ID: 964721463

View in Genome Browser
Species Human (GRCh38)
Location 3:159770767-159770789
Sequence CCTCCCTTCAGGTGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 313}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964721451_964721463 23 Left 964721451 3:159770721-159770743 CCTTTTCCCATTGCTCTATTCCA 0: 1
1: 0
2: 0
3: 42
4: 439
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313
964721454_964721463 3 Left 964721454 3:159770741-159770763 CCATCTGCATCCTGCTTTCCAGG 0: 1
1: 0
2: 3
3: 48
4: 430
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313
964721449_964721463 25 Left 964721449 3:159770719-159770741 CCCCTTTTCCCATTGCTCTATTC 0: 1
1: 0
2: 1
3: 39
4: 455
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313
964721456_964721463 -7 Left 964721456 3:159770751-159770773 CCTGCTTTCCAGGACACCTCCCT 0: 1
1: 0
2: 3
3: 38
4: 312
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313
964721452_964721463 17 Left 964721452 3:159770727-159770749 CCCATTGCTCTATTCCATCTGCA 0: 1
1: 0
2: 1
3: 23
4: 227
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313
964721450_964721463 24 Left 964721450 3:159770720-159770742 CCCTTTTCCCATTGCTCTATTCC 0: 1
1: 0
2: 3
3: 56
4: 461
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313
964721453_964721463 16 Left 964721453 3:159770728-159770750 CCATTGCTCTATTCCATCTGCAT 0: 1
1: 1
2: 0
3: 25
4: 313
Right 964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG 0: 1
1: 0
2: 1
3: 28
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964721463 Original CRISPR CCTCCCTTCAGGTGGCTGGG TGG Intronic
900211027 1:1455965-1455987 CCTGCCTGCAGGTGTCTGGGGGG + Intronic
900223934 1:1524013-1524035 CCTGCCTGCAGGTGTCTGGGGGG + Intronic
900360020 1:2283927-2283949 CCTTCCTGCAGGAGGCGGGGAGG + Intronic
900413716 1:2525651-2525673 CTCCCCTAGAGGTGGCTGGGAGG + Intronic
900828355 1:4945091-4945113 CCTCCCTTCATGGCTCTGGGAGG - Intergenic
901631679 1:10651139-10651161 CCTCCCTCCAGGGGGCACGGCGG - Intronic
902399553 1:16150557-16150579 CCTCCCAAGAGGTGGATGGGTGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
904597756 1:31657449-31657471 CCTCTCTTCTGGTGGCTGCTGGG + Intronic
905445441 1:38025743-38025765 CCTACCTTCATGTGGGTGTGTGG - Intergenic
907550946 1:55304399-55304421 CCTCCCTACAGGTGTCTCAGGGG + Intergenic
908239504 1:62176960-62176982 TCTCCATTCAGTTGGTTGGGGGG - Intergenic
909051659 1:70774689-70774711 CCTGCCTACTGGTGGCTGGCTGG + Intergenic
909684015 1:78325476-78325498 CCTGCCACCAGGTGGCTGGCTGG + Intronic
909975546 1:82042389-82042411 TCTCTCTTCAGGTGTCTGGCAGG + Intergenic
912774113 1:112493372-112493394 CAGCACTTCAGGAGGCTGGGAGG + Intronic
913281055 1:117185470-117185492 GGTCCATTCAGGTGGTTGGGGGG - Intronic
913414333 1:118588807-118588829 GGTCCATTCAGATGGCTGGGGGG + Intergenic
914667856 1:149847003-149847025 CCTCCCTTAAGGTCTCTGGAGGG - Intronic
915835782 1:159173408-159173430 CCTCCCTATAGTTGGCTGGCTGG + Intronic
916501724 1:165393163-165393185 CCTCCCCTGGGGAGGCTGGGCGG + Intergenic
916991634 1:170250993-170251015 CCTCTCTGCAGGGGGCTGGCAGG + Intergenic
