ID: 964708045

View in Genome Browser
Species Human (GRCh38)
Location 3:159642002-159642024
Sequence TGGAGGAGATTTAGAGCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964708045 Original CRISPR TGGAGGAGATTTAGAGCCAG AGG Intronic
901854792 1:12037776-12037798 TGGAGTAGATAAAGACCCAGAGG - Intergenic
902924128 1:19684511-19684533 CGGAGGAAGTTGAGAGCCAGAGG - Intronic
905388712 1:37622647-37622669 GGGAGGAGACTGAGAGACAGAGG + Intronic
905996472 1:42385638-42385660 AGGAAGAGTTTTAGAACCAGTGG + Intronic
906245707 1:44272380-44272402 AGGAAGAGCTTTGGAGCCAGAGG - Intronic
906380311 1:45328161-45328183 TGGAGCTGATTCAGAGGCAGGGG + Exonic
909867871 1:80696752-80696774 TGTAGGAGACCTTGAGCCAGAGG + Intergenic
915046136 1:153018523-153018545 TGGCGGGGATTTCAAGCCAGTGG - Intergenic
916278654 1:163023906-163023928 TGGAGCAGGCTTAAAGCCAGGGG + Intergenic
916942274 1:169688486-169688508 TGGGGGAGCTTCTGAGCCAGGGG - Intronic
918947149 1:191081695-191081717 TTGAAGAGATTTTGAACCAGAGG + Intergenic
920055259 1:203186468-203186490 GGGAGGAGAAGCAGAGCCAGGGG - Intronic
920869547 1:209782809-209782831 GGGAGGAGAGTTAAAGTCAGAGG + Exonic
920872788 1:209807865-209807887 AGGAGGAGATTTGGACACAGAGG + Intergenic
921014917 1:211180556-211180578 TGGAGAGGATGTAGAGCAAGAGG - Intergenic
921287009 1:213617873-213617895 TCGAGGAGATTTAGACAGAGGGG + Intergenic
922177981 1:223211736-223211758 TGCAGGAGATTAAGAGGAAGGGG + Intergenic
922800581 1:228362983-228363005 TGGAACAGATTTAGAGCAGGAGG - Intronic
923696314 1:236255680-236255702 TGAGGGAGATTTAGAGGCAGTGG + Intronic
1063099476 10:2936744-2936766 AGGAGGAGACTGAGAGGCAGAGG - Intergenic
1064889869 10:20159088-20159110 TGGAGAACATTTGAAGCCAGTGG + Intronic
1064983988 10:21191881-21191903 TGCAGGAGACCTAGAGACAGTGG + Intergenic
1065253801 10:23844369-23844391 TTAAGGAGATTTAAAGACAGTGG - Intronic
1065740201 10:28790675-28790697 TGGAGGGGTTTTAAAGCTAGAGG + Intergenic
1065844133 10:29730744-29730766 TCGAGGAGATTTGGAGTCAGAGG + Intronic
1068800397 10:61133697-61133719 TGGGGGATATTTACAGCCTGGGG + Intergenic
1068978352 10:63035134-63035156 TGGAGAGGATTTGGAGCCACTGG + Intergenic
1069186839 10:65433819-65433841 TTAAGAAGATTTACAGCCAGAGG + Intergenic
1069634413 10:69916754-69916776 TTGGGGAGAGTTAGACCCAGAGG + Intronic
1072108816 10:92298666-92298688 GGGAGGATATTTTGAGCCGGAGG - Intronic
1072441501 10:95460059-95460081 TGGAGGAGAATGAGACACAGGGG + Intronic
1073329963 10:102663894-102663916 TGGAGGAGCTTTAGAAACAGTGG + Intergenic
1073831163 10:107384979-107385001 TGGAGCAGATGGAGAGCCTGGGG + Intergenic
1076388767 10:130079870-130079892 TGCAGGAGATTAGAAGCCAGTGG - Intergenic
1076408259 10:130227714-130227736 AGGAGGAGGTTGAGATCCAGAGG + Intergenic
1076655475 10:132020713-132020735 TGGAGGAGAGTGTGAGCCCGAGG - Intergenic
