ID: 964710611

View in Genome Browser
Species Human (GRCh38)
Location 3:159667680-159667702
Sequence CACAGGGAAATGTCTTTTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964710603_964710611 9 Left 964710603 3:159667648-159667670 CCAAGAAGTAGGCACAAAGCCAG 0: 1
1: 0
2: 1
3: 22
4: 268
Right 964710611 3:159667680-159667702 CACAGGGAAATGTCTTTTATGGG 0: 1
1: 0
2: 0
3: 15
4: 234
964710606_964710611 -10 Left 964710606 3:159667667-159667689 CCAGCACGATCCCCACAGGGAAA 0: 1
1: 0
2: 1
3: 9
4: 121
Right 964710611 3:159667680-159667702 CACAGGGAAATGTCTTTTATGGG 0: 1
1: 0
2: 0
3: 15
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964710611 Original CRISPR CACAGGGAAATGTCTTTTAT GGG Intronic
901694043 1:10993293-10993315 CAGAGGGAAAGGACTTTTCTCGG + Intergenic
905364625 1:37443388-37443410 CACTGGGACAGGTCCTTTATAGG - Intergenic
906891338 1:49718794-49718816 TAGAGGGAAATGTTTTTTACAGG - Intronic
914781684 1:150791363-150791385 CACATGGAAATGCCCTTTCTGGG - Intergenic
916887766 1:169086736-169086758 CACAGGGAAAATTCTTCCATGGG - Intergenic
916943695 1:169702549-169702571 TAAAGGGAAATGTCTCTGATAGG + Intronic
918046814 1:180946532-180946554 CTCTGGGGAATGTCTTTTATGGG - Exonic
918976213 1:191489820-191489842 CACAGGTAAATGTGTGTCATGGG + Intergenic
923323883 1:232863077-232863099 CTCAGTGAAATGTCTTGAATAGG + Intergenic
924071152 1:240280621-240280643 CACTGCAAAATGTCCTTTATTGG - Intronic
1064186273 10:13164503-13164525 CTCAGGCAAACGTATTTTATAGG + Intronic
1064485594 10:15785285-15785307 CAAATGGAAATGTCTGTTACAGG + Intronic
1065053659 10:21820788-21820810 CCCAGGGAAATATGTTTTACTGG + Intronic
1068478111 10:57553853-57553875 TACAGAGAAATGTCTTGTAAAGG + Intergenic
1071820213 10:89272143-89272165 CATAGGTAAATGTGTGTTATGGG + Intronic
1072077014 10:91986943-91986965 CGCAGGGAAATGTCTATATTTGG - Intronic
1073430107 10:103480474-103480496 CACAGGGAAATCTGTCTCATAGG - Intergenic
1075260113 10:120955993-120956015 CCAAAGGAAATGTCCTTTATTGG - Intergenic
1075534775 10:123261627-123261649 CACAGGGACAAGGCTTTTAAAGG - Intergenic
1078387714 11:10907664-10907686 CACTGAGAAATCTCTGTTATAGG + Intergenic
1080973543 11:37306780-37306802 CACAGGAATGTGGCTTTTATAGG + Intergenic
1084849645 11:71928573-71928595 CACACGGAAATGTATTTTCCTGG - Exonic
1087639552 11:100741686-100741708 CACAGAGAAATCTGCTTTATAGG - Intronic
1088535453 11:110855340-110855362 CAGAAGAAAATGTATTTTATAGG - Intergenic
1088567322 11:111185736-111185758 CACTGGGCACTTTCTTTTATTGG - Intergenic
1090089260 11:123680099-123680121 CAGAGGTAACTGTCTTGTATGGG + Intergenic
1090384083 11:126346521-126346543 CGCAGGGACATGGCTTGTATGGG + Intergenic
1090823851 11:130369508-130369530 CACAGGGACATGTCCATTCTAGG + Intergenic
1091525965 12:1301494-1301516 AACAGGATCATGTCTTTTATAGG + Intronic
1092724463 12:11471696-11471718 CACTGGCAAATGTCTGCTATGGG + Intronic
1093037197 12:14343495-14343517 CACAGGTAAATGTGTGTCATGGG + Intergenic
1094805953 12:34092440-34092462 CACAGGAAAAAGTATTTCATAGG + Intergenic
1096758884 12:53823239-53823261 TGCAGGGAGATGTCATTTATGGG + Intergenic
