ID: 964719961

View in Genome Browser
Species Human (GRCh38)
Location 3:159761585-159761607
Sequence GGTTCCTGGCAGGAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 2, 2: 0, 3: 51, 4: 452}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964719956_964719961 -5 Left 964719956 3:159761567-159761589 CCTGTTCCAAAGTGGGAGGGTTC 0: 1
1: 0
2: 0
3: 5
4: 107
Right 964719961 3:159761585-159761607 GGTTCCTGGCAGGAGATGGAAGG 0: 1
1: 2
2: 0
3: 51
4: 452
964719951_964719961 15 Left 964719951 3:159761547-159761569 CCTAGGAGTTGGCAGGGCTTCCT 0: 1
1: 0
2: 3
3: 36
4: 263
Right 964719961 3:159761585-159761607 GGTTCCTGGCAGGAGATGGAAGG 0: 1
1: 2
2: 0
3: 51
4: 452

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964719961 Original CRISPR GGTTCCTGGCAGGAGATGGA AGG Intronic
900083455 1:875796-875818 GGTTCCTGGAAGCAGCTGGGAGG + Intergenic
900479257 1:2890137-2890159 AGCTCATGGCAGGGGATGGAAGG + Intergenic
901130456 1:6959496-6959518 GGTCCCGGGCAGGGGATGGTGGG + Intronic
901149816 1:7093748-7093770 TGTGCCTGGCAGAAGAAGGAAGG + Intronic
901182409 1:7350837-7350859 GGATCCTGGCAGAATGTGGAGGG - Intronic
901228543 1:7629214-7629236 GGTCCCTGGCAAGAGAGAGAAGG + Intronic
903869783 1:26425590-26425612 GGTCCCTGGCAGCATCTGGAAGG + Intronic
904377327 1:30090102-30090124 GGGTCCAGTGAGGAGATGGAGGG + Intergenic
904713113 1:32446602-32446624 GGTTCCTCCCAGGTGATTGAGGG - Intergenic
905290613 1:36919601-36919623 GATACCTGGAAGGAGATGGCTGG - Intronic
906144233 1:43550429-43550451 AGGTCCCGGCAGGAGCTGGAGGG + Intronic
906641010 1:47440332-47440354 GGTTGCTGGCCGGAGATGGCTGG - Exonic
906694985 1:47817726-47817748 GGCTCCTCGCAGGACATGCAAGG + Intronic
907334124 1:53689348-53689370 GCTTCTTGCCAGGAGAAGGAGGG - Intronic
910486529 1:87721072-87721094 GGGTCCTGGCAGGAAACAGATGG - Intergenic
910590802 1:88926629-88926651 GGTTCCTCCCAGGAGACTGAGGG + Intergenic
910965686 1:92805918-92805940 GAGTCATGGCAGGAGATGAAAGG - Intergenic
911925661 1:103828460-103828482 GGTACCTGCCAGGGGTTGGAGGG - Intergenic
915596853 1:156901072-156901094 GGGTCCTGGCAGGAAGAGGAAGG - Intronic
917500223 1:175578905-175578927 GGTTCCTGGCAGTAGAGGAGGGG - Intronic
917725864 1:177826523-177826545 GCTTGCTGACAGGAGATAGATGG - Intergenic
918011025 1:180586722-180586744 GATCCATGCCAGGAGATGGAGGG - Intergenic
918128878 1:181607840-181607862 GCATCCTGGCAGGAAATGGAAGG + Intronic
919009461 1:191940801-191940823 GGGTCCTGTCAGGGGGTGGAGGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
920006076 1:202834871-202834893 GGTTCCTGGCAGGTGTTCGGTGG + Intergenic
920543049 1:206793660-206793682 GGTTCCAGGCATAAAATGGAGGG - Intergenic
920756444 1:208738366-208738388 AGTTCCTCTCAGCAGATGGATGG + Intergenic
921015636 1:211188316-211188338 GTTTCCTGGCAGGATAAAGAGGG - Intergenic
922631552 1:227118992-227119014 GGTGCCAGGAAGGAGATGGAGGG - Intronic
922706865 1:227794792-227794814 GGTCCCTGGCAGGACACAGAGGG + Intergenic
922740602 1:228012253-228012275 GGTCCCTGGATGGAGATGGCGGG - Intronic
922857092 1:228784442-228784464 GTGCCCTGGGAGGAGATGGAAGG - Intergenic
924625856 1:245695986-245696008 GGGTATTGGCAGGAGATGGAGGG + Intronic
1062929626 10:1344373-1344395 GCTGCATGGCAGGAGAAGGAAGG + Intronic
1063112492 10:3048806-3048828 GGCCCCAGGCAGGAGAGGGAGGG + Intergenic
1063377477 10:5562615-5562637 GGTTCTGGGGTGGAGATGGAAGG - Intergenic
1064326428 10:14355589-14355611 GGGTCCTGGCAAGAGACAGATGG - Intronic
1065937083 10:30530131-30530153 GGTTCCTATCAGAGGATGGAAGG - Intergenic
1066054090 10:31664152-31664174 GGTTGCTGGCTGGGGAAGGATGG + Intergenic
1066153578 10:32650913-32650935 GGTTCCTGGGAGGGGCTGGCAGG + Intronic
1067350576 10:45472150-45472172 TGTTCCTGGGAGGAGGAGGAGGG - Intronic
1067683956 10:48456421-48456443 CATGCCTGGCTGGAGATGGAAGG - Intronic
1067799675 10:49350419-49350441 GGGTCATGGCTGGAGTTGGAAGG - Intergenic
1069260463 10:66387934-66387956 GGGGCCTGTCAGGGGATGGAGGG + Intronic
1069914081 10:71776513-71776535 GGGTCCTGGCAGGAAACAGATGG + Intronic
1070391890 10:75978094-75978116 TATTCCTGGTTGGAGATGGAGGG + Intronic
1070446728 10:76512184-76512206 GAATCATGGCAGGAGATGAAAGG - Intronic
1070835079 10:79442942-79442964 GCTTCCTCGGAGGTGATGGAGGG - Intronic
1070987025 10:80697908-80697930 GATTCCTAGCTGGAGAGGGAGGG - Intergenic
1071491065 10:86136746-86136768 GATTGTTGGCAGGAGATTGAGGG - Intronic
1071952728 10:90723556-90723578 GAGGCCTGGCAGGAGATGGGAGG + Intergenic
1072797849 10:98369990-98370012 GGTCCAAGGCAGGAGGTGGACGG - Intergenic
