ID: 964711742

View in Genome Browser
Species Human (GRCh38)
Location 3:159678211-159678233
Sequence GTGAAAAATAGGACAATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964711742 Original CRISPR GTGAAAAATAGGACAATTTA TGG (reversed) Intronic
902857155 1:19216068-19216090 TTTAAAAGTATGACAATTTATGG + Exonic
907022013 1:51076348-51076370 GTGTTAAATAGGAAAATATAGGG + Intergenic
907164214 1:52395973-52395995 GTGATAAAAATGATAATTTATGG - Intronic
908604107 1:65775659-65775681 GTGAAAAATATGAGAATATCTGG - Intergenic
909183892 1:72460765-72460787 GTGAAAACTGGGACAATAAATGG - Intergenic
909426476 1:75531207-75531229 GAGATAAATAGGTCTATTTATGG - Intronic
910130284 1:83896352-83896374 GTGAAATATAGCACATTTGAAGG + Intronic
910419903 1:87047887-87047909 TTGAAAAATAAGAAAATTGAAGG - Intronic
911609698 1:99947202-99947224 GTGAACATTAGGATATTTTATGG - Intergenic
911754863 1:101541856-101541878 GTGAAAAAGAAAACAGTTTATGG + Intergenic
911818380 1:102384328-102384350 GAGAAAAACAAAACAATTTAAGG - Intergenic
912824980 1:112897414-112897436 GACAAAAATCGGACAAGTTAAGG + Intergenic
913311425 1:117499961-117499983 GTGATAAATAGCACTAATTATGG + Intronic
914676824 1:149912477-149912499 GTGAAAAACAGGAGAGTTTTTGG - Intronic
914926634 1:151894431-151894453 GTTAATAATAGGAGAAATTAGGG + Intronic
915364870 1:155309448-155309470 GTGTAAAATAGGATGACTTAAGG + Intronic
917262776 1:173187943-173187965 CTGAAAAAGAGGACCACTTATGG + Intronic
917592378 1:176489725-176489747 GTGAAAAATTGGACAAGCTCAGG + Intronic
918911525 1:190578302-190578324 GTGAAAAATCGGGCAGTTTTCGG + Intergenic
919075979 1:192813505-192813527 GTGACAAATAGGATGATATATGG - Intergenic
919240026 1:194902786-194902808 ATGAAATATAGGACAGTTAATGG - Intergenic
921458862 1:215405270-215405292 AGGAAATATAGTACAATTTAAGG + Intergenic
921751842 1:218803692-218803714 TTGAAAAACAGCATAATTTAAGG - Intergenic
922381293 1:225030327-225030349 AAGAAAATTAAGACAATTTATGG - Intronic
923178086 1:231487893-231487915 GTTAATAATAGGACAAACTATGG - Intergenic
923914152 1:238483746-238483768 TTGAAATAAAGGAAAATTTATGG - Intergenic
1064196721 10:13249679-13249701 GTGAAAAACAGCCCAACTTACGG + Intergenic
1065034426 10:21623033-21623055 GAGACACATAGGACAAGTTATGG + Intronic
1065214070 10:23433105-23433127 GAAAAAAATAGGACAAAGTATGG - Intergenic
1065920498 10:30388446-30388468 GTGAGCAACAGGACAACTTAGGG - Intergenic
1066173378 10:32876995-32877017 GGGAAAAATAGGAAAATTTAAGG - Intronic
1068373491 10:56149936-56149958 GTGAGGATTATGACAATTTAAGG + Intergenic
1068755736 10:60650601-60650623 GTGAAAAATCTGAAATTTTATGG + Intronic
1069430629 10:68331565-68331587 GTGAAAAATAGGAGTGTTTCTGG - Intronic
1070495955 10:77022732-77022754 GTGAAAAAAAGGAAAACTTATGG - Intronic
1070849750 10:79553859-79553881 GAGAAAAATATGACAAGTTCAGG + Intergenic
1072850527 10:98886172-98886194 CTGAAATATATGAGAATTTATGG - Intronic
1074548631 10:114422657-114422679 TTGAAAATTAAGACAAATTAGGG + Intergenic
1076069683 10:127477797-127477819 ATTAAAAATAGGACACTATATGG - Intergenic
1076283106 10:129267172-129267194 TTGAAAAATAGTGCAATTTTTGG - Intergenic
1078302986 11:10152586-10152608 GAGGAAATTAGGACAATATATGG - Intronic
1078716120 11:13840403-13840425 GTGAAAATTAGGACCATGTTGGG - Intergenic