1097575280 12:61385030-61385052 GACATGGACATGTCTTTTTTTGG + Intergenic
1097597790 12:61655229-61655251 TCCATGGAAATGTCTCTTATTGG - Intergenic
1097892361 12:64790865-64790887 CAAAGAGAATTGTCTTTTAGTGG - Intronic
1099054254 12:77818408-77818430 AACAGGGAAATTGTTTTTATGGG + Intergenic
1099147342 12:79063487-79063509 CACAGTGGAATGTCTTTGAAAGG - Intronic
1099280292 12:80636127-80636149 TGCAGGGAAATGTGTTTTCTTGG + Intronic
1101308720 12:103556698-103556720 AACAGGGACATGTCTTTTTGGGG - Intergenic
1105425430 13:20290929-20290951 CACTGGGCAAGGTCTTTTGTGGG - Intergenic
1106780566 13:33055258-33055280 CACAGGGAAATGTCCCTTCTAGG - Exonic
1107404637 13:40101132-40101154 CACAGGCAAATGTCATAAATTGG - Intergenic
1107610088 13:42104277-42104299 CCCAGGGAATTGTCTTTGCTTGG + Intronic
1109568127 13:64146348-64146370 CACAGGGAAAATTCTTTTAGAGG + Intergenic
1109635860 13:65115032-65115054 CACAGGTAAATGTGTGTCATGGG - Intergenic
1110283447 13:73721890-73721912 CCAAGGGAAATGTTTTTTAAAGG + Intronic
1111549747 13:89791433-89791455 CACCGGGAAATTTTTTTTAAAGG + Intergenic
1111737325 13:92159165-92159187 ATCAGGGAAATGTAATTTATAGG - Intronic
1112065567 13:95789203-95789225 CATAGGTAAATGTGTGTTATGGG + Intronic
1113022199 13:105899886-105899908 CACAGGTAAATGTGTGTAATGGG - Intergenic
1115370506 14:32608630-32608652 CACAGGGAAAAGTCATTGACAGG + Intronic
1116616941 14:47151804-47151826 CACATAGAAATATATTTTATAGG - Intronic
1120507878 14:85375867-85375889 AACAAGGAAATGTCATTAATTGG + Intergenic
1123879618 15:24664894-24664916 CATAGGCATGTGTCTTTTATGGG - Intergenic
1125209658 15:37198306-37198328 CACAAAGAAAAATCTTTTATAGG + Intergenic
1127148029 15:56045285-56045307 AACTGGGAAATCACTTTTATAGG - Intergenic
1131732611 15:95297768-95297790 CACTGCAAAATGTCTTTTAGAGG - Intergenic
1132138174 15:99364986-99365008 AATAAGGAAATGTCTTCTATAGG - Intronic
1138665051 16:58559638-58559660 GACAAGCAAATGCCTTTTATAGG + Intronic
1138825651 16:60316130-60316152 CAAAGGGAAATTTCTTTTTAGGG - Intergenic
1139171432 16:64634632-64634654 CACAAGAGAATGTCATTTATTGG - Intergenic
1139368854 16:66452426-66452448 CACAGGGCCATGCCTTTTGTAGG + Intronic
1139821851 16:69727117-69727139 CCCAGGGAAGTGTGTTGTATGGG - Intergenic
1141667347 16:85472725-85472747 CACCGGGAAATGACTTTAAACGG + Intergenic
1145365952 17:22267124-22267146 CACTGGGAGATGTCCTTTCTTGG - Intergenic
1148214489 17:45826989-45827011 CCCAGGGACATTTCTTTTTTTGG - Intronic
1153386937 18:4509563-4509585 CACACAAAAATGTCTTTTTTAGG - Intergenic
1153468008 18:5411188-5411210 CACAGGCATATATTTTTTATGGG + Intronic
1156617942 18:38810244-38810266 CACAGGTAAATTGCGTTTATGGG - Intergenic
1157228694 18:45892708-45892730 CAAAGGCAAATATATTTTATGGG - Intronic
1159809177 18:72995837-72995859 CCCAGGGAAATGTGTTTCTTGGG - Intergenic
1159866592 18:73713144-73713166 CAAAGGGAAATATCTCATATTGG - Intergenic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1163935925 19:20443359-20443381 TACAGAGAAATTTCTTTTAAGGG + Intergenic
1164398801 19:27888752-27888774 CACTGGGAAATGATCTTTATCGG - Intergenic