1073589629 10:104744114-104744136 GGTGGCTGGCAGGAGAATGATGG + Intronic
1074087649 10:110220602-110220624 AGCTCCTGGCAGGGGAGGGAGGG + Intronic
1074742418 10:116498181-116498203 GGTTCCTCCCAGGTGATTGAGGG - Intergenic
1075345969 10:121682078-121682100 GATTACTGCCAGGAGAGGGAGGG + Intergenic
1076192199 10:128490751-128490773 GGTTCCTAGCAGGGGCTGGGAGG + Intergenic
1076251624 10:128988686-128988708 CCTTCCTGTCAGGAGATGTAAGG + Intergenic
1077337099 11:2010265-2010287 GGTTCATAGCAGGAGCTCGAGGG + Intergenic
1077456356 11:2683627-2683649 TGTTCCTTGCAGCAGATGCAGGG - Intronic
1078096311 11:8299386-8299408 GGGCCCTTGCAGGAGAAGGATGG - Intergenic
1078434665 11:11314536-11314558 GTGTCCAGGCAGGAGATGGCTGG + Intronic
1079131397 11:17748882-17748904 GGTGCCCAGCAGGAGATGGTGGG + Intronic
1080119457 11:28660462-28660484 AGTTTCTGGCATGAGATAGATGG + Intergenic
1083089750 11:60187408-60187430 GGTTCCTCCCAGGTAATGGAAGG + Intergenic
1083267621 11:61554065-61554087 GGTTCCTGGCTGGGGATTGTGGG + Intronic
1083681458 11:64353697-64353719 GGTCCCTGGCAGGAGTGAGAAGG - Exonic
1084702528 11:70796608-70796630 GGTTGCTTGCAGGAGAGGGTGGG + Intronic
1086734335 11:90286975-90286997 GGTTCCTAACAGGCCATGGATGG + Intergenic
1086995579 11:93352680-93352702 GATTCATGGCAGGAGGTGAAAGG + Intronic
1087103946 11:94392312-94392334 GGGTCCTGTCAGGAGGTGGGGGG + Intronic
1088004116 11:104920345-104920367 GGGGCCTGTCAGGAGGTGGAGGG - Intergenic
1088086518 11:105987262-105987284 TTTTCCTTCCAGGAGATGGAAGG + Intergenic
1088815173 11:113415678-113415700 TGTTCCTGGAAGGACATGAATGG - Intronic
1089411449 11:118246503-118246525 GGATCCAGGCAGGCAATGGAAGG + Intronic
1090517114 11:127440647-127440669 CCTTCCTTGCAGGAAATGGAGGG + Intergenic
1090672466 11:128958421-128958443 GGTTACTTGCAGGAGAGGAAGGG - Intergenic
1202820083 11_KI270721v1_random:65447-65469 GGTTCATAGCAGGAGCTCGAGGG + Intergenic
1091699207 12:2648919-2648941 TGCTCTAGGCAGGAGATGGAAGG + Intronic
1091942562 12:4501400-4501422 GGTTCCTAACAGGTGATGGACGG - Intronic
1092211821 12:6651302-6651324 GGTAAGTGGCAGGAGTTGGAGGG - Exonic
1093499967 12:19800389-19800411 ATTTCCTGGCAGGAAATTGAAGG - Intergenic
1094001847 12:25703880-25703902 GGTGCCTGGTAGGAGGTGGTTGG - Intergenic
1094061307 12:26317554-26317576 GGTTCCTATCAGGATATTGAGGG - Intergenic
1095829923 12:46573935-46573957 AGTTTGTGGCAGCAGATGGAGGG - Intergenic
1096053758 12:48633749-48633771 GGTTCCCAGTAGGAGAAGGAAGG + Intergenic
1096154538 12:49334668-49334690 GGTATCTGGGAGGAGGTGGAGGG - Intronic
1096499321 12:52055560-52055582 TGTTCCTGGCGTGAGATGAAAGG + Intronic
1096912473 12:54998181-54998203 GGCTTCTGGCAGTGGATGGACGG - Intergenic
1096932040 12:55222102-55222124 GGTTCCTAGCAGGAAAGAGATGG + Intergenic
1097110338 12:56653234-56653256 GGTTCCTAACAGGCCATGGACGG - Intergenic
1097249076 12:57622497-57622519 GGTCCCTGGCAGAAGCTAGAAGG - Intronic
1100324849 12:93531179-93531201 GGTTTCTAGCAGGCCATGGACGG + Intergenic
1100713022 12:97277345-97277367 GGGTTCTGGCATTAGATGGAAGG + Intergenic
1102590211 12:113950972-113950994 GGTCCCTGGCAGGTGAAGAATGG - Intronic
1102677601 12:114668981-114669003 CGTGCCTGGCCAGAGATGGAAGG + Intergenic
1102760073 12:115377265-115377287 GGTTCCTGGCAGAAAATGATGGG - Intergenic
1102907993 12:116692013-116692035 GGTGGCTGCCAGGAGCTGGAGGG + Intergenic
1103397242 12:120617503-120617525 GGGTCCTGGCAGGAGGTGATTGG + Intergenic
1104323938 12:127778140-127778162 GGTTCCTGGCCGGCGAAGAAGGG - Intergenic
1104392854 12:128405779-128405801 GGTTCATGTCATGAGATTGAGGG + Intronic
1104918841 12:132280081-132280103 GGATCCTTGCAGGAAATTGATGG - Intronic
1104951027 12:132440166-132440188 GGTTCCTGGCTTGAGATGTCAGG - Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106368911 13:29112340-29112362 GGTTCCTGGAAAGAGATGGCTGG + Intronic
1107653524 13:42568927-42568949 GGGTCCTGGCAGGAAATAGGTGG + Intronic
1107899408 13:44996998-44997020 GGTGCTTGTCAGGAGCTGGAGGG - Intronic
1108014261 13:46057552-46057574 GGTTCATGGCAAAAGATGCAAGG - Intronic
1108434643 13:50389875-50389897 GGATCCTGGCAGGAAACAGATGG + Intronic
1110465488 13:75795807-75795829 GGGGCCTGTCAGGTGATGGAGGG + Intronic
1110661600 13:78064267-78064289 GGGGCCTGTCAGGGGATGGATGG - Intergenic
1111066887 13:83106202-83106224 GATTCATGGCAGGAGATGAAAGG - Intergenic
1114431837 14:22668043-22668065 GGTGCCTGGCAGGAGTTGTTTGG - Intergenic
1114664695 14:24370497-24370519 GGTTCCCGGAAGGAGGTGGCTGG + Exonic
1115017397 14:28633759-28633781 GGGTCCTGGGAGGGGATGGCAGG + Intergenic
1115021419 14:28685151-28685173 GAATCATGGCAGGAGATGAAAGG - Intergenic
