATCAGGATCCCTGGG - Intronic
1160348364 18:78153168-78153190 CCTTTGTGCCCTGGGTCTCGGGG + Intergenic
1161294442 19:3512616-3512638 CCTTGGGTCCCTGGAGCTGCAGG + Intronic
1161812593 19:6479203-6479225 CCCTGGGTCCCTGAATCTCTGGG + Intronic
1161812599 19:6479219-6479241 CTCTGGGTCCCTGGATCTCTGGG + Intronic
1161812609 19:6479251-6479273 CCCTGGGTCCCTGGATCTCTGGG + Intronic
1161812650 19:6479426-6479448 CCCTGGGTCCCTGGGTCCCTGGG + Intronic
1162088514 19:8262533-8262555 CCCTGGGGCCCTGCATCCTTGGG - Intronic
1162321185 19:9971221-9971243 CCTGGGGGCCCTAGATCTCCGGG + Exonic
1162966977 19:14160647-14160669 CCTTGGGGCTCTGGAACCCCCGG - Exonic
1163427849 19:17248807-17248829 CCTGGGGGCCCAGGAGCTGTGGG - Intronic
1163795294 19:19334476-19334498 CCTTGGGGCTGGAGATCTCTAGG - Intronic
1164992267 19:32692732-32692754 CCTTGGGGGCCTGGGCCGCTGGG - Intronic
1165395400 19:35561003-35561025 CCCTGGTGCCCTGGTTTTCTTGG + Intronic
1165453928 19:35900163-35900185 GCTTGGGAGGCTGGATCTCTGGG - Intronic
1166532734 19:43552528-43552550 GGTTGGGGGCCTGGATCCCTGGG - Intronic
1166603239 19:44116433-44116455 CCTTGGGTGCCTGGAGCACTGGG - Intronic
1166802623 19:45467805-45467827 CCTCGGGGCCCTGGGGGTCTCGG - Intronic
1166897572 19:46033467-46033489 TCTTGGGGCCCTGCAGCTCCTGG + Intergenic
1167600433 19:50451552-50451574 GATTGGGGACCTGGATCCCTGGG + Intronic
1167600461 19:50451626-50451648 GGTTGGGGACCTGGATCCCTGGG + Intronic
1167630366 19:50622558-50622580 CCTGGGACTCCTGGATCTCTGGG - Intronic
1167630875 19:50625655-50625677 GCCTGGGGCCCCGGACCTCTGGG - Intronic
1167639615 19:50673433-50673455 CCTGCGAGCCCTGGTTCTCTCGG + Intronic
1167710793 19:51109204-51109226 GTTTGGGGACCTGGATCTCAAGG - Intergenic
1167756401 19:51416002-51416024 CCCTGGGGCCCTAGACCCCTGGG - Exonic
1168499395 19:56880708-56880730 ACTTGGAGCTCTGGACCTCTTGG + Intergenic
925129021 2:1481474-1481496 CTGTGGGTCCCTGGATATCTGGG - Intronic
925675831 2:6360235-6360257 CTTTGGGGCACTGGATCACAGGG + Intergenic
927498200 2:23564521-23564543 CCTTGGTGCCCAGGAGCACTGGG + Intronic
928212800 2:29336119-29336141 CCTTGGAGGCCTGGAGATCTTGG + Intronic
928312157 2:30220103-30220125 CCGAGGGGCCCTGCCTCTCTGGG + Intergenic
928913598 2:36447874-36447896 CCTTCTGGCCCTGGAACTCTGGG + Intronic
931760721 2:65414527-65414549 CCTTGGTCCCCTGAATGTCTGGG + Intronic
933710515 2:85322332-85322354 CCCTGGGGCCCGGGCTCTGTAGG - Exonic
934504583 2:94880435-94880457 CCTTGGGCTCCTGGATGCCTGGG - Intergenic
937090511 2:119203139-119203161 CCTTGGGGCCATGGCTGTCAGGG - Intergenic
941005381 2:160241939-160241961 CCTGGGTGCCCTGGATGCCTGGG + Intronic
942304143 2:174589431-174589453 CCTTGGGGCTCTACTTCTCTGGG - Intronic
942657812 2:178232365-178232387 CCTTGGTGCCCTATGTCTCTGGG - Intronic
943877416 2:193088884-193088906 CATTGGGGCCCTGGTTCTGCAGG + Intergenic
947352851 2:229264449-229264471 CCTTGTGGCCCTTGATCACTTGG - Intronic
948870362 2:240794815-240794837 ACCTGGGGCCCTGGCTTTCTTGG + Intronic
948939069 2:241187311-241187333 CCTTGGGGCCCTGGGCCTCAGGG - Intergenic