917152889 1:171963860-171963882 CATCCATTCAGGTGGATGGGGGG - Intronic
918177254 1:182057247-182057269 CGTCCCTACAGGTGCCTGCGGGG - Exonic
919767391 1:201136122-201136144 CCTCCCTTGAGCTAGCTGTGTGG - Intronic
920311729 1:205052649-205052671 CTTCCCCTCAGCTGTCTGGGTGG - Intronic
923317851 1:232798881-232798903 CCTGCCTTCAGTTAGCAGGGAGG - Intergenic
923377516 1:233379343-233379365 CCTCCCCACAGGTGGATGGCAGG - Exonic
923440798 1:234018352-234018374 CCTCCATTCAGCTGGCTCTGAGG + Intronic
923926050 1:238628817-238628839 CATTCCTCCAGGTAGCTGGGGGG - Intergenic
924262635 1:242247702-242247724 GCTCCGTTCAGCAGGCTGGGGGG + Intronic
1062825865 10:568144-568166 CCTCCCTTTTGGGGGCTTGGTGG - Intronic
1063006355 10:1974755-1974777 CCTCCCTCCAGGTGCCTCCGAGG + Intergenic
1063661277 10:8036455-8036477 CCTCTCTTGGGGTGGGTGGGGGG - Intergenic
1065888686 10:30101704-30101726 GGTCCATTCAGGTGGTTGGGGGG + Intronic
1067312558 10:45127675-45127697 CCTGCCTTAAGGTCTCTGGGTGG + Intergenic
1067542268 10:47164651-47164673 CAGCCCTTCAACTGGCTGGGAGG + Intergenic
1067797518 10:49331609-49331631 CCTTCCACCAGGTGGATGGGTGG + Intergenic
1068261945 10:54594471-54594493 GCCCCCTTGAGGTGCCTGGGGGG - Intronic
1068661415 10:59627099-59627121 CCTCCGTCAAGCTGGCTGGGTGG - Intergenic
1069811235 10:71161363-71161385 CCTAGCTTCAGGTGGCTTGCTGG - Intergenic
1070327030 10:75396130-75396152 CCGCCCTGCAGGTGGGAGGGCGG - Intergenic
1070601265 10:77868022-77868044 CCTCGCTTCTGGTGGCTTGCTGG - Intronic
1070888231 10:79923134-79923156 CCTTCCTTCATGTGGATGGGAGG + Intergenic
1071288927 10:84174089-84174111 ACTGCCTGCAGGTGGCTTGGGGG + Intronic
1071433401 10:85624079-85624101 CCTACTTACAGGTGGCTGTGGGG + Intronic
1075651952 10:124133033-124133055 CCTCCCTGCAGATGCTTGGGTGG + Intergenic
1075856121 10:125631671-125631693 CCTCCCTTCTGGTGGGTAGGGGG + Intronic
1076244878 10:128939062-128939084 CCTCCCCTCAAGTGTTTGGGAGG - Intergenic
1076428903 10:130388039-130388061 CTTCCCTTCAGGTTGGAGGGTGG + Intergenic
1077099596 11:816196-816218 CCTCCCTCCAGGCCCCTGGGAGG - Intergenic
1077174290 11:1181631-1181653 CCCCACTGCAGGTGGCTGGTGGG - Intronic
1077269342 11:1667738-1667760 CCTCACTCCAGGTGGGTGGGGGG + Intergenic
1083006889 11:59355386-59355408 CATCAGTTCAGGTGCCTGGGAGG + Intergenic
1083675544 11:64322925-64322947 ACTCCCTGTAGGTGGCTGAGAGG - Intergenic
1084360218 11:68664388-68664410 CCACCCTCGAGGTGGCTGGGCGG - Intergenic
1084400840 11:68942063-68942085 GCTCCATGCAGGAGGCTGGGGGG - Intergenic
1084881849 11:72177330-72177352 CCTCTCTGCAAGTGGCTGGCAGG - Intergenic
1084914476 11:72418072-72418094 CCTCCATTCATGTGGATGGAAGG - Intronic
1085521397 11:77140884-77140906 CCTCTCTTCATGTGAATGGGAGG - Intronic
1085596971 11:77820018-77820040 TCTCCCTTCACCTGGGTGGGCGG - Intronic
1089183471 11:116598783-116598805 TCCCCTTTCAGGTGGCTGGAAGG - Intergenic
1089572620 11:119420437-119420459 CTCCACTTCAGGTGGGTGGGAGG - Intronic
1090409817 11:126500213-126500235 CCTCACATCAGGTGGCTTTGGGG - Intronic
1092247317 12:6871024-6871046 CCTCCCTCCAAGTGGCTCTGGGG + Exonic
1094427022 12:30326819-30326841 CCTGCCATCAGGTGGCTGGCTGG + Intergenic