1115152638 14:30302947-30302969 GGCTACGGGCAGGATATGGAAGG - Intergenic
1115425739 14:33257171-33257193 AGTTTCTGGGAGGCGATGGAAGG - Intronic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116035923 14:39627043-39627065 GGAGCCTGGCCGGAGATGGCTGG + Intergenic
1117069002 14:52039598-52039620 GCAGCCTGGCAGGAGATGTAGGG - Intronic
1117556042 14:56884927-56884949 TGTTTCTGGAAGGAGAGGGATGG - Intergenic
1117995569 14:61474545-61474567 GGGGCCTGGCAGGGGATGGGGGG + Intronic
1118047484 14:61987148-61987170 GGGACCTGAAAGGAGATGGATGG + Intergenic
1118662402 14:68028732-68028754 GGGCCCTGGAAGGAGATGGCAGG + Intronic
1118819264 14:69334477-69334499 GGGTCCTGGCAGAATACGGAAGG + Intronic
1118952966 14:70451424-70451446 TTTTCCTGGCAGGAAATGGAAGG + Intergenic
1120568195 14:86085522-86085544 GCTTCCAGGCACGAGAGGGAAGG + Intergenic
1120685467 14:87531954-87531976 GGTTCCACACAGGAGATGCAAGG - Intergenic
1120739370 14:88090876-88090898 GGTTAGTGGTGGGAGATGGAAGG + Intergenic
1121993158 14:98581023-98581045 GGACCATGGCAAGAGATGGAAGG + Intergenic
1122179727 14:99946481-99946503 GGGATCCGGCAGGAGATGGAAGG - Intergenic
1122635218 14:103126656-103126678 GGGTCCAGGCAGGGGCTGGATGG + Exonic
1122691110 14:103532564-103532586 GGTGCCTGGCAGGACAAGAAGGG - Exonic
1122957383 14:105076984-105077006 GAGTCCGGGCAGGAGCTGGAGGG + Intergenic
1202902720 14_GL000194v1_random:52723-52745 GGTTGCTGGGAGGAGAGGCATGG - Intergenic
1123586862 15:21768824-21768846 GGGGCCTGTCAGGAGATGGAAGG + Intergenic
1123623501 15:22211389-22211411 GGGGCCTGTCAGGAGATGGAAGG + Intergenic
1123755506 15:23394752-23394774 GGTTCCTGGCAGGCCTTGGTGGG + Intergenic
1124226814 15:27901972-27901994 GGGTCCTGGCAGGGGGCGGAGGG + Intronic
1124634723 15:31357705-31357727 GGTTCCTGGCAGGTGCAGGAAGG + Intronic
1125520590 15:40345929-40345951 GAGTCCTGGCTGGAGAGGGATGG - Intergenic
1126030241 15:44489773-44489795 GGATTCTGGCAGTAGATGGTAGG + Intronic
1126187113 15:45841279-45841301 GGAGCCTGGCCGGAGATGGCTGG + Intergenic
1127578784 15:60317727-60317749 GAATCATGGCAGGAGATGAAAGG + Intergenic
1128151054 15:65363656-65363678 GGGTCCTGGCAGGAGGCGGGTGG - Intronic
1128509313 15:68303745-68303767 GGGCCCTGGCAGGGGAGGGAAGG - Intronic
1129381388 15:75169668-75169690 GGCTCCTGGCAGGGGGTGGTTGG + Intergenic
1129786091 15:78311129-78311151 GGTTCCTGGCAGCCTCTGGAGGG - Intergenic
1129875672 15:78973850-78973872 GGTGACTGGCAGGAGTTGGGGGG - Intronic
1130720641 15:86382726-86382748 GGTTTCTGGTAGGAAATGGAAGG - Intronic
1130870615 15:87969024-87969046 GGTACCTGGCAGGGGGTGGGGGG - Intronic
1131781806 15:95867819-95867841 AATGACTGGCAGGAGATGGAGGG + Intergenic
1132328072 15:100988616-100988638 GGGACCTGGCAGGAGATGGCAGG - Exonic
1132858171 16:2056796-2056818 GGTTCCTGAGAGCACATGGATGG + Intronic
1133001847 16:2855847-2855869 GGTTGCTGGAAGGAAAGGGAAGG + Exonic
1133028457 16:2998632-2998654 GGATCCAGGCAGGGGATAGAGGG - Intergenic
1133537142 16:6713192-6713214 GGCTCTAGGCAGAAGATGGATGG - Intronic
1133556179 16:6908389-6908411 GGTTCCTGGGAGGAAAGAGAAGG - Intronic
1134030527 16:10988926-10988948 GGTCCCAGGTAGGAGGTGGAAGG - Intronic
1134460869 16:14428273-14428295 GGTTCCTGGCAGGCCTTGGAGGG - Intergenic
1134859044 16:17544670-17544692 GGTTGCTGGGAGCTGATGGAGGG + Intergenic
1136022224 16:27447529-27447551 GAGTCCTGGCAGGGGAGGGAAGG + Intronic
1136503736 16:30689011-30689033 GGTTCCTGGCAGGATAAGCTGGG + Intergenic
1137650317 16:50114437-50114459 GGTTCCCTGCAGGTGCTGGAAGG + Intergenic
1137780178 16:51091366-51091388 GGTCCCTGGCTGCAGATGGTGGG - Intergenic
1138380866 16:56601432-56601454 GGATCCTGCCAGGAGCTGGAAGG - Intergenic
1138526504 16:57610840-57610862 GGTTCCTGAGAGGAGATGTACGG + Intronic
1138616728 16:58173908-58173930 GGTTCCTAGCAGCAGAGAGAGGG - Intronic
1139011467 16:62639837-62639859 GGGTCCTGGCAGGAAACAGAAGG - Intergenic
1139429899 16:66905455-66905477 GGTTCTGGGCTGGAGCTGGAGGG - Intergenic
1139587501 16:67913527-67913549 GGTTGCTGGCAGGAGCTTGAAGG + Intronic
1139587833 16:67915745-67915767 GGTTGCTGGCAGGAGCTTGAAGG - Intronic
1141131950 16:81443519-81443541 GGTTTCAGGCAGGGGATGAAAGG - Intergenic
1141689706 16:85589160-85589182 GCTTCCTAGCAGGAGCTGAAAGG + Intergenic
1142350684 16:89577966-89577988 GGGACCTGGCAGCAGCTGGATGG - Intronic
1142692450 17:1614943-1614965 GGTCCCTGACAGAAGATGGAGGG + Intronic
1142976485 17:3647726-3647748 TTTCCCTGGCAGGAGAAGGAAGG + Intronic
1143239730 17:5433795-5433817 TGCTGCTGGAAGGAGATGGATGG + Intronic