1078135059 11:8644999-8645021 TGGAGGAGAGTGAGAAGCAGTGG - Intronic
1078748605 11:14138962-14138984 AGGAGGAGAATCAGAGGCAGGGG - Intronic
1078797518 11:14607617-14607639 TGGAAGAGATTTATTGGCAGGGG + Intronic
1079322104 11:19459682-19459704 TGGAGGTGAGTTTGAGACAGAGG + Intronic
1081816789 11:45949401-45949423 TGGAGCAGTCTTTGAGCCAGAGG - Exonic
1085752296 11:79172177-79172199 TGGAGGATCATTTGAGCCAGGGG - Intronic
1087531721 11:99390342-99390364 TGGAGGATAGTTTGAGCCATGGG - Intronic
1087691862 11:101329789-101329811 GGGAGGAGAGTTAGATTCAGGGG + Intergenic
1087798221 11:102476762-102476784 TGGAGGAGAGTTTAAGCCAGTGG - Intronic
1089120456 11:116130831-116130853 TGGAGGAGGGAGAGAGCCAGAGG - Intergenic
1090266558 11:125356842-125356864 TGGAGGCCATTCACAGCCAGGGG - Intronic
1090951128 11:131474359-131474381 AGGAGAAGATGTAGAGCAAGAGG - Intronic
1091447560 12:552755-552777 TGGAGGAGAGTGAGAGCCCGGGG + Intronic
1091871648 12:3896097-3896119 TGGGGGAAATGTAGGGCCAGAGG + Intergenic
1091922924 12:4320458-4320480 CAGTGGAGATTTATAGCCAGGGG + Intergenic
1092936356 12:13367640-13367662 TGGAGGAGTTTTAAAGCCAGAGG - Intergenic
1094580806 12:31732252-31732274 TGGAGGAGATTCTGAGCTAGAGG - Intergenic
1096213383 12:49784056-49784078 TGGATGTTATTTAAAGCCAGAGG - Intergenic
1097447934 12:59696310-59696332 TTGAGGTGATTTAAAGGCAGTGG + Intronic
1098566156 12:71938904-71938926 TGGCGGAGATTGAGAGGAAGGGG - Exonic
1101517320 12:105448863-105448885 TGTAGGATATTTAAAACCAGAGG + Intergenic
1102176104 12:110876169-110876191 TGGAGGATATTTAGGACCATGGG - Intronic
1103923445 12:124411307-124411329 TGCAGGAGATTCAGAGCCAGGGG + Intronic
1105729766 13:23201079-23201101 TGTAGGAGATTTAGAGCCACAGG + Intronic
1105774323 13:23643141-23643163 GAGAGGAGATTTAAAGCCACTGG + Intronic
1106569011 13:30909966-30909988 TGAAGGAGCTTTAGAGCTGGTGG - Intronic
1106575028 13:30966780-30966802 TTGAGAAGTTTTGGAGCCAGGGG - Intronic
1112594794 13:100797678-100797700 AGGCGGAGATTTACAGCCAAAGG - Intergenic
1112714035 13:102163457-102163479 TCGAGGAAGTTTAGAGCAAGTGG + Intronic
1113175996 13:107564704-107564726 TTCAGCTGATTTAGAGCCAGTGG - Intronic
1113311433 13:109137116-109137138 TGGAGGTGAGGGAGAGCCAGAGG - Intronic
1113418155 13:110147398-110147420 TGGAGGGGATGTGGAGCCACTGG + Intergenic
1113432504 13:110262798-110262820 TGAAGGAGACTTAGACCCATTGG - Intronic
1113717145 13:112519319-112519341 TGGAACATATTTAGAGGCAGTGG - Intronic
1113976217 13:114229396-114229418 TGGAGCAGATTTGCAGCCACAGG + Intergenic
1114399399 14:22395591-22395613 TAGAGGAGATTTGGGGGCAGTGG + Intergenic
1114984207 14:28206732-28206754 TGTAGGACATTTGGAGCCAGGGG - Intergenic
1115546710 14:34470684-34470706 AGGAGGAGATGAAAAGCCAGAGG + Intergenic
1117073123 14:52074086-52074108 CAGAGGGGATTTAGAGGCAGAGG - Intergenic