1079632231 11:22692185-22692207 GTGAAAAATTGGGCAAGATAGGG + Intronic
1079754313 11:24236754-24236776 ATGAAAAATATTATAATTTATGG + Intergenic
1080105025 11:28502797-28502819 GTGAAAAAGAGCAGAACTTATGG + Intergenic
1080313215 11:30918994-30919016 TTGAAAAATGGGATGATTTAAGG - Intronic
1080492801 11:32784352-32784374 GGGAAAAATAAGACAATCCAAGG + Intronic
1080987019 11:37481042-37481064 GGGAAAAATATGAAAATGTAAGG - Intergenic
1081144936 11:39551242-39551264 GTGAAAAGGAGAATAATTTACGG - Intergenic
1081961049 11:47137808-47137830 ATGAAAAAAAGGAGCATTTAGGG + Intronic
1083375161 11:62214507-62214529 GAGAAAAGTTGCACAATTTAAGG - Intergenic
1085327407 11:75617629-75617651 GTGCAAAATAAGAAAACTTACGG + Intronic
1086000722 11:81982384-81982406 AAGAAAAATAATACAATTTATGG - Intergenic
1086213035 11:84343726-84343748 GTAAAATATAGAAAAATTTAAGG + Intronic
1086851409 11:91813549-91813571 GTGAAAAACAGAACAGTTTTTGG + Intergenic
1087479270 11:98679378-98679400 GTGAAAAAAAAAAAAATTTAAGG - Intergenic
1087904969 11:103684942-103684964 GTGAGAAAGAGGCAAATTTAAGG - Intergenic
1088193147 11:107248572-107248594 GTGGAAGATAGCACAATGTAAGG + Intergenic
1092933343 12:13337880-13337902 CTGAAAGATCGGGCAATTTATGG + Intergenic
1093556783 12:20485647-20485669 ATGAAAACTAGCACATTTTAAGG + Intronic
1094349529 12:29508557-29508579 GTGAAGAAAAGGGCAATTTGAGG - Intronic
1095491466 12:42739025-42739047 GTGAAAACAAAGACAATGTAAGG - Intergenic
1095645405 12:44539767-44539789 GTGTAAAATATAACAATTTATGG - Intronic
1096896999 12:54830997-54831019 CTGGCAAATAGGACAAATTAAGG - Intronic
1096990160 12:55794903-55794925 GAGAAAAAAAAGTCAATTTATGG + Intronic
1097131594 12:56815054-56815076 GTCAAAACCAGGACAATTTTGGG + Intergenic
1097681827 12:62656515-62656537 GTCAAAAATAAGTCAATTTCAGG + Intronic
1098532658 12:71558290-71558312 GGGAAAAAAAAGACTATTTATGG - Intronic
1098623222 12:72631217-72631239 GTGAAAAATTGAAATATTTAAGG - Intronic
1099241418 12:80143504-80143526 ATGAAAAATGGGAGAAATTAAGG - Intergenic
1101314742 12:103618840-103618862 GTGAGAATTATTACAATTTAAGG - Intronic
1102612384 12:114123763-114123785 GTGAAAAACCTTACAATTTAGGG + Intergenic
1105341963 13:19535397-19535419 GTGAAAATTAGAAAAATTTAAGG + Intronic
1106500772 13:30326689-30326711 ATGAAAAATAAGAGAATTTTTGG + Intergenic
1106776280 13:33013248-33013270 GAGAAAAATATGACAATATCTGG - Intergenic
1106810790 13:33357051-33357073 GTAAATAATAGGAAAGTTTAGGG + Intergenic
1106932968 13:34686889-34686911 GTTAAAAACAGGAGAAGTTAGGG + Intergenic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108620172 13:52174731-52174753 GTGAAAATTAGAAAAATTTAAGG + Intergenic
1108634823 13:52322958-52322980 CTTAAAAATAGGACATTTTTAGG - Intergenic
1108652981 13:52500230-52500252 CTTAAAAATAGGACATTTTTAGG + Intergenic
1108666570 13:52638344-52638366 GTAAAAATTAGAAAAATTTAAGG - Intergenic
1109073526 13:57803109-57803131 GTGAAAAATACCACATTCTATGG - Intergenic
1109676472 13:65682195-65682217 GTGTAAAGAAGGATAATTTATGG - Intergenic
1109818206 13:67616057-67616079 AGGAAAAATAGTGCAATTTAAGG - Intergenic
1109866927 13:68276676-68276698 GGGAAAAAGAGGAAAATCTAGGG + Intergenic
1110351640 13:74515484-74515506 CAGAAAAATAGGAGATTTTATGG + Intergenic