1143324621 17:6090650-6090672 GGCTCCTGGCAGGGCAGGGATGG + Intronic
1144617830 17:16792542-16792564 GGTTCCTAACAGGCCATGGACGG + Intronic
1144619056 17:16804639-16804661 GGTTCCTAACAGGCCATGGACGG - Intergenic
1144743109 17:17595454-17595476 AGTTCCTGGGAGGAGATGGGTGG + Intergenic
1144893644 17:18511056-18511078 GGTTCCTAACAGGCCATGGACGG + Intergenic
1145137349 17:20421094-20421116 GGTTCCTAACAGGCCATGGACGG + Intergenic
1145138579 17:20433218-20433240 GGTTCCTAACAGGCCATGGACGG - Intergenic
1146264523 17:31443543-31443565 GGTTCCAGCCAGGTGAGGGAGGG - Intronic
1146459416 17:33033678-33033700 GATTCCTGGCAGGAAGGGGATGG + Intronic
1147864369 17:43543108-43543130 GGTTCCCAGCTGGTGATGGATGG - Intronic
1147892773 17:43729062-43729084 GGTTGAAGGCAGGAAATGGATGG - Intergenic
1148740026 17:49887520-49887542 GGTTCCTGGCCTGAGTGGGAGGG - Intergenic
1148776317 17:50097405-50097427 GGATCCTGGCAGGAGAAAGAGGG - Exonic
1149270920 17:54976586-54976608 GGTTCCTAACAGGCCATGGACGG - Intronic
1151254581 17:72866050-72866072 GGTTCCTAACAGGCCATGGACGG - Intronic
1152659149 17:81534489-81534511 GGTTCCTGCGAGGGGATGGAGGG - Intronic
1157121476 18:44915345-44915367 GGATCTTGGCAGCAAATGGAGGG + Intronic
1157429749 18:47614994-47615016 GGTTCCTGGCAGTAAACAGAGGG + Intergenic
1157468524 18:47969299-47969321 GGTTCCTAACAGGCCATGGATGG - Intergenic
1157625202 18:49045166-49045188 GGGTCCTGGGAGGAGGAGGACGG + Intronic
1159258574 18:65980568-65980590 GGTTCCCAGCTGGAGATGGATGG - Intergenic
1159582229 18:70246126-70246148 GGTTCTTGGCAGGAAACAGATGG + Intergenic
1159775619 18:72600576-72600598 GGGGCCTGGAAGGATATGGAAGG + Intronic
1160739938 19:681006-681028 GGTTCCTGGGTGGAGATGGGCGG + Intronic
1160926586 19:1549606-1549628 GGTGCATGGTTGGAGATGGATGG - Intergenic
1160998315 19:1895499-1895521 GGTTCCTGACATGAGAAGGAAGG + Intergenic
1161332216 19:3693721-3693743 AGTGCCTGGCAGGACAGGGATGG - Intronic
1164023345 19:21328702-21328724 GGTTCATGGGAGGAGCTTGAAGG - Intronic
1164484619 19:28644307-28644329 GCTTCCTGTCAGGAGGTGGTGGG - Intergenic
1165232011 19:34393179-34393201 GGTTTCCGGCAGGAGGTGGGGGG + Intronic
1165313718 19:35042435-35042457 GGGACCTGTGAGGAGATGGACGG - Exonic
1165477555 19:36039954-36039976 GGTCCCCGGGAGAAGATGGAGGG + Exonic
1165915527 19:39256708-39256730 AGGTGCTGGCAGGAGATTGAGGG + Intergenic
1166195943 19:41206040-41206062 GTTTCCTGGATGCAGATGGACGG + Exonic
1168608171 19:57776436-57776458 GGATCCTGGGAGGAGGAGGATGG + Intronic
925156876 2:1655643-1655665 GATTCCTGTCAGGAGAAGGCAGG - Intronic
925157215 2:1657451-1657473 GGTCCCTGTCAGGAGAGGGTAGG - Intronic
925157270 2:1657697-1657719 GGTTCTTGTCAGGAGGGGGAAGG - Intronic
925540379 2:4960251-4960273 GGGACCTGGCAGGAGATGATTGG - Intergenic
925891430 2:8438133-8438155 GGTTCCTAACAGGCCATGGATGG - Intergenic
926285351 2:11483093-11483115 GGTCCCGGGAAGGAGGTGGAAGG + Intergenic
926555724 2:14355602-14355624 GGTTTCTGGGAGGGGATGGAAGG - Intergenic
927029641 2:19107137-19107159 GCTCCCTGGCTGGAGCTGGATGG + Intergenic
927249417 2:20984233-20984255 GGTGGATGGCAGGGGATGGATGG + Intergenic
927893859 2:26769055-26769077 GGTCCCAGGCAGGAGAAAGAAGG + Intronic
927969069 2:27292748-27292770 GGTACCTGGCATAGGATGGATGG - Intronic
930374181 2:50543150-50543172 GGTTCCTGGAAAAAGATAGAGGG - Intronic
930661981 2:54063792-54063814 GGGTCCTGGCAGGAAAAAGATGG - Intronic
930712244 2:54559843-54559865 GGTTCCTGTGAGGAGGAGGAAGG + Intronic
931126655 2:59285698-59285720 GGTGCCTGGAATGGGATGGAGGG + Intergenic
931306430 2:61033843-61033865 TGTTAGTGGCAGGAGATGAAGGG + Intronic
932599614 2:73114371-73114393 AGTTCCTAACAGGACATGGAGGG - Intronic
932775498 2:74525864-74525886 GTTTCCTGGCAGGAAATGCTGGG - Intronic
933881086 2:86670642-86670664 GGTCACTGGCTGGAGAAGGAAGG + Intronic
933981688 2:87555842-87555864 GAATCATGGCAGGAGATGAAGGG + Intergenic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934503940 2:94877671-94877693 GGTTGCTGGGAGGAGAGGCATGG + Intergenic
935380288 2:102444794-102444816 GGTTCCTGGGAGGTGAGGAATGG + Intronic
935927919 2:108090079-108090101 GAATCATGGCAGGAGATGAAAGG - Intergenic
936312148 2:111394975-111394997 GAATCATGGCAGGAGATGAAGGG - Intergenic
936387461 2:112042979-112043001 GGTTCCTCCCAGGTGATTGAGGG - Intergenic
936611252 2:114004239-114004261 GGGGCCTGGCAGGAGATGTTTGG + Intergenic
938554065 2:132408070-132408092 GGTTCCTAGCATAAGATGGGGGG + Intergenic
939991463 2:148879940-148879962 ATTTCTTGGCAGTAGATGGATGG + Intronic
940352594 2:152705851-152705873 GGTTCCTCCCAGGTGATTGAGGG + Intronic