1118365218 14:65089206-65089228 TGGTGGAGAGAGAGAGCCAGAGG - Intronic
1119323915 14:73747328-73747350 TTGAGGAGCTTAAGAGCCTGGGG + Intronic
1119658905 14:76436771-76436793 TGGAGGAGATTCTCAACCAGGGG + Intronic
1120185216 14:81386975-81386997 TGGTGGAATTTTAAAGCCAGAGG + Intronic
1120565823 14:86055469-86055491 TTCTGGAGATTTAGAGCTAGAGG + Intergenic
1120638992 14:86986876-86986898 TAGAGGAGATTTGAAACCAGTGG - Intergenic
1120654041 14:87168534-87168556 TGCAGGAGATTGAGAGAGAGAGG + Intergenic
1120747318 14:88164159-88164181 TGGTGGAGATTCAGAGAGAGAGG - Intergenic
1121050216 14:90815522-90815544 TAGAGGAGAAATAGAGTCAGGGG - Intronic
1121109608 14:91303463-91303485 TGGAGGAGAGGCAGAGCCTGGGG - Intronic
1122358577 14:101141485-101141507 TGGAGAAGACATAGAGCTAGAGG - Intergenic
1125337206 15:38638571-38638593 TGTAAGAGACTTAGAGCCATGGG + Intergenic
1125910030 15:43428330-43428352 TGGATGAGTTATATAGCCAGAGG + Intronic
1126107966 15:45159344-45159366 TGGAGGAGATGGAAAGCGAGTGG + Intronic
1126589441 15:50324479-50324501 TGGAGGGGCTTCAAAGCCAGGGG - Intronic
1126731740 15:51690418-51690440 TGGAGGAGATGAGGAGCCATGGG - Intronic
1128870480 15:71151710-71151732 GGCAGGAGAATTAGAGACAGCGG - Intronic
1129992711 15:79978596-79978618 TGGAGAAGATTTAAAGACACGGG - Intergenic
1131316076 15:91338833-91338855 TGGAGGAGAGTTACTTCCAGAGG + Intergenic
1132389032 15:101425276-101425298 TGCAGCAGCTTTGGAGCCAGTGG - Intronic
1132578050 16:672951-672973 TGGAGGAGACAAAGAGGCAGGGG - Exonic
1132894708 16:2223358-2223380 TGGAGCAGATTGCCAGCCAGGGG - Intergenic
1133302805 16:4793135-4793157 GGGAGGAGGATTAGAGTCAGAGG + Intronic
1135516645 16:23141189-23141211 TGGAGGAGGTGGAGAGGCAGGGG - Intronic
1135626879 16:24003120-24003142 TGGAGGCTAGTAAGAGCCAGAGG - Intronic
1135972810 16:27084695-27084717 TGGAACAGATTCTGAGCCAGGGG + Intergenic
1136341002 16:29643296-29643318 TGGATGATATTTAAAGCCAGGGG - Intergenic
1136479496 16:30532880-30532902 TGGAGCACATTTACAGCCACAGG - Exonic
1136485175 16:30567152-30567174 TGGGGGAGATTTTCAGGCAGAGG - Intergenic
1136555886 16:31007668-31007690 TGGAGTACATTGAGGGCCAGAGG - Intronic
1136690399 16:32024417-32024439 AGGAAGAGATCTGGAGCCAGTGG + Intergenic
1136790988 16:32967981-32968003 AGGAAGAGATCTGGAGCCAGTGG + Intergenic
1136878825 16:33885951-33885973 AGGAAGAGATCTGGAGCCAGTGG - Intergenic
1138434389 16:56989166-56989188 AGGAGGGGACTTAGAACCAGGGG - Intergenic
1138687569 16:58739023-58739045 TGGAGGAGAGAGTGAGCCAGGGG + Intergenic
1140123082 16:72099908-72099930 TGGAGCAGATTCAGAGCTGGAGG + Intronic
1141260114 16:82445038-82445060 TGGAGGAGAAGTACAGACAGGGG + Intergenic
1141282110 16:82638233-82638255 TGGAGCAGAATTAGAGCCTGGGG + Intronic
1142715986 17:1747205-1747227 TGGAGGAGGGTGAGAGCAAGGGG + Intronic