1095332024 12:40977480-40977502 GTTCCTTTCAGATGGCTGGGGGG + Intronic
1096123835 12:49105625-49105647 CCTCCCTATTGGTCGCTGGGAGG + Intronic
1096478086 12:51920915-51920937 TCTGCCTGCAGGGGGCTGGGGGG + Exonic
1096773538 12:53950965-53950987 CCTCCCTGCCGGTGCCCGGGAGG - Intergenic
1097053613 12:56237768-56237790 CCTCCATTCCTGTGGTTGGGGGG - Exonic
1097247264 12:57613432-57613454 CTCCTCTTCAGGTGGCTGGAAGG - Exonic
1101163451 12:102004285-102004307 TGTCCATTCAGGTGGCTGGGGGG - Intronic
1101505522 12:105342608-105342630 TCTCTCTGCAGGTGGCAGGGTGG + Intronic
1102559436 12:113751813-113751835 GCTCCCTTCTGGTGACTGGCAGG + Intergenic
1104717324 12:131024804-131024826 GCTCCCTTCTCGTGTCTGGGAGG - Intronic
1104852492 12:131883988-131884010 CATCCTTTCATGTGGCTGAGAGG - Intergenic
1105812852 13:24009921-24009943 CATCCATTCAGATGGTTGGGGGG + Intronic
1106927900 13:34632302-34632324 AGTCCATTCAGTTGGCTGGGGGG - Intergenic
1108024990 13:46168422-46168444 CCTCGCTCCTGGGGGCTGGGGGG + Intronic
1108526000 13:51286547-51286569 CATCCCTGAAGGTGGCTGTGGGG + Intergenic
1111706938 13:91761870-91761892 CCTCCCTGGAGGTTGGTGGGAGG + Intronic
1112919465 13:104593840-104593862 CCTGAATTCAGGTGGGTGGGTGG + Intergenic
1113381153 13:109807424-109807446 CCTCCTTTCATGGGGCTGGGGGG + Intergenic
1113557595 13:111251047-111251069 CCTCCCTTTAGGTTGCTGGTTGG + Intronic
1114861522 14:26528924-26528946 TCTCACTTCAGCTGGCTGGGAGG - Intronic
1121089906 14:91174032-91174054 CCTCCCTGGAGGTTGCGGGGAGG - Intronic
1121449655 14:93999074-93999096 CCTCCCCTCTGGGGGCTGGTGGG + Intergenic
1121704839 14:95983773-95983795 CCTCTCTTCAGGGGGCTGATGGG + Intergenic
1122005662 14:98701504-98701526 CTTCCCTTCTGGAGGCTGGTGGG + Intergenic
1122419302 14:101565047-101565069 CGTCCCTACCGGTGGCTTGGGGG + Intergenic
1122488641 14:102098056-102098078 TCTCCCTGGAGGTGGCAGGGAGG - Intronic
1122549701 14:102543389-102543411 TTTCCGTTCCGGTGGCTGGGTGG + Intergenic
1124593837 15:31077574-31077596 CCTTCCTGCAGGTGGGAGGGAGG + Intronic
1125504834 15:40261694-40261716 CCTCCCTTTAGGTGGTTGATTGG + Intronic
1125834514 15:42737362-42737384 CCTCCCTTCAGGTCGCTCCAGGG - Intergenic
1126563988 15:50075707-50075729 GTTTCCTTCAGGTGGGTGGGTGG - Intronic
1127396941 15:58550600-58550622 CCTACCCTCAGGGGGCTCGGTGG + Intronic
1128356598 15:66931911-66931933 CCTCCCGGGAGCTGGCTGGGGGG + Intergenic
1129616721 15:77104710-77104732 CCTCACTCCAGGAAGCTGGGAGG + Exonic
1131026774 15:89149599-89149621 CTTCCAGTCAGGTTGCTGGGGGG - Intronic
1132113197 15:99117232-99117254 CTTCCCACCACGTGGCTGGGTGG + Intronic
1132473892 16:122805-122827 CATCCCTTTAGGTGGGTGGGGGG - Intronic
1132613690 16:830029-830051 CCTTCCTTCTTGTGGCTGAGTGG + Intergenic
1132643613 16:988951-988973 CCTCCCAGCAGCTGCCTGGGAGG + Intergenic
1132931861 16:2462747-2462769 CCTCAGTGCAGGTGGCAGGGTGG - Intronic
1133121647 16:3612073-3612095 CCGCGCTTCAGGTGCCTGGAGGG + Intronic
1133209950 16:4258014-4258036 TCTCCCTTCTGGGGGCTGGAGGG - Exonic
1133909553 16:10052563-10052585 TCCGCCTTCAGGTTGCTGGGAGG + Intronic
1134592693 16:15468600-15468622 GCTCCATTCAGATGGTTGGGGGG + Intronic