1110788615 13:79562037-79562059 GTGAAATATGGGACTATGTAAGG + Intergenic
1110923435 13:81119023-81119045 TTGAAAAATATGACAACCTATGG - Intergenic
1111405594 13:87800950-87800972 ATAAAAAATAAGACAATTCAAGG + Intergenic
1111822800 13:93233892-93233914 GTGAAAAAGGGAACAACTTACGG - Intronic
1112101337 13:96192880-96192902 GTGAAAAATGGTGCAATATAAGG + Intronic
1112905159 13:104408568-104408590 TTGAAAAATAGAACATTTTTGGG + Intergenic
1114726540 14:24943504-24943526 CTGAAAAATGTGAAAATTTAAGG - Intronic
1114896753 14:27000593-27000615 TTAAAAAATAGGAAAAATTAAGG - Intergenic
1114973893 14:28069794-28069816 GTGAGAAAGAGCCCAATTTAGGG + Intergenic
1115012151 14:28561833-28561855 GTGAAATATGGGGCATTTTAGGG + Intergenic
1115512256 14:34149271-34149293 CTTAAAATTAGGACAATCTAAGG - Intronic
1117531459 14:56664410-56664432 ATGAAAAACAGGAAACTTTAAGG + Intronic
1119110836 14:71972412-71972434 GATATACATAGGACAATTTAAGG - Intronic
1120165688 14:81196439-81196461 ATGAAAAATAAAACATTTTAAGG - Intronic
1120423730 14:84320615-84320637 CTGAAAAAAGGGACAATTTGAGG - Intergenic
1122335905 14:100982906-100982928 GAGAAAAATAGGACACATTCTGG + Intergenic
1122944982 14:105003850-105003872 AAAAAAAAAAGGACAATTTAGGG + Intronic
1124037646 15:26070877-26070899 GTGGAAATTCGGACAATATAAGG + Intergenic
1124099190 15:26677625-26677647 GGGAAAAGAAAGACAATTTACGG + Intronic
1125259925 15:37811787-37811809 GAGACAGATAGTACAATTTAAGG + Intergenic
1126176308 15:45739013-45739035 GTGAAAAATACGGCAAATTATGG + Intergenic
1126491697 15:49244023-49244045 GAGAAAAACAGGAAAATTTATGG + Intronic
1127833796 15:62773693-62773715 GTGAAAAATAGCACAAGCTTTGG + Intronic
1129484760 15:75859598-75859620 GTGAGAAATTGGACAATGTCTGG + Intronic
1129959610 15:79671946-79671968 CTGCAAAAGAGGACAACTTATGG - Intergenic
1130128629 15:81116835-81116857 GAGAAAATTAGGAGAATTCAGGG + Intronic
1130430596 15:83843231-83843253 TTAAAAAAAAGGACATTTTAGGG - Intronic
1130575673 15:85090975-85090997 TTGAAAAAGAGGACAATCAAAGG - Intronic
1130848073 15:87766182-87766204 CTAAAAATTAAGACAATTTAAGG + Intergenic
1131843798 15:96467676-96467698 GGGAAAACAAGGGCAATTTAAGG + Intergenic
1131938543 15:97534879-97534901 TGGAAAAATAGGGAAATTTAAGG + Intergenic
1137049621 16:35696802-35696824 GTGAAAAATTGAACATTGTATGG + Intergenic
1137349431 16:47698699-47698721 GTGCAAAATAGGATACTTGAGGG + Intronic
1137852517 16:51760573-51760595 GTGAAAAATAGCAACTTTTAAGG - Intergenic
1138468308 16:57210400-57210422 GTTAAAAATAGAAGCATTTAAGG + Intronic
1138977175 16:62221471-62221493 GTGTAAAAGATGACAATTTAAGG - Intergenic
1140198205 16:72873138-72873160 GTGAAAAATACGCCCATTGAAGG - Intronic
1140271821 16:73472929-73472951 TTTAATAATGGGACAATTTATGG - Intergenic
1140614042 16:76638109-76638131 GTGAAAAATCAGACATTTTTTGG - Intergenic
1143277711 17:5724473-5724495 GTGAACTATGGGACAATTTCAGG + Intergenic
1144262704 17:13538441-13538463 GTGAAAAATTAGACAATTGTTGG - Intronic
1147053827 17:37818623-37818645 GTATAAAATATGACAATTTGGGG - Intergenic
1149114828 17:53080541-53080563 GGGAAAAATTAGAAAATTTAGGG + Intergenic
1149342182 17:55698543-55698565 GAAAAAAATAGGATAATTTGAGG - Intergenic