1143627231 17:8117601-8117623 GGGAGGAGTTTAGGAGCCAGGGG + Intronic
1148521150 17:48276173-48276195 TGGAGAATATTTAGAGAGAGTGG - Intronic
1151005181 17:70427392-70427414 TGGAGGTGAAATAGAGTCAGAGG + Intergenic
1151458461 17:74240683-74240705 TGGAGGAGATAAAAAGCCAAGGG + Intronic
1152272729 17:79334493-79334515 AGGAGGAGATTTTGAAACAGTGG - Intronic
1153018781 18:607859-607881 AGAAGAAGTTTTAGAGCCAGTGG - Intronic
1153792843 18:8595647-8595669 AGGAGGAGACCTAGAGACAGGGG - Intergenic
1156239206 18:35235715-35235737 GGGAGGAGATATTGAGTCAGTGG - Intergenic
1156711039 18:39945894-39945916 TGGTGAAGATTTAGAACCACAGG + Intergenic
1157427422 18:47595765-47595787 CAGTGGAGATTTACAGCCAGCGG + Intergenic
1157573493 18:48729151-48729173 TGGGGAAGATTTGAAGCCAGGGG + Intronic
1157575229 18:48739080-48739102 GGGAGAAGACTTAGAGACAGGGG - Intronic
1158763487 18:60419099-60419121 TGGAGGATTTTCAGAGCCAGTGG + Intergenic
1160781552 19:879796-879818 TGGTGGGGATTGACAGCCAGGGG - Intronic
1161288857 19:3482271-3482293 TGGAGAAGATTTGGAGGTAGGGG + Intergenic
1162786236 19:13036741-13036763 TGGTGGCTATTTATAGCCAGAGG - Intronic
1163680157 19:18676602-18676624 TGGAGGTGAATTAGGGCCATTGG - Intergenic
1164855879 19:31520295-31520317 TGTAGGAGATTGAAAGCAAGGGG - Intergenic
1165894476 19:39133454-39133476 GGGAGGAGACTGAGAGCCTGGGG + Intronic
1166819338 19:45567710-45567732 AGGAGGAGTTTGGGAGCCAGTGG + Intronic
1167263233 19:48470422-48470444 TGGTGGAGATTCAGCGCCTGCGG + Exonic
1167694638 19:51007548-51007570 TGGAAGAGAGTGAGAGGCAGGGG - Intronic
1168072591 19:53961228-53961250 AGGAGGGGATTTGGAGGCAGTGG + Intergenic
924966573 2:81927-81949 TAGATCAGATTCAGAGCCAGAGG + Intergenic
926027558 2:9557845-9557867 TGGGGGAGATAAAGAGCCAAAGG + Intergenic
927880884 2:26689270-26689292 TGGAGAAGATAATGAGCCAGTGG + Intergenic
928272733 2:29871587-29871609 AGGAGTAGAATTAGAGCCATTGG - Intronic
929435582 2:41926318-41926340 AGGAGGAGATGTGGAGCCAGCGG + Intergenic
930013867 2:46957599-46957621 TGGAGGGGATTTAGGGACATGGG + Intronic
930629796 2:53740055-53740077 TGGAGGAGATGGACAGCCTGTGG - Intronic
933503743 2:83150421-83150443 TGGAGAAGATTTAGTGGCAGAGG - Intergenic
933847314 2:86336824-86336846 TGCAGGGGATTGAGAGACAGGGG - Intronic
934097751 2:88623023-88623045 TAGAGAGGAATTAGAGCCAGAGG + Intronic
937015114 2:118597921-118597943 TGGAGGAGAAATGGAGGCAGAGG - Intergenic
937162776 2:119781344-119781366 TGGATGAGAATTAGAGGCATTGG - Intronic
938732116 2:134154651-134154673 TGGATGAGATTTAGAGTCTCAGG - Intronic
939145039 2:138403438-138403460 TGGAGAGGATGTAGAGCCATGGG + Intergenic
939468143 2:142584790-142584812 TGGAGGTGATTTATTGCTAGAGG + Intergenic
940468524 2:154063588-154063610 TGGAGGAGATTCAGAATCAATGG + Intronic
940565170 2:155351441-155351463 TGGAGAGAATTTAAAGCCAGTGG + Intergenic