949027694 2:241774134-241774156 CCCTGGGGCCCTGGGGCCCTGGG + Intergenic
1169354886 20:4897959-4897981 CCATGGAGCACTGGTTCTCTGGG - Intronic
1169821169 20:9711745-9711767 CCTTTGGTTCCTGAATCTCTGGG + Intronic
1170764065 20:19275196-19275218 CCCTGGGCTCCTGGAGCTCTGGG + Intronic
1171183982 20:23111798-23111820 CCTAGTGGCCCTGGGTCTCAGGG - Intergenic
1172248275 20:33461045-33461067 CCTTGGCCCCCTGAATATCTGGG - Intergenic
1172639695 20:36433302-36433324 CCCTGGGCCCCTGCAACTCTTGG - Intronic
1173165262 20:40683260-40683282 TCTTGCGACCCCGGATCTCTGGG - Intergenic
1173523757 20:43716965-43716987 CCTTGTGGCCCTAAATCCCTAGG + Intergenic
1175119370 20:56706542-56706564 CCATGTGGCCCTGGAGCTCCTGG - Intergenic
1176139808 20:63539969-63539991 CCTTGGGGCTCACGCTCTCTGGG + Intergenic
1177779551 21:25607700-25607722 CCTGGGGGCCCTGCACCTCTGGG - Intergenic
1177947950 21:27496084-27496106 CTCTAAGGCCCTGGATCTCTGGG + Intergenic
1178741661 21:35207157-35207179 CCCTGGGGCCCGGGCTCTCTGGG + Intronic
1179468897 21:41597532-41597554 ACTAGGGTCCCTGCATCTCTGGG + Intergenic
1179495616 21:41769586-41769608 GCTTGGGGACCTGGAGCTCAAGG - Intergenic
1179588389 21:42388731-42388753 CCATGGAGCTCTGGCTCTCTTGG - Intronic
1180083288 21:45496515-45496537 CCTGGGGGCCCTGGAGGTCCTGG - Exonic
1180161492 21:46000452-46000474 TGTTGGGGGCCTGGGTCTCTGGG + Intronic
1182117981 22:27768323-27768345 CCCTGGGGGCCTGGTTCTCCAGG - Intronic
1182796154 22:32993154-32993176 CATTGGGTCCCTGGATCCCTGGG - Intronic
1183117698 22:35704418-35704440 GGGTGGGGCCCTGGGTCTCTTGG + Intergenic
1183684593 22:39354435-39354457 CCTTGGTGCCATGGATATCCAGG - Intronic
1184192498 22:42904309-42904331 TCCTGGAGCCCTGGGTCTCTGGG + Intronic
1184384854 22:44168207-44168229 CTCTGGGGCCCTGGAAGTCTTGG - Intronic
1184392422 22:44212102-44212124 CCTGGGGGCCCTGGGTGCCTGGG + Intronic
1184551891 22:45209082-45209104 CCCTTGGGCCCTGGAGCACTCGG + Intronic
1185170467 22:49290858-49290880 CCCTGGGGCACTGCATCTCTGGG + Intergenic
1185171126 22:49295240-49295262 CCGGGGGGCCCTGGAACCCTCGG + Intergenic
950549541 3:13657905-13657927 CTTTGGGGCCGTGGAGCTTTGGG - Intergenic
950549549 3:13657937-13657959 CTTTGGGGCTGTGGAGCTCTGGG - Intergenic
951772051 3:26269374-26269396 ATTTGGGGCCCTGGAAATCTGGG - Intergenic
954132231 3:48566676-48566698 CCTGGGGTCCCTGGAGCTCCTGG - Exonic
954440846 3:50521239-50521261 CCTTGGGGGACTGGAGCCCTGGG - Intergenic
958892139 3:99794775-99794797 CCTTGTGGCCCAGGTTCTCCTGG - Exonic
959041113 3:101424184-101424206 CCCTGGGGTCCTGTATCACTGGG + Intronic
960933441 3:122878429-122878451 CCTAGGGTCCCTGGAGCTCCAGG + Intronic
961406180 3:126681404-126681426 CCTTGGGCCCCTGGTCCTCCAGG + Intergenic
963531089 3:146474309-146474331 CCTTGGTGCCGTGGAAATCTTGG - Intronic
964590876 3:158361017-158361039 CCCTGTGGCCCTGGCTCTCAGGG + Intronic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
967297734 3:187981752-187981774 TCTGGGGACCCTGGAGCTCTGGG + Intergenic
968509036 4:987343-987365 CTCTGGGGCCCTGGCTCTCCCGG + Intronic
968634720 4:1672105-1672127 CCCTGGGTTCCTGGATCTGTGGG - Intronic