1151026295 17:70681108-70681130 CTGAAAAAAAGGAAAATTCAAGG + Intergenic
1151825126 17:76519724-76519746 GTGAAAGAGAGGACAGTTGAGGG - Intergenic
1153461922 18:5344870-5344892 AAGAAAAATAGGAAAAATTAGGG + Intergenic
1153809679 18:8741017-8741039 ATGTAAAAGGGGACAATTTAGGG - Intronic
1155213621 18:23623154-23623176 GTGAACAAAAGTACAAATTAAGG - Intronic
1156225157 18:35098107-35098129 GAGAAAAAAAGGGCAAATTATGG - Intronic
1157052341 18:44180990-44181012 GTGAAAAAAATGACAAGCTAAGG - Intergenic
1158656869 18:59345308-59345330 GTCAAAAATAAAACATTTTAAGG - Intronic
1159077519 18:63698677-63698699 GTAAGAAATGGGACAATTGATGG - Intronic
1159305228 18:66632622-66632644 GAATAAAATAGGACAATTGAGGG + Intergenic
1159477431 18:68941316-68941338 GTAAATCATAGCACAATTTAGGG + Intronic
1159573832 18:70151759-70151781 GAGAAAAATAAGACAATTTTAGG - Intronic
1164306699 19:24010244-24010266 GTAAAAAAAAGGAAATTTTAAGG + Intergenic
924963327 2:54564-54586 ATGAGAAAGAGGACTATTTATGG - Intergenic
925770409 2:7276853-7276875 GGGAAAAAAAGGACAGTTAATGG - Intergenic
926570196 2:14521116-14521138 ATGAAAAATAAGAAAATTTCAGG - Intergenic
926853124 2:17222788-17222810 GGGAAAAATAAGAAAATTTTTGG - Intergenic
926871197 2:17419719-17419741 GTGAAAAATAGGTCAGAATAGGG - Intergenic
929317945 2:40503204-40503226 GGGAAAATTAAGACAAATTATGG - Intronic
930914969 2:56675517-56675539 ATGAAAAATAGGACAAGGTTAGG - Intergenic
932533163 2:72560059-72560081 GTGAAAAATAAGACAAAGAATGG + Intronic
932967528 2:76494571-76494593 GTGACAAATAAGCCATTTTAAGG - Intergenic
933050930 2:77601148-77601170 GAGAAAACTAGGACAATTTGTGG - Intergenic
934669410 2:96200403-96200425 GTGATACATAGTACAATATATGG - Intronic
934707756 2:96496734-96496756 GGGAAAAATAAGACATTTAAAGG + Intergenic
936840340 2:116760635-116760657 GTGAAAATTGGTACATTTTAAGG - Intergenic
937144090 2:119627624-119627646 GTGAAAAAAAGGGCACTTTTAGG - Intronic
937578897 2:123459274-123459296 GTGAAAAAGAGAATATTTTAGGG - Intergenic
938505261 2:131873454-131873476 CTGCAAATGAGGACAATTTATGG - Intergenic
940386881 2:153084508-153084530 GTGGAAATTACTACAATTTAAGG - Intergenic
941108660 2:161392815-161392837 GTGAAAAATGGCACCATTCAGGG + Intronic
941209085 2:162612953-162612975 ATGAAAAATATGACAGTTTAAGG + Intronic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
943468066 2:188255369-188255391 GTGAAAAAAAGGATAATTTGGGG + Intergenic
945897094 2:215495947-215495969 ATGAAAAATATGAACATTTAAGG + Intergenic
946958190 2:224955273-224955295 TGGAAAAATTGGTCAATTTATGG + Intronic
1168925661 20:1577007-1577029 CTGAAAAATACTCCAATTTATGG - Intronic
1169593432 20:7170994-7171016 GTGAAAAACAGGACAGTGAATGG + Intergenic
1170177575 20:13489339-13489361 GTGAAATATAGGGGAATATATGG + Intronic
1170472075 20:16677777-16677799 GTGAGAAAGAGGAGAATTAAAGG + Intergenic
1171031707 20:21682488-21682510 GTGAAAAATGGGACTTTTTCTGG - Intergenic
1173068099 20:39733920-39733942 GTGAAGCATAGGAAAATTTTAGG + Intergenic
1173633913 20:44538044-44538066 GAGAGAAAAAGGACAATATAAGG + Intronic
1173887809 20:46477195-46477217 GTGAAAAATAGGAGAGTACAGGG + Intergenic
1176787838 21:13280425-13280447 ATGCAAATGAGGACAATTTATGG + Intergenic
1177052577 21:16255775-16255797 GAGAAAAATAGTCCAATTCATGG - Intergenic