1164689368 19:30198517-30198539 CACATAGATATGTATTTTATTGG - Intergenic
1202674106 1_KI270710v1_random:24790-24812 AACAGAGAAATGTCTGATATTGG - Intergenic
926108135 2:10165297-10165319 CAAAGGGAAACGTGTTTGATGGG - Intronic
927339597 2:21967009-21967031 AACAGTCAAATGTCTTTAATGGG - Intergenic
928125016 2:28609370-28609392 CAAGGGGAAATGTATTTTAAAGG - Intronic
928745042 2:34402672-34402694 TACAGGGAAAAGTCATTGATTGG - Intergenic
929198168 2:39207719-39207741 AACAGGAAAATTTATTTTATAGG + Intronic
930405366 2:50948707-50948729 CACAGGCAAATGTCTCTTTCAGG + Intronic
930604394 2:53477682-53477704 ACCAGGGAAATGTCTTTGCTGGG - Intergenic
934918234 2:98318669-98318691 CATAGGTAAATGTGTTTCATGGG - Intergenic
935060226 2:99601028-99601050 CACAGGGAAAGGGGTTTTATGGG - Intronic
935538437 2:104321752-104321774 GACAGGGAAATGTTTATTTTGGG + Intergenic
935985131 2:108665152-108665174 CACAGGGAAATGTCTGAGAAAGG + Intronic
936137567 2:109908796-109908818 CACAGGGAAATGTCTGAGAAAGG + Intergenic
936207130 2:110462689-110462711 CACAGGGAAATGTCTGAGAAAGG - Intronic
937440223 2:121908846-121908868 CATAGGGAAGTGTCTATTCTGGG - Intergenic
937470403 2:122169464-122169486 CAGTGGGCAATGTCTTTTACAGG - Intergenic
939515280 2:143159129-143159151 AACAGGAAAATATTTTTTATTGG + Intronic
939717520 2:145603157-145603179 GAAAGGGAAATATCTTTTGTAGG + Intergenic
941617005 2:167732045-167732067 CACATAGAAATGTATTATATAGG - Intergenic
943949051 2:194105882-194105904 GACAGGTAAATATTTTTTATAGG - Intergenic
945185834 2:207138606-207138628 CCCATGGAAATGTATTTTAGTGG + Intronic
945199414 2:207266258-207266280 CACAGGGATATATGTTTTAAGGG + Intergenic
945330068 2:208529353-208529375 AACAGTGAAATATCTTTTAAAGG - Intronic
947223282 2:227814963-227814985 CAAAGGGAAATATGATTTATAGG - Intronic
947459903 2:230294953-230294975 CAGAGGCAAATGTATTTTATAGG + Intronic
947849825 2:233276845-233276867 CACAGGGAAATTTCTAATACTGG - Intronic
948960837 2:241335329-241335351 CACAAGGAAAACACTTTTATGGG + Exonic
1168897058 20:1331010-1331032 CACCTGGAAATATCTTTCATTGG + Intronic
1169023687 20:2349394-2349416 CACATGGAAATGCCTTATGTGGG + Intergenic
1174019229 20:47516419-47516441 CACAGGGAAGAGAATTTTATTGG + Intronic
1174957247 20:55112131-55112153 CACAGGTAAATGTGTGTCATGGG - Intergenic
1175634379 20:60568461-60568483 GACAGGGAAATGTATTTTAAGGG - Intergenic
1177056022 21:16301990-16302012 CACAGTGACATGTATTTTCTTGG + Intergenic
1177115253 21:17077781-17077803 CATATGGAAATTTCTTTAATTGG - Intergenic
1177706261 21:24709278-24709300 TCCATGGAAATTTCTTTTATAGG + Intergenic
1177801393 21:25832199-25832221 GACAGGGAACTGTGTTTTATAGG - Intergenic
1177811341 21:25927807-25927829 CAAAAGGAAATGTGTTTTAAAGG - Intronic
1181867253 22:25868583-25868605 CACTGGGAAATATCATTTCTTGG + Intronic
949113307 3:288739-288761 CACAGGGAATTGTCTGTGAAGGG + Intronic
949339832 3:3017570-3017592 CACAGGTAAATGTCCTTTAAAGG - Intronic
951128808 3:19016885-19016907 ATCTGGGAAATGTGTTTTATAGG + Intergenic
951336224 3:21425536-21425558 CACAGTGAAATGTTTTATTTTGG + Exonic
952228885 3:31408486-31408508 CCCAGAGAAAAGTCTTTTTTGGG + Intergenic