1134866288 16:17610360-17610382 GGTCTCTTCAGGTGGTTGGGGGG - Intergenic
1134886737 16:17799924-17799946 CATCCCCTCAGGTAGGTGGGTGG + Intergenic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1137614591 16:49838982-49839004 GCTCCCCTCGGGTAGCTGGGCGG + Intronic
1138418629 16:56885512-56885534 CCTGTCTTGTGGTGGCTGGGTGG - Intronic
1139557095 16:67719229-67719251 CCTTCCTTAAGGCGGATGGGTGG - Exonic
1139949753 16:70663186-70663208 TCTCCCTCCAGGAGGCGGGGCGG - Exonic
1140219049 16:73030429-73030451 CCTCTTTCCAGGTAGCTGGGAGG + Intronic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141064480 16:80902769-80902791 TCTCCCTCCAGGAGGCTGGGTGG - Intergenic
1142002587 16:87671974-87671996 CCTCGCTTCAGGTGCCTGACGGG + Intronic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142194910 16:88734863-88734885 CCCTCTTCCAGGTGGCTGGGGGG - Exonic
1142251189 16:88992803-88992825 TCTCCCATCAGCTGCCTGGGTGG + Intergenic
1142251199 16:88992834-88992856 CCCCCCATCAGCTGCCTGGGTGG + Intergenic
1143734237 17:8899266-8899288 CCTGCTTTGATGTGGCTGGGTGG - Intronic
1144630579 17:16870197-16870219 CCACCCTGCAGGTGGCAGGAAGG - Intergenic
1144650746 17:17005258-17005280 CCACCCTGCAGGTGGCAGGAAGG + Intergenic
1144711490 17:17404307-17404329 CCTCCCATCAGAGGGCTGAGGGG - Intergenic
1144778729 17:17797468-17797490 CCTGCCCTCCGGGGGCTGGGAGG - Exonic
1144826285 17:18107502-18107524 CCTCAGTGCAGGGGGCTGGGAGG - Exonic
1145278326 17:21450098-21450120 CCTCCCAGCAGGTGGCAGGATGG - Intergenic
1145316149 17:21735994-21736016 CCTCCCAGCAGGTGGCAGGATGG - Intergenic
1145401127 17:22533938-22533960 CCTCCCAGCAGGTGGCAGGATGG + Intergenic
1145714579 17:27007919-27007941 CCTCCCAGCAGGTGGCAGGATGG - Intergenic
1145771495 17:27496524-27496546 CCTCCCTTCTGTTGGAAGGGAGG - Intronic
1145944266 17:28761181-28761203 CCTCCCATCAGGGGGCTCAGCGG + Intronic
1147184470 17:38705844-38705866 CTTCCCTTCAGGTGGGGTGGGGG - Intronic
1147361534 17:39933819-39933841 CCTCCCTTCAGGAAGCAGGTGGG - Intergenic
1148021211 17:44555225-44555247 TCTGCCTTGGGGTGGCTGGGAGG + Intergenic
1148682787 17:49484265-49484287 CCTGCCTGCAGGGGGCTGTGAGG + Intergenic
1149789719 17:59466468-59466490 CCTCGCTTCTGGTGGCTTGCTGG - Intergenic
1151348836 17:73519584-73519606 ACTCCCCTAAGGAGGCTGGGAGG - Intronic
1152592801 17:81222175-81222197 CCTCCCTTCTTCTGGCTTGGAGG - Intronic
1153137530 18:1933846-1933868 GCTACCTACAGGTGGCTGGCAGG + Intergenic
1156255091 18:35387273-35387295 CCTGCCACCAGGTGGCTGGCTGG - Intergenic
1156546364 18:37967526-37967548 CCTGCCTCCAGGTAGCTGGCTGG - Intergenic
1159600646 18:70425724-70425746 CTTCCCTTCAGTTGGCAGGGAGG + Intergenic
1159769912 18:72537644-72537666 CCCCCCACCATGTGGCTGGGAGG - Exonic
1160345377 18:78127966-78127988 CCTCGCCCCAGGTGGATGGGAGG - Intergenic
1160438747 18:78872345-78872367 CCTCCACTCAGGTGGCTCCGAGG - Intergenic
1160657942 19:282868-282890 CCTCCCTTCTGTGGGCGGGGCGG - Intronic
1160939141 19:1611993-1612015 CCTTCCTTGAGAAGGCTGGGGGG + Intronic
1161567927 19:5013675-5013697 CCTCCCATGAGGAGGCTGTGAGG + Intronic
1162530507 19:11233392-11233414 CATCACATCAGGTGGGTGGGTGG - Intronic