1177060958 21:16373647-16373669 TTGAAGAACAGGTCAATTTATGG + Intergenic
1177314891 21:19446601-19446623 GTGATAAATAGGACAAAAGAGGG + Intergenic
1177594465 21:23218349-23218371 ATGAAAAATAGAAAAATCTAGGG - Intergenic
1177986971 21:27988619-27988641 ATGCAAATGAGGACAATTTACGG + Intergenic
1179252972 21:39688889-39688911 GTGAAGATTTGGACATTTTAGGG + Intergenic
1183609130 22:38885352-38885374 GTCAAGAATAGGACAAGTTCGGG - Intergenic
1184205283 22:42998526-42998548 GTGAAAAATACTATTATTTAGGG - Intronic
1184265933 22:43346044-43346066 GTGAAAAATAGGACAGCTGTGGG - Intergenic
949361053 3:3232547-3232569 TTTAAAAATAAGACAAATTAGGG + Intergenic
950144822 3:10641448-10641470 TTTAAAAATTGGAAAATTTAGGG - Intronic
951649994 3:24940877-24940899 GTGAAAAATATAGGAATTTAGGG + Intergenic
953372718 3:42403832-42403854 GGGAAAAAAAGTACAATTCAAGG + Intronic
956876075 3:73464658-73464680 TTGAAATATAGGAAAATTTAAGG - Intronic
957548617 3:81674143-81674165 ATGAGAAAGAGGAGAATTTAGGG - Intronic
957725278 3:84056975-84056997 GTGAAATATTAGACAATCTATGG - Intergenic
957838069 3:85625654-85625676 GTGAAAATGAAGACAATTTAGGG + Intronic
958445980 3:94215607-94215629 GAGATACATAGGACAAGTTATGG - Intergenic
958619418 3:96537441-96537463 GTGAAATACAGGGAAATTTAGGG + Intergenic
959331613 3:105013019-105013041 CTGGATAATAGTACAATTTAAGG - Intergenic
962012596 3:131407410-131407432 GTGAACAATGGTACAATTTCTGG + Intergenic
962043124 3:131728323-131728345 GTGTAAAATCGGAAAAGTTATGG - Intronic
963190637 3:142468466-142468488 GTGAAAAATATGAAATTGTACGG + Intronic
963441792 3:145349098-145349120 GTTAAAAATTGAACATTTTAGGG - Intergenic
963449850 3:145464454-145464476 ATGAAAAATAGAATAATTTTGGG - Intergenic
963752188 3:149193549-149193571 GTGAAAATTATGAAAATATATGG - Intronic
963867019 3:150372595-150372617 GTTAAAAATGGGAAGATTTAAGG - Intergenic
964090220 3:152867032-152867054 CTTAAAAACAGTACAATTTAAGG - Intergenic
964127470 3:153250482-153250504 GCAAAAAATATTACAATTTATGG + Intergenic
964328256 3:155572094-155572116 GAGAAAAAAAGCACAATTCATGG - Intronic
964685280 3:159388618-159388640 GTGAAAAAGAGGAACATTGAGGG + Intronic
964711742 3:159678211-159678233 GTGAAAAATAGGACAATTTATGG - Intronic
965234854 3:166104632-166104654 CTGAAAAATAAAACACTTTATGG + Intergenic
965309148 3:167107304-167107326 GAGAAAAATACCACACTTTAAGG - Intergenic
966072649 3:175897574-175897596 GAGAAAAATAGGAAAATCTAAGG + Intergenic
966929539 3:184666954-184666976 GTGAAAAATAAGACAACGTTTGG + Intronic
967375584 3:188796951-188796973 GGGAAAGATAGGTCATTTTAGGG - Intronic
970912821 4:21297326-21297348 GTGAAAAACACCTCAATTTATGG + Intronic
971508707 4:27396928-27396950 GTCCAAAATTGGAGAATTTAGGG + Intergenic
971897408 4:32615749-32615771 GAGAAAAATAGAAGAAATTAGGG - Intergenic
972150479 4:36083306-36083328 GGGAAAAATATGTCTATTTAAGG - Intronic
973128520 4:46619830-46619852 GGCAAAAATTGGAAAATTTATGG - Intergenic
974361926 4:60892457-60892479 GTGAAAAATATGAAAAGTTTGGG + Intergenic
974428788 4:61770176-61770198 CTGGAAAATGGGACAAGTTAGGG + Intronic
974553294 4:63408609-63408631 ATGAGAAATAGGAAAATTAAAGG + Intergenic
975250416 4:72172393-72172415 GTGAATATTAAGACAATGTAAGG - Intergenic