941321020 2:164054810-164054832 CGTCCCTGACAGGCGATGGATGG + Intergenic
942816936 2:180062950-180062972 GGTTGTTGGGAGGAGATGGTGGG + Intergenic
942830641 2:180234813-180234835 GGTTCCTCCCAGGTGATTGAGGG + Intergenic
943449782 2:188033358-188033380 GCTTCCTGGCATGTGATGGGAGG - Intergenic
944361402 2:198861587-198861609 GATTTCTGGAAGGATATGGAAGG - Intergenic
945565123 2:211388414-211388436 TGTTTCTGGAAGGAGATGGCAGG + Intronic
945668360 2:212770495-212770517 GGCTCATGGCAGAAGATGAAGGG - Intergenic
946280709 2:218663943-218663965 GGTTCCTAGCAGGACTTGGTGGG - Exonic
946574136 2:221056396-221056418 GGATCATGGCAGGAGGTGAAAGG + Intergenic
946741347 2:222805481-222805503 GGTTCCTTTCAGGAGATGTAGGG - Intergenic
947821279 2:233072839-233072861 GGGTCCTGGCAGGAAATAGATGG + Intronic
948604314 2:239125177-239125199 GGGACCTGGCAGGAGGTGGCTGG + Intronic
948636824 2:239343634-239343656 GGTTCATGCCACGAGAGGGATGG - Intronic
1168823975 20:796452-796474 GGTTCCTCCCAGGTGATTGAGGG + Intergenic
1169282973 20:4282770-4282792 TATTCCAGGCAGGAGATGGGAGG + Intergenic
1169464722 20:5827305-5827327 GAGGCCTGGCAGGAGGTGGAAGG - Intronic
1170118864 20:12891199-12891221 GAATCATGGCAGGAGATGAAAGG - Intergenic
1170364783 20:15587142-15587164 GAATCATGGCAGGAGATGAAAGG + Intronic
1171417991 20:24996484-24996506 GGTTCCAGGCAGGAGAAGAAGGG - Intergenic
1172044410 20:32070296-32070318 AGTTTCTGGCAGGAGAATGATGG - Intronic
1172485706 20:35296673-35296695 TGTTCCTGGCTGGAGAAAGAGGG + Intergenic
1172821572 20:37739742-37739764 TGTTCCTTTTAGGAGATGGACGG + Intronic
1172899634 20:38325031-38325053 AGATGCTGGCAGGAGGTGGAGGG + Intronic
1173521653 20:43704444-43704466 GGCTGCTGGCTGGAGAAGGAAGG + Intronic
1175166029 20:57045341-57045363 GGCTCCAGGCAGGGGATGGCTGG + Intergenic
1175218820 20:57405449-57405471 GGTTCCTGGCAGGAGCTGCCTGG + Intronic
1175258641 20:57661727-57661749 GGCTGGTGGCAGGAGATGGCTGG - Intronic
1176190036 20:63804179-63804201 GGCACCTGGCTGGAGCTGGAGGG - Intronic
1176622084 21:9067490-9067512 GGTTGCTGGGAGGAGAGGCATGG - Intergenic
1178041213 21:28642709-28642731 GGGCCCTGGCCGGAGATGGCTGG - Intergenic
1178728683 21:35078956-35078978 GGTTCCTGCCTGGAAATAGAGGG + Intronic
1179410128 21:41156120-41156142 GGCTCTTTGCAGGATATGGATGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181177719 22:21047338-21047360 GGTGCCTGGCAGGAGACAGGGGG - Exonic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181450117 22:23014156-23014178 GGGGCCTGGCTGGAGATGGCTGG - Intergenic
1181573499 22:23780341-23780363 GGATCCTGGAGGGAGATGGAGGG - Exonic
1182333873 22:29570324-29570346 GGCTCCAGGAAGGAGATGGGAGG - Intronic
1182420074 22:30244718-30244740 GGATACTGACAGGAGATGGCAGG - Intronic
1182450229 22:30415741-30415763 ATTTGCTGGCAGGAGAGGGAAGG - Exonic
1183423659 22:37726106-37726128 GGATCCTGGAAGAAGAGGGATGG - Exonic
1183477049 22:38041398-38041420 GGATCCAGGCGGGGGATGGAGGG + Intronic
1184757746 22:46526455-46526477 GGTTGCTGGCATGAGTGGGATGG - Intronic
1185370449 22:50458517-50458539 GGTTTCTGGCAGGGGTGGGAAGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949610153 3:5696040-5696062 GGTTCCTCCCAGGTGATAGAGGG - Intergenic
950147959 3:10665192-10665214 GGTGCCAGGCAGGAGCTGTATGG - Intronic
950159524 3:10749605-10749627 GGTTCATGGCAGTAGGGGGAGGG + Intergenic
952090412 3:29878240-29878262 GGTTCCTAACAGGCCATGGATGG + Intronic
952144176 3:30513696-30513718 AGTTCCTGGCAGGAAACAGATGG - Intergenic
953230790 3:41063203-41063225 TATTCCTGGCAGGAGATGGTAGG + Intergenic
953334111 3:42079344-42079366 GGTACCTGGCTGGCCATGGAGGG + Intronic
953483219 3:43270432-43270454 GGTCCTTGGTAGGAGATGGGAGG + Intergenic
955338973 3:58110180-58110202 GGGGCCTGGGAGGAGATGGGTGG + Intronic
955590018 3:60525001-60525023 GGTTGATGGCAGGGGGTGGATGG + Intronic
956758008 3:72408945-72408967 AGTTCATGGCAGAAAATGGAAGG - Intronic
957614037 3:82505712-82505734 GGTTCCTGGGTGGAAAGGGATGG + Intergenic
958729692 3:97948678-97948700 GGATGCTGTCAGGAAATGGAAGG - Intronic
959419987 3:106117230-106117252 GGTAGCTGTCAGCAGATGGATGG + Intergenic
960641268 3:119825952-119825974 GTGACCTGGGAGGAGATGGAAGG - Intronic
961101958 3:124207259-124207281 CTTTCCTGGCAGGGGAAGGAGGG - Intronic
961368064 3:126413904-126413926 GGTGCCTTGCTGGAGGTGGAAGG + Intronic
962325401 3:134428103-134428125 GGGTCCTGGCAGGATCTGGAGGG + Intergenic
964233353 3:154496308-154496330 GGTTCTTGAAAGGAGATGGATGG + Intergenic
964719961 3:159761585-159761607 GGTTCCTGGCAGGAGATGGAAGG + Intronic
964836023 3:160939669-160939691 GAATCATGGCAGGAGATGAAAGG - Intronic