942015277 2:171807153-171807175 AAGAAGAGATTTAGAGCAAGGGG + Intronic
942546901 2:177074799-177074821 TGGAGGAAATTTCAAGCAAGTGG - Intergenic
942715528 2:178887473-178887495 TGGACTAGAGTTAGAGCGAGGGG - Intronic
942817624 2:180070882-180070904 TGGGGGCTGTTTAGAGCCAGAGG + Intergenic
943789573 2:191917209-191917231 AGGAGGAGAGAAAGAGCCAGGGG + Intergenic
944119036 2:196220914-196220936 TGAACGAGAATTAAAGCCAGGGG - Exonic
944448474 2:199816645-199816667 TGGAGGAGAGTTTTAGGCAGAGG - Intronic
945126767 2:206520577-206520599 TGGAGGACAGTTAAAGCCACAGG + Intronic
946039280 2:216769951-216769973 TGGAGGCCATTTGGAGCTAGAGG - Intergenic
946878275 2:224151834-224151856 GGGAGGAGAGTCAGAGTCAGAGG + Intergenic
947390450 2:229634334-229634356 AGGAGGAAATTGAGAGGCAGTGG + Intronic
948330469 2:237160594-237160616 TGGAGGATCTTTAGGGCCTGTGG - Intergenic
1169003340 20:2184595-2184617 TGGTGCAAATGTAGAGCCAGAGG - Intergenic
1169081582 20:2800572-2800594 TGGCGGGGATTGAGTGCCAGGGG + Exonic
1169451880 20:5719034-5719056 TGCAGCAGATTTTGTGCCAGTGG + Intergenic
1169487873 20:6048408-6048430 AGGAGGAGAGTCTGAGCCAGAGG - Intronic
1170375003 20:15690569-15690591 TGGATGATATTTAAAGCCATGGG + Intronic
1171134038 20:22680646-22680668 TAGAGGAAATTTTGACCCAGAGG + Intergenic
1171770534 20:29319566-29319588 TGGAGGAGCTTTAGGACCGGGGG + Intergenic
1171780094 20:29410339-29410361 TGGAGGAGCTTTAGGACCCGGGG - Intergenic
1172650860 20:36500442-36500464 TGGAGGAGGTCTCGAGCCAGGGG - Exonic
1173089736 20:39958878-39958900 TCCAGAACATTTAGAGCCAGAGG - Intergenic
1173882127 20:46423465-46423487 TGGGGGAGACTTTGAGCCACAGG - Intronic
1174919663 20:54688260-54688282 ATGTAGAGATTTAGAGCCAGGGG - Intergenic
1175009336 20:55719186-55719208 AGGAGGAGACTGAGAGCAAGGGG + Intergenic
1175406616 20:58736848-58736870 TGGAGAAGATGTAGAGCAATTGG + Intergenic
1175550864 20:59816586-59816608 TGGAGGATAATTTGAACCAGAGG - Intronic
1176012134 20:62903617-62903639 TGGAGCAGAGTTAGAGACATTGG - Intronic
1178267376 21:31156051-31156073 TGGAGGAGTTTTAAACACAGAGG + Intronic
1179986844 21:44927019-44927041 GGAAGGAGATTCAGAGCCTGAGG + Intronic
1181033733 22:20160184-20160206 TGGAGGAGCTGGAGAGCTAGAGG - Intergenic
1181714259 22:24712759-24712781 GGAAGGAGATTGAGAGACAGAGG + Intergenic
1182909601 22:33971246-33971268 TGGTGGAATTTCAGAGCCAGTGG - Intergenic
1183174338 22:36211860-36211882 AGGAAGAGACTTAGAGCCAAGGG + Intergenic
950106450 3:10391979-10392001 TGGAGGAGGTTGTGAGCAAGAGG - Intronic
953402522 3:42637970-42637992 AAGAGGAGACTTAGATCCAGTGG + Exonic
954672121 3:52296803-52296825 AGGACCAGAGTTAGAGCCAGCGG + Intergenic
956481054 3:69674436-69674458 GGGAGGAGATTTTCAGACAGAGG - Intergenic
956772166 3:72535898-72535920 TGGGGGAGATGCAGAGCCACTGG - Intergenic