954617744 3:51978227-51978249 CACAGGGGAATGTGTTTGCTGGG - Intronic
954620921 3:51995004-51995026 CACATGGAAGTGTCTTTTCTTGG - Intronic
957337191 3:78846427-78846449 CACAGGGAAATGTCTAAGAGTGG - Intronic
959339092 3:105105532-105105554 GAAAGTAAAATGTCTTTTATTGG - Intergenic
960270362 3:115667542-115667564 CACTGCGAAGTGTCTTTTGTTGG - Intronic
961647893 3:128402109-128402131 CACAGGGGGATGTCTATTACAGG - Intronic
962223805 3:133587277-133587299 CAGATGGAAATGTGTTTTTTGGG + Intronic
962913386 3:139875764-139875786 CATAGGTAAATGTGTGTTATGGG - Intergenic
964449943 3:156802443-156802465 CACAGGGAAAGGTGCTTTTTAGG - Intergenic
964710611 3:159667680-159667702 CACAGGGAAATGTCTTTTATGGG + Intronic
964928419 3:161984878-161984900 CTCATGAAAATATCTTTTATAGG + Intergenic
965182148 3:165417562-165417584 CACAGGGACAGGTCTTTCTTGGG + Intergenic
965914940 3:173832477-173832499 CAAAGAGAAATCTCTTTAATTGG + Intronic
967044135 3:185720923-185720945 CACAGGGAAACGTCCTTCAAGGG + Intronic
968327809 3:197835586-197835608 AATAAGTAAATGTCTTTTATTGG + Intronic
970321153 4:14876874-14876896 CACAGGTAAATGTGTGTCATGGG - Intergenic
971751407 4:30654315-30654337 CATAGAGCAATGTCATTTATGGG - Intergenic
972651915 4:41026022-41026044 CACAAGATAATGTCTTTTGTAGG + Intronic
972969962 4:44561978-44562000 TACAGGGAAAGGCCTTTGATTGG - Intergenic
973997883 4:56478513-56478535 TAAAAGGAAGTGTCTTTTATAGG + Intronic
974581464 4:63808919-63808941 CATAGGTAAATGTGTTTCATGGG + Intergenic
975139523 4:70905151-70905173 CACATGGAAATGATTATTATTGG + Intronic
975573642 4:75841998-75842020 CACAGGGAAATGTTTGAAATAGG + Intergenic
977386241 4:96343163-96343185 CAAATGGAAATTTCCTTTATAGG - Intergenic
977659931 4:99573039-99573061 AATAGTGATATGTCTTTTATTGG + Intronic
978833684 4:113120655-113120677 CACAGGTAAATGTGTATCATGGG + Intronic
979128950 4:117014970-117014992 CTTAGGGAAATGTATTTCATTGG + Intergenic
979224540 4:118269327-118269349 CAAAGGTAAATGTGTTTCATGGG + Intergenic
979693530 4:123585941-123585963 CACAGGGAGATTTGTTTTAGAGG - Intergenic
980477389 4:133334965-133334987 CACAGGTAAATGTGTATAATGGG + Intergenic
981541289 4:145849288-145849310 CACAGGAAAATGTCAATTATTGG - Intronic
981886744 4:149684346-149684368 CTCAAGGAAATTTCTTTTGTTGG + Intergenic
981995865 4:150974753-150974775 CACAGGGATGAGTCTTGTATTGG - Intronic
982759500 4:159264486-159264508 CACATGGATATGTGTTTTGTGGG + Intronic
983596958 4:169480102-169480124 TACAAGGAAATGACATTTATGGG + Intronic
984642321 4:182181301-182181323 CACAGTCAAATGCCTTTTAAGGG - Intronic
985124948 4:186683721-186683743 CACAGGGAGAAGTCGTGTATTGG - Intronic
987920650 5:24275868-24275890 AACTGGGAAATGACTATTATTGG + Intergenic
990424159 5:55668716-55668738 ATCAGGGAAATATCTTTTTTAGG - Intronic
990729815 5:58796067-58796089 CACAGGGAAAGGTCATCTGTTGG - Intronic
992405984 5:76458285-76458307 CATATGGAAACGTCCTTTATAGG + Intronic
996136043 5:119843552-119843574 CAGAAGGATATGTCTTTCATTGG - Intergenic
996767729 5:127051446-127051468 CACTGGGCAATGCCATTTATAGG - Intronic