1162774354 19:12969974-12969996 CCTTCGTTCAGGTGAGTGGGTGG + Exonic
1163112473 19:15170024-15170046 CCTCCCCTCAGGGTACTGGGTGG - Intronic
1163131550 19:15276573-15276595 CCTGCCTTCAGGTTCCTAGGGGG - Intronic
1163403137 19:17106546-17106568 CCTCCCAGCAGGTGGCCAGGGGG + Intronic
1163519015 19:17781022-17781044 CCACCATTCTGGTGTCTGGGAGG + Intronic
1163585693 19:18162268-18162290 CCTCCCTGCAGGATGCTGAGTGG + Exonic
1164966988 19:32493753-32493775 GGTCCATTCAGGTGGTTGGGGGG + Intergenic
1165042731 19:33080777-33080799 TTTCCCTGGAGGTGGCTGGGTGG + Intergenic
1165882705 19:39054792-39054814 CCTGCCTTCTGGAGGCTCGGGGG + Intergenic
1165932622 19:39369851-39369873 CCTCCAGTGTGGTGGCTGGGTGG - Exonic
1166655095 19:44605336-44605358 CCTACCTTCAGGTGGAAGTGGGG - Intergenic
1167292233 19:48630650-48630672 CCTCCCTTGCGGGGGCGGGGAGG - Exonic
1167322730 19:48806505-48806527 ACTCCCTGCAGGTGGCATGGCGG - Exonic
1167356875 19:49009955-49009977 CGTCCCTACAGGGGGATGGGGGG - Exonic
1167574316 19:50310430-50310452 CCTCCCTTCTGGTTGCTCTGAGG + Exonic
1168180389 19:54658729-54658751 CCTCCCTTCTGGCTGCTGTGTGG + Intronic
925112520 2:1348243-1348265 AGTCCATTCAGATGGCTGGGGGG - Intronic
925371591 2:3349437-3349459 CCTCCCTGGAGCTGGCTGTGTGG - Intronic
925579415 2:5395424-5395446 CCTGCCTTAAGATGGCTGGCTGG - Intergenic
926435827 2:12836542-12836564 CCTCCTCTCAGGCGGGTGGGAGG + Intergenic
926748493 2:16179876-16179898 CCTCCCTGCAGGTGCCTGCCTGG - Intergenic
928862511 2:35875426-35875448 CCTCTCCTCAGGTGGCAGGAAGG + Intergenic
932454916 2:71843418-71843440 CCTCCTGTCTGGTTGCTGGGTGG - Intergenic
933228601 2:79779812-79779834 GGTCCATTCAGATGGCTGGGGGG - Intronic
933808395 2:86016773-86016795 TCTCCCTTCAGCTGGCTCTGGGG + Intergenic
933812838 2:86043931-86043953 CATCACTTGAGGTGGCTGGAGGG - Intronic
934939803 2:98492540-98492562 CCTGCTTTCAGCTGGCTAGGAGG + Intronic
936063904 2:109316275-109316297 CCTCGGTCCAGGAGGCTGGGTGG + Intronic
937085809 2:119170829-119170851 CCTCCCTTCAGGACGCAGAGGGG - Intergenic
938153749 2:128909937-128909959 CCTCACTGAAGGAGGCTGGGGGG - Intergenic
938927823 2:136060591-136060613 CCTCCATCCAGCTGCCTGGGAGG + Intergenic
940324133 2:152407436-152407458 CCTCCCTTCAGGGGTGTGGGTGG + Intronic
941907886 2:170734705-170734727 AGTCCATTCAGTTGGCTGGGGGG - Intergenic
942937994 2:181581713-181581735 CCTGCCACCAGGTGGCTGGCTGG + Intronic
945172174 2:207008256-207008278 CCCTCCTTCATGTGCCTGGGGGG + Intergenic
946396600 2:219446471-219446493 CCTCCCTGCAGGTGGCTGGCTGG + Intronic
948989152 2:241543045-241543067 GCTGCCTCCAGGAGGCTGGGCGG - Intergenic
1170677679 20:18497305-18497327 CCTGCCTTCCGCTGGCTGCGTGG + Intergenic
1171465036 20:25321399-25321421 CCTCCTTTCAGGAAGCTGGTGGG + Intronic
1173201760 20:40959953-40959975 CCTCCCTGCAGGAGGAGGGGAGG + Intergenic
1173966012 20:47113450-47113472 CCCCACTGCAGGTGGCTTGGTGG - Intronic
1174551852 20:51367842-51367864 CAGCTATTCAGGTGGCTGGGAGG + Intergenic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1179159081 21:38876953-38876975 ACTCATATCAGGTGGCTGGGGGG - Intergenic
1179551358 21:42146014-42146036 CCTCCCTTCCCGTTTCTGGGAGG + Intergenic