956785661 3:72640243-72640265 TGGAGGAAATATAGAGATAGTGG - Intergenic
957463516 3:80555316-80555338 TGGATAAGAGTTAGAGGCAGTGG - Intergenic
958253673 3:91299859-91299881 AGAAGGAGACTTAAAGCCAGTGG - Intergenic
958422487 3:93943833-93943855 TGGGGGAGCTTCTGAGCCAGGGG - Intronic
959380589 3:105636636-105636658 TCCATGAGATTCAGAGCCAGTGG + Intergenic
960303115 3:116028353-116028375 TGTACTAGATTGAGAGCCAGGGG + Intronic
960655245 3:119996253-119996275 TGGAGAAGATGTACAGACAGTGG - Intronic
961005691 3:123403839-123403861 GGGATGAGATTGAGAGCCAAAGG - Intronic
961134379 3:124496319-124496341 TGGAGGATATTGACAGCCAGGGG + Exonic
961647533 3:128400511-128400533 TGGAAGAGAGCCAGAGCCAGGGG - Intronic
962086661 3:132198555-132198577 TGGAGGAGATTTAGTGAGACAGG + Intronic
963871499 3:150420113-150420135 TTGAGGAGATTAAGAGCCCAAGG - Intronic
964225734 3:154399163-154399185 TGGAGGAGGTTGAGAACCACTGG + Intronic
964708045 3:159642002-159642024 TGGAGGAGATTTAGAGCCAGAGG + Intronic
966425113 3:179772618-179772640 GGGAGGAGAATTAGCACCAGTGG - Intronic
967614570 3:191548798-191548820 AGGAAAAGATTTTGAGCCAGAGG - Intergenic
967638123 3:191829575-191829597 TGGAGAAGATGTAGAGAAAGGGG + Intergenic
969665059 4:8552714-8552736 TGGTGGAGAGTCAGAGGCAGTGG - Intergenic
969950966 4:10835173-10835195 TGGAGGAGCCTTAGAGGTAGAGG + Intergenic
970937961 4:21596911-21596933 CCGAGGAGATGGAGAGCCAGTGG + Intronic
971873065 4:32269509-32269531 TGGAGGATAATTTGAGCCTGGGG + Intergenic
975317378 4:72970148-72970170 TGGCTGAGAGTTAGAGCTAGAGG - Intergenic
978970381 4:114796662-114796684 TGAAGGAGATCTAAAGTCAGTGG - Intergenic
979416770 4:120450920-120450942 TGGAGGGGAATAAGAGCTAGAGG + Intergenic
979675301 4:123402786-123402808 TTGAGGGTATTGAGAGCCAGTGG + Exonic
980416441 4:132495460-132495482 TGGGGGAGCTTTTGAGCCAGGGG - Intergenic
982106786 4:152018242-152018264 TGCAAGAGCTTTAGAGCAAGAGG - Intergenic
984474392 4:180217294-180217316 TGGAGGAGTTTTAAAGCTAGAGG - Intergenic
984891485 4:184498074-184498096 TGGAGGAGTGTTAAAGCTAGAGG - Intergenic
988424938 5:31053168-31053190 TGTTAGAGATTTAGAGCCTGTGG - Intergenic
988462573 5:31453691-31453713 TGGAGCAGGTTTAGAGGAAGTGG - Intronic
988551816 5:32207169-32207191 TGTAAGAGATCTGGAGCCAGAGG - Intergenic
989673074 5:43942402-43942424 TGGAGGAGATGTGGAGAAAGGGG + Intergenic
990893386 5:60671699-60671721 TGCAAGAGATTTAATGCCAGGGG - Intronic
992212161 5:74491466-74491488 TGGAGGAGATTTTTAGACAAAGG - Intergenic
993103912 5:83576703-83576725 TGGAGAAGATGTAGAGCAACAGG - Intronic
995457638 5:112368899-112368921 TGGACGAGAATTGGAGACAGAGG - Intronic
997533155 5:134595118-134595140 TGGAGGAGGTTTATAGAAAGGGG - Intergenic
999088118 5:148911278-148911300 TGGAGGTGAATGGGAGCCAGAGG + Intergenic
1000050868 5:157561954-157561976 TCGAGGAGGTTAAGAACCAGAGG + Intronic