997212330 5:132084647-132084669 CCCAAGGAAAAGTCTTTCATTGG + Intergenic
997524616 5:134544331-134544353 CACAGGAAGGTGTCTGTTATGGG + Intronic
998249657 5:140543424-140543446 CCCAGGGTCATGCCTTTTATTGG - Intronic
998495146 5:142582021-142582043 CTCAGGGATATGCCTTTTGTTGG + Intergenic
998817980 5:146032726-146032748 CAGAGAGAAATGTGATTTATGGG - Intronic
999227983 5:150043261-150043283 CACAGGGAAAAGTAATCTATGGG - Intronic
1000314787 5:160079318-160079340 CCCAGTGAAATGTATTTTGTAGG - Intronic
1000326610 5:160177139-160177161 CACAGGGACAGGTCTTTTCCTGG + Intergenic
1002675565 5:180909576-180909598 CACAGTGAAATGTATTTGACGGG + Intronic
1005234864 6:23747964-23747986 CACAGTAAAATGTCTTGTGTAGG - Intergenic
1006311376 6:33263561-33263583 CAAAGGGAAATGTCTAGTTTGGG + Intronic
1008169891 6:48191005-48191027 CACAGGTAAATGTCATTTTTTGG + Intergenic
1009731425 6:67612940-67612962 AACAGGAAAATATCTGTTATGGG - Intergenic
1010570691 6:77470695-77470717 CAAAAGGAAATGTATTTTTTAGG + Intergenic
1010698273 6:79005988-79006010 CACAATGAAATGTGTTATATAGG - Intronic
1011192411 6:84744633-84744655 CAGAGGGAATTGTCAATTATAGG - Intronic
1012347150 6:98204133-98204155 AACAGGGGAATGACTTTTAATGG - Intergenic
1012619529 6:101323887-101323909 CATAGGTAAATGTGTTTTATGGG - Intergenic
1012818226 6:104051915-104051937 CAGAGGGAAATGGTTTTAATTGG + Intergenic
1013824097 6:114190496-114190518 CCCAGTGAAATGACTTTTAAAGG - Intronic
1014820453 6:125983235-125983257 CTCAAGAAAATCTCTTTTATGGG + Intergenic
1014953690 6:127590424-127590446 CACAGGGAAATCTTTATTTTTGG - Intronic
1015722843 6:136263234-136263256 ATCTGGGAAATGTGTTTTATGGG - Intronic
1016024994 6:139277891-139277913 CAAGGGGAAATGTCTGTTCTTGG - Intronic
1016681298 6:146832516-146832538 CAATGGTAAATGTCTTTTCTTGG + Intergenic
1016744966 6:147569496-147569518 AGATGGGAAATGTCTTTTATAGG + Exonic
1020511584 7:9063423-9063445 CAGAGGGGCATCTCTTTTATAGG + Intergenic
1021274831 7:18637534-18637556 CAGAGGGAAATGTGATTTAATGG + Intronic
1025791057 7:64687019-64687041 TACAGAGAAATGTGTTTTAGGGG + Intronic
1026292845 7:69024462-69024484 CAGAAGGAAATGCATTTTATGGG - Intergenic
1028610801 7:92709346-92709368 CACAGGGAAAGGTGTGTTCTAGG - Intronic
1028999056 7:97133889-97133911 AACAATGAAATGTCTTTTAAAGG - Intronic
1029065849 7:97847498-97847520 CTAAGGGAAAGGGCTTTTATTGG - Intergenic
1029795031 7:102885293-102885315 CACAAGGAAATTTGTTTTAATGG - Intronic
1029855710 7:103514837-103514859 GACTGGGAAATGTCATTTGTTGG + Intronic
1031438079 7:121757578-121757600 CACTGAGAAATGTCTTTCCTAGG + Intergenic
1032865898 7:135924176-135924198 CACAGTGAAATGTCTATTGAGGG + Intergenic
1033798602 7:144875741-144875763 CACAGGTAAATGTGTGTCATGGG + Intergenic
1033881513 7:145889606-145889628 CACATGGAAATGTCTCAGATAGG + Intergenic
1034210065 7:149355764-149355786 CACAGGGAAAGGTTGTTAATTGG - Intergenic
1034687596 7:152986683-152986705 TACAGGGAGATGTTCTTTATAGG - Intergenic
1036290021 8:7479332-7479354 CACGAGGAAAAGGCTTTTATAGG + Intergenic
1036331455 8:7832191-7832213 CACGAGGAAAAGGCTTTTATAGG - Intergenic