1179566253 21:42250908-42250930 CTTCCCTTCATGTGTCTGGTGGG - Intronic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1179981522 21:44898286-44898308 CCTCCCTGCAGGGGTGTGGGCGG - Intronic
1180597965 22:16991630-16991652 CTTCCCTACAGGTGGCTGAGAGG + Intronic
1180866781 22:19124295-19124317 GGTCCATTCAGATGGCTGGGGGG + Intergenic
1181936668 22:26443697-26443719 CCTGCCGTCAGGTGGCTGAAGGG - Exonic
1182297510 22:29318475-29318497 CCTCCCGACAGGGGGCTGAGTGG - Intronic
1182414820 22:30214595-30214617 CCTCCTTCCAGGTGGCTGTGAGG - Intergenic
1182505560 22:30779825-30779847 CGGCCCTTTTGGTGGCTGGGTGG + Intronic
1183167073 22:36156008-36156030 GCTCCCTGCAAGTGGCTGTGGGG + Intronic
1184172073 22:42765727-42765749 CCTCCCTCCAGGGGGAAGGGAGG - Intergenic
1184372171 22:44089599-44089621 GCACCGTTCAGGTGGCGGGGGGG + Intronic
1184986209 22:48137091-48137113 AGTCCATTCAGATGGCTGGGGGG + Intergenic
1185082772 22:48718876-48718898 CCTCCCTTCATGTGACAAGGTGG + Intronic
950431500 3:12953667-12953689 TCTTCCTTCATGTGGTTGGGTGG - Intronic
950831353 3:15878917-15878939 CCCACCTCCAGGTGACTGGGGGG + Intergenic
952954615 3:38549348-38549370 CCTCTCTTCCGATGGCTGGCTGG + Exonic
953009873 3:39014850-39014872 TCTACCATCAGGTGGCTGGCTGG + Intergenic
953927486 3:46989778-46989800 CCTCCCATCAGGTGGAGGGGTGG + Intronic
954369071 3:50160817-50160839 CCTCCCATCAAGGGGCAGGGTGG - Intronic
958719430 3:97825686-97825708 CCTCCACCCAGGTGGGTGGGAGG + Intronic
960154984 3:114290619-114290641 CCTCCCGTGAGGTGGCTCTGAGG - Intronic
961472484 3:127124845-127124867 TAGCCCTTCATGTGGCTGGGAGG + Intergenic
961689852 3:128661280-128661302 AATCCATTCAGGTGGTTGGGGGG + Intronic
962259529 3:133894327-133894349 CCTTCCTACAGGTGGCAGAGGGG + Intronic
963247634 3:143077205-143077227 CCTCCCTCCAGGTGTGTGGGAGG + Intergenic
964721463 3:159770767-159770789 CCTCCCTTCAGGTGGCTGGGTGG + Intronic
967784154 3:193471859-193471881 CATTCCTGCAGGGGGCTGGGTGG + Intronic
968913701 4:3488086-3488108 CCTCCCTGCCTGTGCCTGGGAGG - Intronic
968923873 4:3536816-3536838 AGTCCATTCAGATGGCTGGGGGG - Intergenic
969086989 4:4663997-4664019 CCTGCCCTCAGGTGGTTGTGAGG + Intergenic
970430645 4:15986176-15986198 CCTGCCCTCAGGGGCCTGGGTGG - Intronic
970652472 4:18193676-18193698 CCAACCATCAGGTGGGTGGGTGG + Intergenic
971576242 4:28279228-28279250 AGTCCACTCAGGTGGCTGGGAGG - Intergenic
972333851 4:38087914-38087936 GCTCCCTTCTGTTGCCTGGGTGG + Intronic
972686667 4:41359701-41359723 CCTTCCTGCAGGTGGTTAGGGGG - Intronic
973730087 4:53814890-53814912 CCTCCTTCCTGCTGGCTGGGAGG + Intronic
976344593 4:83985677-83985699 CCACTCTTCAGGTTGCTGAGTGG + Intergenic
976812007 4:89108411-89108433 CCACCTTGCAGGTGGCTGGGAGG + Intronic
977716030 4:100184897-100184919 TCTCCTTTCAGGTGGATGTGAGG + Intergenic
979801345 4:124913385-124913407 TCTCCCTCCAGGTCCCTGGGAGG + Intergenic
980728552 4:136797657-136797679 CCTGCCATCAGGTTGCTGGCTGG - Intergenic
980820097 4:138004045-138004067 CCTCCCATCAGTTCACTGGGTGG - Intergenic
981110113 4:140925527-140925549 CCTCCCCTCCGATTGCTGGGAGG + Intronic