1000733566 5:164868702-164868724 TGGTGCAGGTTTAGAGCCAAAGG + Intergenic
1001221347 5:169903502-169903524 TGGAAGAGAGTAGGAGCCAGCGG + Intronic
1002581775 5:180213007-180213029 TGGAGGAGGTCTGGAGGCAGCGG + Intergenic
1006093183 6:31640265-31640287 AGCAGGACATTCAGAGCCAGCGG - Exonic
1006335804 6:33420088-33420110 AGGAGGAGAATAAGAGCCAACGG - Intronic
1008012497 6:46483250-46483272 TGAAGGTAATTTAGATCCAGAGG + Intronic
1009190800 6:60627179-60627201 AGAAGGAGACTTAAAGCCAGTGG + Intergenic
1009936718 6:70242688-70242710 TAGAGGAGAATTAGGACCAGTGG - Exonic
1010516949 6:76784856-76784878 TAGATTAGATTTAGAGACAGAGG - Intergenic
1011855507 6:91684554-91684576 AGGAGGAAAGTTAGAGACAGTGG + Intergenic
1012378899 6:98596295-98596317 GGGAAGAGTGTTAGAGCCAGAGG + Intergenic
1015198822 6:130555000-130555022 TGTAGAAGGATTAGAGCCAGAGG + Intergenic
1015650313 6:135450321-135450343 TGGAGAAGCTTTAGTGGCAGAGG + Intronic
1015954124 6:138582766-138582788 TGGAGGAGATAAAGAGTCAAGGG - Intronic
1018006305 6:159625470-159625492 TGGAGGACAATTAGAGAGAGGGG - Intergenic
1018760758 6:166892382-166892404 TGGAGGAGAGAGAGAGACAGAGG + Intronic
1020117937 7:5486908-5486930 TGGAGGATTTATGGAGCCAGAGG - Intronic
1020619078 7:10496710-10496732 TGGTGGAGATTCCAAGCCAGTGG - Intergenic
1021851769 7:24815498-24815520 AGGAGGCAATTCAGAGCCAGAGG + Intronic
1022208576 7:28186226-28186248 GGGAGGACATTTGAAGCCAGGGG + Intergenic
1023331022 7:39117031-39117053 TTGAGGTGAATTATAGCCAGAGG + Intronic
1028788685 7:94827471-94827493 TGTAGGGAATTTAGAGCCATAGG + Intergenic
1029570847 7:101367962-101367984 TGGAGGAGACTTGTAGACAGTGG - Intronic
1030939724 7:115631022-115631044 TGGGGGAGACTTAGAGCCAGCGG + Intergenic
1032285718 7:130537167-130537189 GGTAGGAGATTCAGAGGCAGAGG + Intronic
1032626328 7:133595199-133595221 TGCAGGAGAATCAGAGCAAGTGG + Intronic
1033500831 7:141947148-141947170 TCAAGGAGATTTAGACACAGAGG - Intronic
1034990218 7:155543216-155543238 TGGAGGAGTCTTGAAGCCAGAGG - Intergenic
1035705825 8:1673849-1673871 TAGAGGAAATTTGGAGACAGAGG + Intronic
1036262725 8:7253295-7253317 TGGGGGAAACTAAGAGCCAGGGG + Intergenic
1036303860 8:7586263-7586285 TGGGGGAAACTAAGAGCCAGGGG - Intergenic
1036314765 8:7711834-7711856 TGGGGGAAACTAAGAGCCAGGGG + Intergenic
1036354717 8:8034255-8034277 TGGGGGAAACTAAGAGCCAGGGG - Intergenic
1039518667 8:38153253-38153275 TGGAGGAGGTTTTGAGGAAGGGG - Intergenic
1041413148 8:57578578-57578600 TTCAGGATATTTACAGCCAGTGG + Intergenic
1042819030 8:72909857-72909879 AGGAATAGATTTAGTGCCAGAGG + Intronic
1043121941 8:76337573-76337595 TGGAGAAGATATAGAGAAAGGGG + Intergenic
1044395918 8:91712126-91712148 TGTAGGAGATGTAGAGCTACTGG + Intergenic
1048423823 8:134304212-134304234 TGGAGGAGATCCAGAGGCTGTGG - Intergenic