975989947 4:80248406-80248428 GTTAAAAAAAGGAAAATATATGG + Intergenic
978143312 4:105342292-105342314 TTGAAAAAGAGGCTAATTTAAGG + Intergenic
979426210 4:120571148-120571170 GTGAATAAAAAGACAATTAAGGG + Intergenic
979834661 4:125349493-125349515 GTTATAGATAGGACCATTTAGGG - Intronic
979981515 4:127261891-127261913 TTGAAAAAGAGGAATATTTAAGG + Intergenic
980076311 4:128297374-128297396 GTAAAAAATAAGATAATTTCAGG - Intergenic
980305579 4:131056766-131056788 ATGTAAATTAGTACAATTTATGG - Intergenic
980924348 4:139119700-139119722 GCTAAAATTAGGATAATTTAAGG - Intronic
981648710 4:147030323-147030345 GTAAATAATATGACCATTTAGGG - Intergenic
982035769 4:151344194-151344216 GAGAAGAAAAGAACAATTTATGG - Intergenic
982167731 4:152630012-152630034 GTGAACAAAAGGACAAACTAGGG + Intronic
982191343 4:152858813-152858835 GAGAAAAATAGAACAAGGTAAGG + Intronic
984052315 4:174879845-174879867 GTGAAAAAGAGGACAAACTGGGG + Intronic
984063302 4:175018914-175018936 GTGAAAAATAGCACAGAGTATGG + Intergenic
984344370 4:178503601-178503623 GAGAAAAATAGCAGAATTAATGG - Intergenic
984578226 4:181476183-181476205 GTTAAAGATAAGACATTTTAGGG + Intergenic
986840859 5:11695773-11695795 GATAAAAATGGGACAAATTAAGG - Intronic
987006456 5:13715206-13715228 TTGAAAAAAAAGAAAATTTACGG + Intronic
988580961 5:32468474-32468496 GTGATAAACAGGAGATTTTAGGG + Intergenic
988708727 5:33752499-33752521 CTGAAAAATAGGATAAATCAAGG + Intronic
989703817 5:44303197-44303219 GGGAAAAATATGACCTTTTATGG + Intergenic
991962300 5:72057258-72057280 GTGAAAAAGAGGACAAATATTGG + Intergenic
992935387 5:81698421-81698443 GTTAAAAATAGGATAACTTTTGG - Intronic
993126940 5:83846900-83846922 GTCATAATTAGCACAATTTAGGG - Intergenic
993229916 5:85221352-85221374 CTGAAAAAAAGGATAATTTGGGG + Intergenic
994260656 5:97654954-97654976 CTGAAAAAGAGGAGGATTTAGGG - Intergenic
994682089 5:102900727-102900749 GTGATAAAAATTACAATTTAAGG - Intronic
995799433 5:115977984-115978006 GTGAAAATTAGGATATTTTGGGG + Intronic
996798157 5:127373556-127373578 TTGAAAAATAGTTCATTTTAGGG - Intronic
997369322 5:133347842-133347864 GTGGAAACTAGGTCTATTTATGG - Intronic
998300847 5:141018217-141018239 GCCAAAAGTAGTACAATTTAGGG + Intergenic
998737278 5:145156794-145156816 TTGAAAAATTGAAGAATTTAAGG + Intergenic
1000580739 5:163033009-163033031 GAGCAAAATAGGATACTTTAAGG - Intergenic
1000684675 5:164233808-164233830 GGGAAAAATAGGACAATGTTGGG - Intergenic
1001693339 5:173649274-173649296 GTGCAAAATAGGACCACATATGG + Intergenic
1002143668 5:177161468-177161490 TTTAAAAATAGGAGAATATAGGG - Intronic
1004250516 6:14019538-14019560 GTGAAAATTGGGACATTCTAAGG + Intergenic
1005212642 6:23485774-23485796 GTGACAAATAAGAAAAATTAGGG + Intergenic
1005653785 6:27911294-27911316 GACAAAAATAGGACAACTTGCGG + Exonic
1006544972 6:34773127-34773149 GAGAAAAAAAGGTCAGTTTAGGG + Intronic
1008192214 6:48474444-48474466 GTGACAAATAGGACAATCTCAGG + Intergenic
1008422512 6:51318369-51318391 GTGAAAATTGGGTCAATATATGG + Intergenic
1009008163 6:57811507-57811529 GAGAGAACTAGGACATTTTAGGG + Intergenic
1009804277 6:68582444-68582466 GTGAAAAATAAGATAATTATTGG + Intergenic
1009881287 6:69569483-69569505 ATGAAAGAGGGGACAATTTATGG - Intergenic
1010087211 6:71934971-71934993 GTTAAAAATAGTTCAATTTTAGG - Intronic