968724770 4:2241696-2241718 CCTTGGGGCCGCGGATCCCTGGG - Exonic
969574239 4:8027323-8027345 CCCTGGGCCCCAGGAGCTCTGGG + Intronic
970720867 4:18987358-18987380 ACTTGGGGCCATGGGTCTCCAGG - Intergenic
971480973 4:27114694-27114716 CCCTGAGGGCCTGGAGCTCTGGG + Intergenic
977607061 4:98994594-98994616 CCTTGGTGCCCTGGATGCCCTGG + Intergenic
978271181 4:106892929-106892951 CTTGGGGGCCTTGGATTTCTGGG + Intergenic
979487262 4:121283534-121283556 CCTTGGGGCCCTGGGGCCCTGGG - Intergenic
980255585 4:130376695-130376717 CATTGGACCTCTGGATCTCTTGG - Intergenic
985827698 5:2205056-2205078 CCTTGGGGCCCAAGACCTCCAGG - Intergenic
985994906 5:3592442-3592464 CCTTGGGTCCCCGGAGCACTGGG + Intergenic
992275275 5:75110029-75110051 CAGTGGGACCCTGGAGCTCTTGG - Intronic
992425438 5:76652266-76652288 ACTTGTGGCCCTGAATCCCTTGG - Intronic
997658115 5:135570045-135570067 TCTTGGGGCCCTGGACCCCAGGG + Intergenic
999281866 5:150371437-150371459 CCTTGCGGCCCTGGGTTTCTGGG - Intronic
999396881 5:151235160-151235182 CCTTGGGAACCTGGATTTCTGGG + Intronic
1002299083 5:178247525-178247547 CCTTGGGACCCTGGATTCCCTGG + Exonic
1002460126 5:179369161-179369183 CCTTGGGAACCTGGATCACATGG + Intergenic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003338973 6:5201646-5201668 TCTTGGTGCCCTGGATCTTCAGG - Intronic
1006295781 6:33169426-33169448 CCTGGTGGCCCTGGCTCTCCTGG + Exonic
1007428772 6:41764319-41764341 ACTGGGGGCTCTGGCTCTCTGGG - Intergenic
1009933092 6:70199715-70199737 CCTTGGGGTCCAGGGTCTCCTGG - Exonic
1011698300 6:89932770-89932792 GCTCGGGGCTCTGGATGTCTCGG + Exonic
1014035762 6:116765410-116765432 CCTTGGGGCCCAGAATTGCTGGG + Exonic
1014717119 6:124879524-124879546 CTTTGGAGCCTTGGATCCCTGGG + Intergenic
1015440383 6:133241090-133241112 CCTCGGGGCCCTGGATGTCCCGG - Intronic
1017582616 6:155882752-155882774 CCTTGGAGCCCAGGATATTTTGG - Intergenic
1019522992 7:1468926-1468948 CCCTGGGGCCCTGGAGCCATGGG - Intergenic
1019597553 7:1865202-1865224 CCTTGGGCCCCTGACTCTGTGGG - Intronic
1020794249 7:12661958-12661980 CCCAGAGGCCCTGGAACTCTGGG + Intergenic
1021604261 7:22394526-22394548 CCTGGGTGCCCTGGGTCCCTGGG - Intergenic
1023822480 7:43987863-43987885 CCGTGGGGCCGTGAAGCTCTGGG + Intergenic
1024001296 7:45190908-45190930 CCCTGGGGCTTTGGACCTCTGGG + Intergenic
1024364754 7:48508128-48508150 CATTGGGGCCCTGGCTGCCTTGG + Intronic
1026310349 7:69178263-69178285 ATTTGGGGCCATGGACCTCTTGG - Intergenic
1026845090 7:73694222-73694244 GTTTGGGGTCCTGGATGTCTGGG + Intronic
1026949599 7:74338506-74338528 CCTTGGGGCCCGGCTTCTCGGGG - Exonic
1029750743 7:102541278-102541300 CCGTGGGGCCGTGAAGCTCTGGG + Intronic
1029768698 7:102640389-102640411 CCGTGGGGCCGTGAAGCTCTGGG + Exonic
1030206917 7:106960069-106960091 TCTGGGGGACCTGGACCTCTGGG - Intergenic
1033608006 7:142941510-142941532 CCTTGGGGCACTTGATCCCCTGG - Intronic
1034817130 7:154182299-154182321 TCTTGGAGCCCTGGAGATCTTGG - Intronic
1034944657 7:155254041-155254063 CCTGTGGGCCATGGAGCTCTGGG - Intergenic