964927828 3:161978899-161978921 GGTTCCTGGGAGGCCATGGGCGG + Intergenic
966092605 3:176158574-176158596 GAGTACTGGCAGGGGATGGAGGG + Intergenic
966103275 3:176302529-176302551 GGTGCTTGCCAGGAGCTGGAGGG - Intergenic
966486724 3:180479287-180479309 GGATCCTGGCAAGAAATAGATGG - Intergenic
968487268 4:868680-868702 GCTTCCCTGCAGGAGAGGGAGGG + Exonic
968782190 4:2591434-2591456 GGGTTTTGACAGGAGATGGAGGG + Intronic
969387930 4:6868577-6868599 GATGCCTGGCAGGAAAGGGAGGG + Intronic
970468523 4:16352098-16352120 GGTCCCTGGCTGCAGAAGGAAGG + Intergenic
970558412 4:17258978-17259000 GGTTCATGGCAGCAAATGTAAGG - Intergenic
970652910 4:18198060-18198082 GGTCCCTGACAGGAGATAGAAGG + Intergenic
970955059 4:21801384-21801406 TGTTCCTGGCAAGAGAAAGAAGG + Intronic
971451217 4:26803775-26803797 GGTTTCTGGCAGAACAAGGAGGG + Intergenic
971545640 4:27881603-27881625 GGTGCCTGGCAGGAGGTGATTGG - Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972787476 4:42340531-42340553 GGGTCCTGGCAGGAAAGAGATGG - Intergenic
973236825 4:47914549-47914571 GGTTCCCGGCGGGAGACGCAGGG - Intronic
973664559 4:53144895-53144917 GGTTCCTAACAGGCCATGGACGG - Intronic
974121966 4:57649663-57649685 CATTCATGGCAGGAGGTGGAAGG + Intergenic
975706493 4:77117260-77117282 GGATCCTGGCAGGAAATAAACGG + Intergenic
976706556 4:88025739-88025761 GGTTCCTGGTAGGAGATGATTGG + Intronic
977571202 4:98631594-98631616 GCTTCCTAGCAGCAGTTGGATGG - Intronic
978100910 4:104840440-104840462 GAATCCTGGCAGGAGGTGAAAGG + Intergenic
978617191 4:110609851-110609873 AATTTCTGGCAGGGGATGGAGGG - Intergenic
979045791 4:115861555-115861577 GGTTCATGGCAGGAGATTTTGGG - Intergenic
979751991 4:124290387-124290409 GGGTCCTGGCAGGAAAGAGATGG - Intergenic
981609477 4:146578041-146578063 AGTTCCTAACAGGACATGGATGG + Intergenic
981799204 4:148636500-148636522 GAATCATGGCAGGAGATGAAAGG + Intergenic
982032519 4:151314877-151314899 TGTTCCTGGCAGGAGGTGGGAGG + Intronic
983291234 4:165808711-165808733 GAATCCTGGCAGGAGGTGAAAGG - Intergenic
983298131 4:165891822-165891844 GGTAACTGGCAGAAGTTGGAAGG - Intronic
984279214 4:177648147-177648169 GGTACCTGGAAGGACCTGGATGG + Intergenic
984722578 4:182989536-182989558 GGTTCCTGGGAGTGGAAGGAGGG + Intergenic
985759540 5:1738204-1738226 GGTTCCAGGCATGAGTGGGAAGG - Intergenic
986171708 5:5319682-5319704 GGTTCCTGGTAAGAGATGCTCGG - Exonic
986450063 5:7854523-7854545 GAATCATGGCAGGAGATGAAAGG + Intronic
986775912 5:11013748-11013770 GGTTTGTGGCAGGAGAAGAAAGG - Intronic
987222482 5:15804613-15804635 GGTTCCTAACAGGTCATGGATGG - Intronic
987280737 5:16411287-16411309 GGTTCCTGCAAAGGGATGGAAGG - Intergenic
988623476 5:32847079-32847101 GGATCCTAGCAGGAAATAGATGG + Intergenic
988657579 5:33229130-33229152 TGGTCCTGGCAGGAAATAGATGG + Intergenic
990867004 5:60390787-60390809 GGTTCCTGGCACGGGAGGGATGG - Intronic
992122709 5:73611021-73611043 GATTCATGGCAGGAGGTGAAAGG + Intergenic
992363054 5:76062355-76062377 GTCTCATGGCAGAAGATGGAAGG - Intergenic
993770578 5:91919498-91919520 GGTTTCTAGCAGGCCATGGATGG + Intergenic
994355653 5:98791547-98791569 GTTTCCTTGCAGGAGGTAGAAGG + Intronic
994614901 5:102092198-102092220 GAATCATGGCAGGAGATGAAAGG + Intergenic
994667390 5:102722435-102722457 TGTTCCAGGCAGGAGAATGAAGG + Intergenic
994784341 5:104136870-104136892 GGTTCCTGGCAAGAAACAGATGG - Intergenic
995824657 5:116282154-116282176 GGTTTCTGGCAGAAGCTGGAGGG - Intronic
996129524 5:119764897-119764919 TGGTACTGGCAGGAGATGGAGGG - Intergenic
997082599 5:130758288-130758310 GGGGCCTGTCAGGGGATGGAGGG + Intergenic
997830573 5:137146217-137146239 GGTTCCTGGCAGGAGAAAAGGGG - Intronic
998194470 5:140055653-140055675 GGTTCCAGGCAGGACAGGGAAGG + Intergenic
999199612 5:149806378-149806400 GGGTCCTGGCAAGAGAGTGAAGG - Intronic
999454497 5:151703449-151703471 GGTTCCTGGCAGAAAACAGATGG - Intergenic
999687713 5:154117440-154117462 GGTTCAGGGACGGAGATGGAAGG + Intronic
1000883259 5:166721239-166721261 GGGTGCAGGGAGGAGATGGAGGG - Intergenic
1001530237 5:172456080-172456102 AGGGCCTGGCAGGAGATTGAGGG + Intergenic
1001558594 5:172654372-172654394 GGTTCCTCCCAGGTGATTGAGGG - Intronic
1002086779 5:176780843-176780865 GGTTTCTGGCAGGAGATGGAAGG - Intergenic
1002416268 5:179122460-179122482 TTTGCCTGGCAGGAAATGGAGGG - Intronic
1003960170 6:11201462-11201484 GGTTGCTGGAAGCACATGGAAGG - Intronic
1004489137 6:16097447-16097469 GGTTTCTAGCAGCAAATGGATGG + Intergenic
1004591944 6:17060253-17060275 GGATCCTGGCAAGAAATAGAAGG + Intergenic