981505277 4:145492665-145492687 CCTCCCTTGAGGTTGGAGGGTGG + Intronic
982575935 4:157110063-157110085 CCTCCCTGAAGGTTGCGGGGTGG + Intronic
983493066 4:168411834-168411856 CCTCCCTTCTGCTTGCTGAGAGG + Intronic
985860118 5:2464272-2464294 CCTCCATGCAGGTGGCCTGGCGG + Intergenic
985963344 5:3320433-3320455 CCAGCCTTCAGGAGGCAGGGTGG + Intergenic
989414339 5:41156007-41156029 ACTACCTTCATGTTGCTGGGGGG + Intronic
991144335 5:63283215-63283237 GGTCCATTCAGTTGGCTGGGGGG + Intergenic
992094069 5:73344106-73344128 CCTCCCTGCAGGAGGCTGCTTGG - Intergenic
992583646 5:78209131-78209153 GGTCCCTTCAGGTGGTTGTGGGG - Intronic
995348509 5:111148515-111148537 CCTGCCATCAGGTGGCTGGCTGG + Intergenic
997656819 5:135561418-135561440 CCTCCGTGCAGGCGGCTGTGTGG - Intergenic
998594506 5:143514689-143514711 CCTCCATCCAGGATGCTGGGGGG - Intergenic
999447327 5:151650496-151650518 CCTTCCTTCTGGTGGCTGCATGG - Intergenic
999546345 5:152632706-152632728 CCTCCTTCCAGGTGGTGGGGTGG + Intergenic
1000673426 5:164090644-164090666 CATCCCTTGGGGTGGCTGGAAGG - Intergenic
1000952501 5:167501312-167501334 CCTCTCTTCAGGTTACAGGGTGG + Intronic
1001656645 5:173355836-173355858 CCTCCCCACAGATGGCCGGGAGG - Intergenic
1002180635 5:177429362-177429384 GCTGCCTTGATGTGGCTGGGAGG + Intronic
1002779863 6:357702-357724 CCTCCCATTAGATGGCAGGGTGG + Intergenic
1006502959 6:34469673-34469695 CCTTCCTGCAGGTGGCTCTGTGG + Intronic
1007258001 6:40542017-40542039 AGTCTCTCCAGGTGGCTGGGAGG - Intronic
1007341268 6:41192764-41192786 TCTGCCCTCAGGAGGCTGGGAGG + Intronic
1007344471 6:41217595-41217617 CTTTCCTTCAGGTCCCTGGGGGG + Intergenic
1008535166 6:52501919-52501941 CTTCTCTTCAGGTGGAGGGGAGG + Exonic
1010829020 6:80508332-80508354 CCACCATTCTGGTGGCTGTGTGG - Intergenic
1011164644 6:84432112-84432134 CCTGCCCTCAGATAGCTGGGAGG - Intergenic
1011684570 6:89814108-89814130 CCTTCATTCAGTTGGTTGGGGGG - Intronic
1013475948 6:110507500-110507522 AGTCCATTCAAGTGGCTGGGGGG - Intergenic
1016473544 6:144401343-144401365 CCCCCCTTCAGGTTGATGTGTGG + Intronic
1018385284 6:163297799-163297821 CCACCCATCAGGTGGCTGTGAGG - Intronic
1018454478 6:163939790-163939812 CCACCCTTGAGGAGCCTGGGTGG - Intergenic
1018897704 6:168032242-168032264 AGTCCATTCAGATGGCTGGGGGG + Intronic
1019274132 7:167004-167026 GCTCCTTTCAGGTTGCTGGTAGG - Intergenic
1019307766 7:344025-344047 CCTCTCTGCCAGTGGCTGGGGGG - Intergenic
1019660052 7:2219250-2219272 CCTCTCTCCTGGTGGCTGGGTGG - Intronic
1019769679 7:2875971-2875993 CCTCCCTCCAAGAGGCTGTGTGG + Intergenic
1020248542 7:6449254-6449276 CCACCCTGCAGCTGGCGGGGTGG + Intronic
1022499242 7:30872265-30872287 GCTCCAATCAGGTGGCTGGTGGG - Exonic
1024278403 7:47697806-47697828 CCTCCTTCCAGGTGCCAGGGAGG + Intronic
1025249884 7:57344543-57344565 CCCCTATTCAGGTAGCTGGGCGG + Intergenic
1026247447 7:68633763-68633785 GCTCCATTCAGTTGGGTGGGGGG + Intergenic
1026897978 7:74021598-74021620 GCTCCCTGCAGGCGGCTGTGTGG + Intergenic
1027363184 7:77430486-77430508 CCTCTCTTTAGGTGTCTGTGCGG - Intergenic
1029276608 7:99408808-99408830 CCTCACTTCCGGTGGGTGGCAGG - Exonic
1029354503 7:100041869-100041891 GGTCCATTCAGGTGACTGGGTGG - Intergenic
