ID: 964716021

View in Genome Browser
Species Human (GRCh38)
Location 3:159722606-159722628
Sequence TGTATGTGTGTGTATAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4110
Summary {0: 2, 1: 5, 2: 155, 3: 804, 4: 3144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964716021 Original CRISPR TGTATGTGTGTGTATAGAGA GGG Intronic
Too many off-targets to display for this crispr