1010733932 6:79420825-79420847 GTGGAAAATAAGAAAATTTAAGG - Intergenic
1011052609 6:83170052-83170074 GTTAAAAATATGACACTTTCAGG + Intronic
1011288424 6:85750080-85750102 ATGAAAAATAAGAAAATATAGGG - Intergenic
1011577656 6:88821435-88821457 GTGAAATATAGGGCATTTTGAGG + Intronic
1012427807 6:99133239-99133261 AGGTAAAATAGGACAAGTTATGG - Intergenic
1012564574 6:100631881-100631903 CTGAAAAGTAGGAAAACTTAGGG + Intronic
1012669444 6:102023526-102023548 GAGAAAAATAAAACCATTTATGG - Intronic
1012864683 6:104604157-104604179 GAGAAAAATATGAGACTTTAGGG - Intergenic
1013238215 6:108217820-108217842 GTGAGAAATAGGAGAATATCTGG + Intronic
1013679442 6:112508122-112508144 GACAAAAATCGGACAAGTTAAGG + Intergenic
1013848644 6:114486144-114486166 GTGAAAAGAAAGACAGTTTAAGG - Intergenic
1013868864 6:114732069-114732091 TTGAAAATTAGTACACTTTAGGG - Intergenic
1014233136 6:118926419-118926441 GTGACAAACAGAATAATTTATGG + Intronic
1014667401 6:124256300-124256322 GTGAAAAATAAGATAGTTAAGGG + Intronic
1014869893 6:126581052-126581074 GTTATAAATAAAACAATTTATGG + Intergenic
1014977317 6:127903598-127903620 GGGAAAAATAGGAAAATGTCTGG + Intronic
1016050244 6:139523030-139523052 GTGAAAAAAAGGAAAAGTTGAGG + Intergenic
1017354827 6:153491766-153491788 GTAGAAAATAGGGCAATTTAAGG + Intergenic
1018288926 6:162270759-162270781 GCACAAAAAAGGACAATTTAAGG - Intronic
1018843947 6:167541136-167541158 GTGAAAAATCAGTCAATCTAAGG + Intergenic
1020248480 7:6448917-6448939 ACAAAAAATAGGAAAATTTATGG - Intronic
1021102383 7:16598645-16598667 GTGAAGAAAAGGAGAATTGATGG + Intergenic
1022056212 7:26737175-26737197 GTGAAAAAGAGGATATTTTGTGG + Intronic
1023203808 7:37726359-37726381 GTAAAAAATGGGAGAATTCATGG + Intronic
1025564076 7:62409005-62409027 GTGAAAAATGATACTATTTAAGG - Intergenic
1027489146 7:78800577-78800599 GACAAAAATAGAACAATTTTTGG + Intronic
1027515315 7:79135487-79135509 TCAAAAAATAGGGCAATTTATGG + Intronic
1027551909 7:79608757-79608779 GAGAAAAAAAGCTCAATTTAAGG + Intergenic
1027746108 7:82076125-82076147 GTGAAAAATAAGACAGATTCAGG + Intronic
1027812027 7:82915373-82915395 GTGAAAATTTTGACATTTTAGGG + Exonic
1028110907 7:86940009-86940031 GTAAAAAATATCACAATTGAAGG - Exonic
1029032531 7:97483883-97483905 CTGAAAAAAAGGAAAATTCAGGG + Intergenic
1030215143 7:107037077-107037099 GAGAAAAATAAGAAAATTAAAGG - Intergenic
1030934522 7:115568691-115568713 CTGAAGATTAGGACATTTTAAGG + Intergenic
1030981730 7:116193520-116193542 GTGAAAAATATGCCAAATAAGGG - Intergenic
1031822718 7:126524682-126524704 GTGAAAAAAAGGAAAATATGAGG - Intronic
1031852089 7:126877989-126878011 ATGAAACATTGGACAAATTAAGG + Intronic
1032418592 7:131758984-131759006 GTGAATAATAGGGAAATTTTAGG + Intergenic
1032638697 7:133740302-133740324 GTGAAAAATTGGGAATTTTATGG - Intronic
1034711035 7:153191657-153191679 GAGAAGAATAGGAAAATTTGGGG + Intergenic
1038052278 8:23825254-23825276 AAGAAAAATAAGACAATATAAGG - Intergenic
1038938461 8:32278300-32278322 GTGAAAAATAGAGCAATTTGGGG + Intronic
1039695331 8:39904495-39904517 GTGAAAAATAAAACAAAGTACGG - Intronic
1039904748 8:41778234-41778256 ATGAAAAATAGGACAATAAAAGG + Intronic
1041564960 8:59266445-59266467 TTGAAAAATAGGCCAATAAATGG - Intergenic