1035093099 7:156330810-156330832 CCTTGGGGCACTTGCCCTCTTGG - Intergenic
1035848853 8:2894058-2894080 ACGTGGGGTCCTGGATGTCTTGG - Intergenic
1035848868 8:2894116-2894138 AGGTGGGGCCCTGGATTTCTTGG - Intergenic
1035926704 8:3735633-3735655 TCTTGGTGCCCTGGTTCACTCGG + Intronic
1036219364 8:6908415-6908437 CGTTGGCTCCCTGGAACTCTCGG + Intergenic
1036648732 8:10628489-10628511 CCTGGGCTTCCTGGATCTCTGGG - Intronic
1036807851 8:11847562-11847584 CCTTGGGGTCCCGGAACTCTAGG - Intronic
1036977279 8:13427687-13427709 CCTTGGGCCCCTTGTTCTCATGG + Intronic
1037804359 8:22050747-22050769 CCCTGGGTCTCTGGGTCTCTGGG + Intronic
1038646309 8:29365328-29365350 CCTCAGGGCCCTGGACCTCAAGG - Intergenic
1038964915 8:32561745-32561767 CCTTTGACCCCTGGGTCTCTGGG - Intronic
1044329781 8:90904000-90904022 ATTTGGTGCCCTGGATCACTAGG - Intronic
1047547962 8:125838592-125838614 CCTGGGGGCCATGGATCTCTGGG + Intergenic
1047914644 8:129569134-129569156 CCTTGGAATCCTGGATTTCTAGG - Intergenic
1048247416 8:132822418-132822440 CTCTGGAGCACTGGATCTCTAGG - Intronic
1053647513 9:40131894-40131916 CCATGGGACCCTGGGCCTCTGGG - Intergenic
1053758215 9:41331949-41331971 CCATGGGACCCTGGGCCTCTGGG + Intergenic
1054328491 9:63729848-63729870 CCATGGGACCCTGGGCCTCTGGG - Intergenic
1054537066 9:66244276-66244298 CCATGGGACCCTGGGCCTCTGGG + Intergenic
1055405902 9:75973572-75973594 CCTTGGCCTCCTGGATCTCCGGG + Intronic
1057052666 9:91937437-91937459 CCTGGGGCGTCTGGATCTCTGGG - Intronic
1057517372 9:95733465-95733487 CCTTGGGGGCCTAGTTATCTAGG + Intergenic
1058913714 9:109544708-109544730 CCTTTGAGCCCTGGAGCTCAAGG + Intergenic
1059401321 9:114072207-114072229 CTTTGGGGCCCTGCAGTTCTTGG + Intronic
1060358305 9:122931354-122931376 CCCTGGGGCCCTGGATCAACCGG - Intronic
1060719658 9:125967990-125968012 CCTTGGCCTCCTGGAGCTCTGGG + Intergenic
1062024893 9:134335766-134335788 CCTCGGGGCCCTGGCTCCCAGGG + Intronic
1062590232 9:137271255-137271277 CCTCGGGGGCCTGGGTCTCCTGG + Intronic
1062601260 9:137319598-137319620 GCTTGGGGCCCTGGCCCTCCAGG + Intronic
1062735663 9:138136021-138136043 GCCTGGGTCCCAGGATCTCTGGG - Intergenic
1203783739 EBV:115617-115639 CCGGGGGGCCCAGGATCTATAGG + Intergenic
1203744655 Un_GL000218v1:35174-35196 CCTTGGGCTCCTGGATGCCTGGG + Intergenic
1203565449 Un_KI270744v1:84310-84332 CCTTGGGCTCCTGGATGCCTGGG - Intergenic
1186031821 X:5376550-5376572 CTTTGGGGCCGTGATTCTCTAGG + Intergenic
1187234729 X:17456614-17456636 CCTTGGTGCCCTGGGTCGCTGGG + Intronic
1189362066 X:40360417-40360439 CCTTGTTGGCCTGGAACTCTGGG + Intergenic
1193496613 X:82220421-82220443 CCTGGGAGCCTTGGATCCCTGGG - Intergenic
1199444160 X:147901643-147901665 CCCTGGGGCCTTAAATCTCTTGG - Intergenic
1200165502 X:154032517-154032539 CCTTGAGGCCCTGGAGGTCCTGG + Exonic
1200256304 X:154584973-154584995 CCTTCCGGCCCGGGCTCTCTTGG + Intergenic
1200261465 X:154619430-154619452 CCTTCCGGCCCGGGCTCTCTTGG - Intergenic
1200267448 X:154653727-154653749 CCTTCCGGCCCGGGCTCTCTTGG - Intergenic
1201157993 Y:11150215-11150237 CCTTGGGCTCCTGGATGCCTGGG + Intergenic