1049979123 9:887679-887701 TGGAGGTGATTTAGAGACAGTGG - Intronic
1051868480 9:21709235-21709257 TGGAGGAGGTTAGGAGCCACAGG + Intergenic
1052707502 9:32010908-32010930 TGGAGGAGGCTGAGAGACAGGGG - Intergenic
1052867510 9:33473652-33473674 TGGAGGATGTTTCCAGCCAGTGG - Intronic
1053728766 9:41030923-41030945 TGTAGGAGATTTGGAGATAGTGG - Intergenic
1054699742 9:68401158-68401180 TGTAGGAGATTTGGAGATAGTGG + Intronic
1054991593 9:71333699-71333721 TGTGGGAGACTTAGAGCCAGAGG + Intronic
1055150493 9:72992605-72992627 TGGAGGAGACAGAAAGCCAGTGG - Intronic
1055514560 9:77022263-77022285 CGGAGGTGACTTAGAGCCAAAGG - Intergenic
1056750289 9:89345675-89345697 TGCAGGAGGTGTAGAGCTAGAGG + Intronic
1056899259 9:90583310-90583332 TGGAGGGGTTTTAAAGCTAGAGG + Intergenic
1057453619 9:95187802-95187824 TGTTGGAGATTTTGAACCAGAGG - Intronic
1057474634 9:95388221-95388243 TGTTGGAGATTTTGAACCAGAGG + Intergenic
1057707716 9:97408768-97408790 TGGAGAAGATTTAGAGCAACTGG + Intergenic
1058539620 9:105998164-105998186 TGGAGGAAAATAAGAACCAGTGG - Intergenic
1059168676 9:112103853-112103875 TGGAGGAGAACTAGAGCCCATGG + Intronic
1059304737 9:113345055-113345077 GGGAGGAGATTTCCAGACAGAGG - Intergenic
1059529582 9:115023559-115023581 AGGAGGAGATTTAAAGTCTGTGG + Intronic
1060298203 9:122357263-122357285 TGGAGGAGATTTAGATTAGGGGG - Intergenic
1060929933 9:127482982-127483004 AGGAGGAGACTGAGAGCCTGCGG + Exonic
1061724926 9:132577091-132577113 TGAAGGGGATTTAGATCCATGGG + Intergenic
1062169743 9:135128426-135128448 TGGAGAAGACTCACAGCCAGAGG + Intergenic
1062383372 9:136298367-136298389 GGGAGGAGATGGAGAGCCCGAGG + Intronic
1062547756 9:137071236-137071258 TGGAGGAGGTGTCCAGCCAGGGG - Intergenic
1062560868 9:137141348-137141370 TGGGGCAGATCTAAAGCCAGCGG - Intronic
1062710956 9:137974951-137974973 GGGAGGAGAGTCAGAGACAGTGG + Intronic
1186803842 X:13119686-13119708 TGGAGAACATTTAGCTCCAGAGG + Intergenic
1187785780 X:22884502-22884524 TGAAGGAGATTGAGACCCCGTGG - Intergenic
1190154674 X:47979808-47979830 TGGAGGTTATTTTGAGCCATAGG + Intronic
1190232120 X:48590364-48590386 TGGAAGAGAATTAAAGGCAGAGG + Intronic
1190843961 X:54173897-54173919 TGTAGGAGACCTTGAGCCAGAGG - Intronic
1195906716 X:109851526-109851548 TGGAGGAGATTGGGAGCTATGGG - Intergenic
1196096481 X:111806295-111806317 TGTAAGAGATCTTGAGCCAGAGG - Intronic
1198030652 X:132750718-132750740 TGGTGGGGATTTAGAGACAGGGG - Intronic
1198580427 X:138058431-138058453 TGGGGGAGATCTTGAGCAAGGGG - Intergenic
1199599835 X:149535365-149535387 GGGAGGAGATTTGGAGGAAGAGG - Intergenic
1199650806 X:149944887-149944909 GGGAGGAGATTTGGAGGAAGAGG + Intergenic
1199983335 X:152933179-152933201 TGGAGGAGCTTGAGGGCCAGTGG - Intronic
1201310956 Y:12597854-12597876 TGGAGATGTTTTAGAGTCAGAGG + Intergenic