1036987514 8:13552695-13552717 TACAGGAAAATGTTTTTTAAAGG + Intergenic
1037004859 8:13765689-13765711 CAAAATGAAATGTCTTTTTTTGG - Intergenic
1037359930 8:18062423-18062445 CACTGAAACATGTCTTTTATAGG - Exonic
1037521255 8:19682442-19682464 CAGAGGGAAGTTTCCTTTATTGG - Intronic
1039104108 8:33971766-33971788 CAAAGGGAAATCTATTATATAGG + Intergenic
1040351759 8:46575987-46576009 CTAAGGGAAAAGGCTTTTATTGG - Intergenic
1042405967 8:68406027-68406049 CACAAGGAATTTTCATTTATAGG + Intronic
1042811660 8:72832333-72832355 TTCAGGGAATTATCTTTTATTGG - Intronic
1043521229 8:81047667-81047689 CAGAGCTAAATGTCTTTTAGAGG + Intronic
1045030350 8:98129027-98129049 CACAGGCAATTGGCTATTATGGG + Intronic
1045859001 8:106794659-106794681 AACATGGACATGTCTTTTAGGGG + Intergenic
1045987935 8:108271297-108271319 AACATGGACATGTCTTTTAGGGG + Intronic
1049060852 8:140275030-140275052 CAAAGGGGAATGTATTGTATAGG - Intronic
1049628812 8:143639938-143639960 CACTAGGAAATGTCATTTATGGG + Intronic
1053566583 9:39258751-39258773 CACACAGAAATGGCCTTTATAGG + Intronic
1053729430 9:41037851-41037873 TACAGTGAAATGCATTTTATGGG + Intergenic
1053832360 9:42096611-42096633 CACACAGAAATGGCCTTTATAGG + Intronic
1054130563 9:61360261-61360283 CACACAGAAATGGCCTTTATAGG - Intergenic
1054598188 9:67090809-67090831 CACACAGAAATGGCCTTTATAGG - Intergenic
1056241641 9:84653706-84653728 TACAGGGCAGTGCCTTTTATAGG + Intergenic
1058448839 9:105077628-105077650 CACAAGGAAATTTCTTGTAAGGG + Intergenic
1059027570 9:110651912-110651934 CACAGAGAAATTTATTTTAATGG + Intergenic
1060651556 9:125331720-125331742 CACAGTGAACTGGCTTATATTGG + Intronic
1185999411 X:4991978-4992000 CAGAGGGAAATTTTTTTTAATGG - Intergenic
1186150323 X:6667847-6667869 CACTGGGCAATGTGTTCTATGGG - Intergenic
1186487971 X:9948447-9948469 CACTGGAAAACTTCTTTTATGGG - Exonic
1187981314 X:24760559-24760581 GACAGGGATGTGTCTTTAATGGG - Intronic
1188272754 X:28161053-28161075 AACAGGGGAATGTTTTGTATAGG - Intergenic
1188611289 X:32101384-32101406 CACAGGGAAAAGTCATGTAGTGG + Intronic
1190488917 X:50961199-50961221 GAAAGGGAAATGACTTTAATGGG + Intergenic
1193278453 X:79619969-79619991 AATCGGGACATGTCTTTTATGGG + Intergenic
1197699969 X:129591963-129591985 CACAGGGAAATACCTTTCCTGGG + Exonic
1198343210 X:135734701-135734723 CCCAGGGACTTGTCTTTTATAGG + Intergenic
1198344779 X:135748594-135748616 CCCAGGGACTTGTCTTTTATAGG - Intergenic
1200703613 Y:6422916-6422938 CACTGGGAGATGTCTGTTCTTGG + Intergenic
1200708105 Y:6459967-6459989 CACTGGGAGATGTCTGTTCTAGG + Intergenic
1200920452 Y:8608451-8608473 CACTGGGAGATGTCTGTTCTTGG - Intergenic
1200921690 Y:8618941-8618963 CAATGGGAGATGTCTGTTATTGG - Intergenic
1201026007 Y:9704741-9704763 CACTGGGAGATGTCTGTTCTAGG - Intergenic
1201030498 Y:9741791-9741813 CACTGGGAGATGTCTGTTCTTGG - Intergenic
1201309479 Y:12583040-12583062 CACAGGTAAATTTCTCTCATGGG - Intergenic
1201482759 Y:14457794-14457816 CACAGGAAAGTGTCTGATATGGG + Intergenic
1202176185 Y:22101014-22101036 CACTGGGAGATGTCTGTTCTTGG + Intergenic
1202215176 Y:22485370-22485392 CACTGGGAGATGTCTGTTCTTGG - Intergenic