1005323881 6:24680970-24680992 GGTTCCTCCCAGGTGATTGAGGG - Intronic
1005843540 6:29760262-29760284 GGGTCCTGGCAGGAAAGAGATGG + Intergenic
1006385677 6:33729489-33729511 GGGCACTGGCAGGAGATGGGAGG + Intronic
1006895145 6:37463376-37463398 GTTTGGAGGCAGGAGATGGATGG + Intronic
1006902539 6:37512480-37512502 GGATGCAGGCAGGAGGTGGAAGG - Intergenic
1006907782 6:37544734-37544756 GGGTCCTGGCAGGAAACAGATGG - Intergenic
1006927540 6:37665577-37665599 GGTGTCTGGCAGTAGATGGTCGG - Intronic
1007073434 6:39052371-39052393 GGGTCCTGGGAGGAGATGCCAGG + Intronic
1007101405 6:39249826-39249848 GGTGTCTGGCAGTAGATGGTCGG + Intergenic
1007178282 6:39911154-39911176 AGGTCTTGGCAGGAAATGGAAGG - Intronic
1007287430 6:40757823-40757845 GGGTCCTGGCAGGAAAGAGATGG + Intergenic
1009351350 6:62683634-62683656 GGTTTCTGGTAGGAGAAGCAAGG + Intergenic
1011076632 6:83445577-83445599 GGTTCCTCCCAGGTGATTGAGGG + Intergenic
1012067389 6:94565304-94565326 GAATCATGGCAGGAGGTGGAAGG - Intergenic
1012198588 6:96376748-96376770 GGTCACTGGCAGGAGATCAAAGG + Intergenic
1013328082 6:109068230-109068252 GGATCCTAGCAGAAAATGGATGG - Intronic
1013706363 6:112839657-112839679 AGTTACTGGCAGGAGATTGGAGG + Intergenic
1013964755 6:115941332-115941354 GGGGCCTGTCAGGGGATGGAGGG + Exonic
1014344680 6:120253187-120253209 GGTGCCTGTCAGGAAGTGGAGGG + Intergenic
1017384695 6:153869862-153869884 GGGTCCTGTCAGGAGGTAGAGGG + Intergenic
1017775452 6:157676822-157676844 GGTTCCTGGCATGAAGAGGATGG - Exonic
1018247995 6:161840602-161840624 GGGGCCTGGCAGAAGGTGGAGGG - Intronic
1018793205 6:167165720-167165742 GGGTCCTGGTAGGAGATGATTGG + Intronic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1019463573 7:1174244-1174266 GGTTCCTGGCCCTGGATGGATGG - Intergenic
1019806887 7:3134180-3134202 GGGTCCTGGCAGGAAACAGATGG - Intergenic
1019852171 7:3570437-3570459 GGTTCCTAACAGGCTATGGACGG + Intronic
1020745250 7:12071751-12071773 GGATCATGGTAGGAGAAGGAAGG - Intergenic
1021969967 7:25956161-25956183 GGTTGCTGGTAGGACGTGGAGGG + Intergenic
1023798942 7:43816244-43816266 GGTTCCTCCCAGGTGATTGAGGG + Intergenic
1025217249 7:57069204-57069226 GGAGCCTGACAGGAGGTGGAGGG + Intergenic
1025654099 7:63501259-63501281 GGAGCCTGACAGGAGGTGGAGGG - Intergenic
1025721530 7:64020283-64020305 GGCTCCTGGCCTGTGATGGAAGG - Intergenic
1025748682 7:64271511-64271533 GGCTCCTGGCCTGTGATGGAAGG - Intergenic
1026295126 7:69044891-69044913 GAATCATGGCAGGAGGTGGAAGG + Intergenic
1028210345 7:88066783-88066805 GGTTCCTGGTAGGAAATTGAAGG + Intronic
1028333825 7:89626956-89626978 GGTTCCTCCCAGGTGATTGAGGG + Intergenic
1028507094 7:91582659-91582681 GGGTCCTGGCAGGAAACAGATGG + Intergenic
1028577659 7:92370181-92370203 GGTGGCTGGCAGGGGATGGGAGG + Intronic
1028668795 7:93377128-93377150 GGTTCCTGGGAGGAGTTGTTTGG + Intergenic
1028914297 7:96241934-96241956 GGAGCCAGGCAGGAGATGAAAGG - Intronic
1029284398 7:99455964-99455986 GTTCCCTGGCAGGAGATGGGAGG - Intronic
1029373991 7:100167068-100167090 GCGTCCTGGCAGGAGAGAGAGGG + Exonic
1029550671 7:101235655-101235677 GGTCCCTGCCAGGAGATGCAGGG + Intronic
1029836134 7:103312967-103312989 GGTGCCTGGCAGGACAAAGAAGG - Exonic
1032364289 7:131284955-131284977 GCTTCCTGGCAGGGCCTGGAAGG + Intronic
1032563207 7:132913739-132913761 GGTTACTAGCAGCAGAGGGAAGG + Intronic
1032721867 7:134556551-134556573 GGTGCCTGGTAGGAGACTGAGGG - Intronic
1033628282 7:143132337-143132359 GGAACCTGGCAGGAGATCCATGG - Intronic
1033641229 7:143264530-143264552 GTTTCCTGCCAGGAGAAGGTTGG - Exonic
1034432778 7:151049432-151049454 GGTCCCTGGCAGGATAGGTAGGG - Intronic
1034475006 7:151276789-151276811 GGTGCCAGGCAGGAGAAGGAGGG + Intronic
1034693042 7:153029220-153029242 GGTTACTGGAAGGGGAAGGAAGG - Intergenic
1035378000 7:158419596-158419618 GGCTCCTGGCGTGACATGGAAGG - Intronic
1035573530 8:689539-689561 GGTGTCTGGCAGGAGCAGGAAGG + Intronic
1036037999 8:5041111-5041133 AGGTCCTGGCAGGAAATGGTTGG - Intergenic
1036452526 8:8881401-8881423 AGTTCCTGGAAGGTCATGGAAGG - Intronic
1036513718 8:9423915-9423937 GTTTCCTGGCAGAATGTGGATGG + Intergenic
1037053768 8:14409994-14410016 GGTTCCTAACAGGCCATGGAGGG - Intronic
1037533918 8:19807545-19807567 GGGACCTGGCAGGAGATGATTGG - Intergenic
1037686165 8:21141431-21141453 AGATCCTAGCAGGAGATGGAGGG + Intergenic
1038380184 8:27085513-27085535 GGTGCTTGCCAGGAGCTGGAGGG + Intergenic
1038613046 8:29071517-29071539 GGGTCCGGGCAGGAGAGGGAGGG - Intronic
1039064471 8:33597175-33597197 GGTTCCTGGTTGAAGATTGAGGG - Intronic
1039206545 8:35161923-35161945 GGTTCCAGGCAGGAGCTGGGAGG - Intergenic