1042277614 8:67021761-67021783 GTGAAAAACAGTACTATATATGG - Intronic
1043023650 8:75038765-75038787 GTGAAAGATAAGACAATTGATGG - Intergenic
1043641348 8:82454301-82454323 GTTAAAATTAGGATAATTGATGG + Intergenic
1043686088 8:83087685-83087707 GTGAAAATTATAGCAATTTAGGG + Intergenic
1044558823 8:93592611-93592633 GAGGGAAATAGGACAATTGAAGG - Intergenic
1044900722 8:96941452-96941474 GTGCAAACTAGGGCAATATATGG - Intronic
1045482976 8:102607761-102607783 GTAAAGAATAGGAAAATATAAGG - Intergenic
1045841376 8:106585898-106585920 GTGAACAACAGGAGAATATATGG + Intronic
1046081757 8:109378216-109378238 GTGAAAAATGGGATAAATAATGG - Intronic
1046282061 8:112046164-112046186 GTAAAAAATACTTCAATTTAGGG + Intergenic
1046483639 8:114856430-114856452 GTGAAAAATTGAACAATGTTGGG + Intergenic
1046860732 8:119088420-119088442 GTGAAAGCAAGGACAATGTATGG - Intronic
1050814505 9:9792533-9792555 GGAAAAAATAGAACAATTTTAGG + Intronic
1050921375 9:11205277-11205299 GTAAAGAATAGGAAAATATAGGG + Intergenic
1051964651 9:22812786-22812808 GATAAAAATAAGACACTTTAAGG - Intergenic
1052581689 9:30364437-30364459 GTAAAAAATATGACAAAGTAAGG - Intergenic
1052589647 9:30474886-30474908 GTAAGCAATAGGTCAATTTAAGG + Intergenic
1056799004 9:89678411-89678433 GTGAAAACTTGGAAAATGTAAGG - Intergenic
1056975947 9:91253883-91253905 ATGAAATAAAGCACAATTTAAGG + Intronic
1057815904 9:98294389-98294411 GTAAAAAATAGGTCCTTTTATGG - Intronic
1058420628 9:104829817-104829839 GTGAAAAACAGGATAATTTCTGG + Intronic
1058524595 9:105844337-105844359 GAGAAAATGGGGACAATTTAGGG + Intergenic
1058794464 9:108484387-108484409 GTGAAATAGATGACAATTGAGGG + Intergenic
1059141654 9:111858620-111858642 GTGGAAAATTGGACAATCTTTGG + Intergenic
1059887665 9:118764655-118764677 GTGAAAAATAGAATTATCTAAGG - Intergenic
1059935852 9:119309877-119309899 GCGAACAGTAGTACAATTTATGG + Intronic
1061344640 9:130013133-130013155 ATAAAAAATAGAACAATTGAAGG - Intronic
1185919590 X:4075878-4075900 GTAAAAAATAGTTCAATTCAGGG + Intergenic
1186081650 X:5939848-5939870 GTTAAAAATAGGGCAATTTGCGG - Intronic
1186653126 X:11583058-11583080 TTTAAAAATGGGACTATTTAAGG - Intronic
1187105952 X:16241976-16241998 GTGAAAAAAAGGAAAACTAATGG - Intergenic
1187672369 X:21680836-21680858 GTCAAATTTAGGACAATTTTTGG + Intergenic
1188093492 X:25992365-25992387 GTGAAAAATGAAACAACTTATGG + Intergenic
1188564869 X:31515113-31515135 GGGAAGAATAGGAAAAGTTATGG + Intronic
1189596084 X:42566922-42566944 GTGTCAATTAGGACAATCTAGGG - Intergenic
1190476673 X:50834889-50834911 GAGAAAAATAAGACAAGGTATGG - Intergenic
1194074952 X:89379693-89379715 GTGAGAAATAGGCAAATTTGAGG + Intergenic
1194706568 X:97182059-97182081 GTGAAGGTTAGGACAAGTTAGGG + Intronic
1196360181 X:114844867-114844889 GTGAAAAATAAAAGAATTAATGG + Intronic
1196916768 X:120544572-120544594 GTGCAGAATAAGACAATTGATGG - Exonic
1197475824 X:126923714-126923736 GAGGAAAATAGGTCATTTTATGG - Intergenic
1197475870 X:126924478-126924500 GAGGAAAATAGGTCATTTTATGG - Intergenic
1200730551 Y:6733864-6733886 GTGAGAAATAGGCAAATTTGAGG + Intergenic
1201251939 Y:12067531-12067553 GTGGGAATTAGTACAATTTAAGG + Intergenic
1202590347 Y:26476243-26476265 GTGGAAATTAGAAAAATTTAAGG - Intergenic