1040677579 8:49768787-49768809 GGTTCCTGTGTGGGGATGGATGG + Intergenic
1041782020 8:61587158-61587180 GGTTTCTGGGAGGAGAGAGAAGG - Intronic
1042076521 8:65001295-65001317 ATTTCATGGCAGAAGATGGAAGG + Intergenic
1045023500 8:98064468-98064490 GGGAGCTGGCAGGAGGTGGAAGG - Exonic
1046036218 8:108844441-108844463 GCTTTCTGGCAGGGGGTGGATGG + Intergenic
1046806569 8:118485912-118485934 GGGTCCTGGCAGGAAACAGATGG + Intronic
1047006966 8:120630533-120630555 GGATCCTGGCAGGAGATGGATGG - Intronic
1047018124 8:120745359-120745381 AGGTCCTGGCAGGAAATGGATGG - Intronic
1048067239 8:130983079-130983101 GTTTCCTGGCAGGACATAGCTGG + Intronic
1048107709 8:131429494-131429516 GGTCCCGGGCAGGAGAAAGAAGG - Intergenic
1048999703 8:139816829-139816851 GGTTCCAAGCAGCTGATGGAAGG - Intronic
1049777437 8:144413202-144413224 GGGGCCTGGAAGGAGATGGGCGG - Intronic
1049843885 8:144790527-144790549 GGTGCATGACAGGAGATTGAGGG - Intronic
1050085887 9:1965377-1965399 GGTTCCCAGCAGGAAATAGATGG + Intergenic
1050211517 9:3263829-3263851 AGGCACTGGCAGGAGATGGAAGG + Intronic
1050431735 9:5569174-5569196 AGATCCTAGCAGGAAATGGAGGG + Intronic
1050524649 9:6534860-6534882 GGCTCCTGTCAGAAGATTGACGG - Intronic
1051294632 9:15582771-15582793 GGGGCCTGGCAGGAGGTGGGGGG + Intronic
1051590675 9:18774174-18774196 GGATGCAAGCAGGAGATGGATGG - Intronic
1051655353 9:19376077-19376099 GGTTCCTTTCAGGGGATGGGTGG - Exonic
1051728702 9:20115321-20115343 GATTTCGGGCAGGAGATTGAAGG + Intergenic
1052146593 9:25058298-25058320 GGGTCCTGTCAGGGGATGGGGGG - Intergenic
1052538661 9:29778832-29778854 GGTTCCTCCCAGGTGATTGAGGG - Intergenic
1052828852 9:33198360-33198382 GGCTCCTGGCAGCAGCTGGCTGG + Intergenic
1052995125 9:34547841-34547863 GGTGCCTGCCTGGAGATGCAGGG - Intergenic
1055829437 9:80360659-80360681 GGAGCCTGGCAGGATCTGGATGG - Intergenic
1058309307 9:103482178-103482200 GTTTCCTGGGAAGAGTTGGATGG - Intergenic
1058347376 9:103980135-103980157 GGATCCTGAAAGGAGAGGGATGG - Intergenic
1058976141 9:110127220-110127242 GCTTCATGGCAGGAGATCCATGG + Intronic
1059391493 9:114002220-114002242 GGTGCCAGGCAGGAGAAGGGAGG + Intronic
1060229856 9:121818590-121818612 AGTTCTTGGAAGTAGATGGAAGG + Intergenic
1060483255 9:124030288-124030310 TGTCTCTGGCAGGAGAGGGAGGG - Intronic
1060846096 9:126838822-126838844 GGGTCCTGGCAGGAGACAGATGG - Intergenic
1060924705 9:127448068-127448090 GGTTCATAGCAGGCAATGGAAGG + Intronic
1061284009 9:129612169-129612191 GGTTCCTGGAAGGAAGGGGATGG - Intronic
1061484668 9:130914274-130914296 GGTGCCTGGCAGGAGATGCTCGG - Intronic
1062463551 9:136671687-136671709 GGTCCCTGGCAGGAGAACTAGGG - Intronic
1062623596 9:137433428-137433450 GGGTCCAGGCAGGAGGGGGAGGG - Intronic
1203745279 Un_GL000218v1:37912-37934 GGTTGCTGGGAGGAGAGGCATGG - Intergenic
1187122720 X:16424755-16424777 GGTTGCTGACTGGAGTTGGATGG - Intergenic
1188136974 X:26503373-26503395 GGTTCCTCCCAGGAGATTAAGGG + Intergenic
1189723190 X:43941323-43941345 GGCTCCAAGCAGCAGATGGATGG - Intergenic
1189921076 X:45903819-45903841 GGATCCTGGCAGGAAACAGATGG - Intergenic
1190509272 X:51160273-51160295 GGTACCTGGCAGGGAATGGGTGG - Intergenic
1191016336 X:55813727-55813749 GGCTCCTGGGAGGAAAGGGATGG + Intergenic
1193614700 X:83672553-83672575 GAATCATGGCAGGAGATGAAAGG - Intergenic
1194159628 X:90434699-90434721 GATTCATGGCAGGAGGTGAAAGG - Intergenic
1195229225 X:102829424-102829446 GGTTCCTTGCTGGAAATGCAAGG + Intergenic
1195890418 X:109687565-109687587 GGGGCCTGTCAGGGGATGGAGGG + Intronic
1196893025 X:120308764-120308786 GGTTGCTGGGAGGGGATGGGGGG + Intronic
1197260173 X:124308940-124308962 GGAGCCTGGTAGGAGATGGCAGG + Intronic
1198093606 X:133356176-133356198 GGGGCCTGGCAGGAGATGTTTGG + Intronic
1199066942 X:143430561-143430583 GGTATGTGGCAAGAGATGGAAGG - Intergenic
1199437821 X:147832689-147832711 CATTCCAGGCAGGAGATGGGAGG + Intergenic
1199851275 X:151726342-151726364 GCTTCCTGGCAGCTGGTGGAAGG + Intergenic
1199987189 X:152961207-152961229 GGATCATGGCAGGAGAGTGAAGG - Intronic
1200132114 X:153855921-153855943 GGTGCTTGGCAGAAGGTGGATGG - Intergenic
1200213035 X:154355315-154355337 GGTGCCTGGGAGGAAAAGGAAGG + Intronic
1200318981 X:155165088-155165110 GGTTCATGGAAAGAGATGGGTGG + Intergenic
1201158601 Y:11152931-11152953 GGTTGCTGGGAGGAGAGGCATGG - Intergenic
1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202224298 Y:22585515-22585537 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202551952 Y:26059912-26059934 CTTTCCTTGCTGGAGATGGAGGG - Intergenic