1029484104 7:100828802-100828824 CCTCCCATCAGTTAGCGGGGAGG + Intronic
1030270265 7:107661969-107661991 CCGCCCTTCTGGTGGGAGGGTGG + Intronic
1030517517 7:110556947-110556969 GCTTCCTTCAGGTTTCTGGGAGG + Intergenic
1034198037 7:149262681-149262703 CCCCCCTACAGCAGGCTGGGCGG + Intronic
1034761435 7:153675470-153675492 GCTCCCTTCAGTTTGCTGAGTGG - Intergenic
1036057894 8:5280264-5280286 GCTCCGTTCTGTTGGCTGGGGGG - Intergenic
1036221423 8:6924052-6924074 CGTCCATTCAGTTGGCTGGAGGG - Intergenic
1036531222 8:9589500-9589522 CCTCCCTTAAAGTTGCTGTGAGG + Intronic
1037123617 8:15318653-15318675 GGTCCCATCAGTTGGCTGGGGGG + Intergenic
1037331653 8:17749014-17749036 GGTCCCTTCAGATGGTTGGGGGG - Intronic
1037882859 8:22581368-22581390 CATCCCTACAGGTGGCCGAGCGG + Exonic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1042396478 8:68296692-68296714 CCTTACTTCAGTTGGCTTGGTGG - Intergenic
1044666610 8:94639836-94639858 CCACCGATCTGGTGGCTGGGGGG + Intergenic
1044732933 8:95246430-95246452 CCTCCCTTCAGTAGGGTGGCTGG + Exonic
1044963534 8:97554258-97554280 CCTCCCTCCAGGTGGGAAGGAGG - Intergenic
1045310269 8:100994969-100994991 CCTCCCTTCTGGGGCCTTGGGGG - Intergenic
1047327328 8:123852323-123852345 CCTGCCTCCAGGTAGCTGGCTGG + Intronic
1049236052 8:141512996-141513018 CCTGCCTACAGGTGCCTGGAGGG + Intergenic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049509328 8:143019512-143019534 CCTCACTTTAGGGGGGTGGGGGG + Intronic
1049791803 8:144475685-144475707 CCTCCTCTTAGGGGGCTGGGAGG + Exonic
1049830535 8:144698881-144698903 CCTCCCTTGGGGGGGTTGGGGGG + Intergenic
1050674958 9:8041769-8041791 CCTGCCTTGAGGTGGCAGGCTGG - Intergenic
1050952474 9:11615651-11615673 GGTCCATTCAGGTGGTTGGGAGG - Intergenic
1051212022 9:14755052-14755074 CCATGCTTCCGGTGGCTGGGTGG - Intronic
1051937203 9:22457624-22457646 CCTGCCACCAGGTGGCTGGCTGG + Intergenic
1053799587 9:41755841-41755863 GGTCCATTCAGATGGCTGGGGGG - Intergenic
1054145632 9:61559157-61559179 GGTCCATTCAGATGGCTGGGGGG + Intergenic
1054187996 9:61967901-61967923 GGTCCATTCAGATGGCTGGGGGG - Intergenic
1054465371 9:65490261-65490283 AGTCCATTCAGGTGGCTAGGGGG + Intergenic
1054650519 9:67620680-67620702 GGTCCATTCAGATGGCTGGGGGG + Intergenic
1055696974 9:78895599-78895621 CCTCCCTTCAGGCGGAGGTGTGG - Intergenic
1055776884 9:79775891-79775913 GGTCCATTCAGTTGGCTGGGGGG + Intergenic
1060544053 9:124450285-124450307 CCTGCCTCCAGGTGGGTGGGAGG - Intergenic
1061276022 9:129569697-129569719 GCTCCCCACAGGTGGCTTGGAGG + Intergenic
1061423845 9:130487001-130487023 TCCCCCTCCAGTTGGCTGGGTGG + Intronic
1061425691 9:130496911-130496933 CCTCCCTCCTGGAGGCTGGTTGG + Intronic
1061529818 9:131201848-131201870 ACTCCCTTCAGCTGCCTTGGAGG + Intronic
1062414114 9:136439357-136439379 CCTCCCTTCCGGCGGCTGCGGGG + Exonic
1185663290 X:1744074-1744096 CCTCCTTTCAGGTGGCGAGAGGG + Intergenic
1185801227 X:3013073-3013095 CGTGCCTTCACGTGGCTTGGTGG + Exonic
1186180212 X:6966843-6966865 CATGCCTGAAGGTGGCTGGGTGG - Intergenic
1186194656 X:7098686-7098708 GCTCCCCTTAGGTGGCTGAGGGG - Intronic
1188331441 X:28876403-28876425 CATTCTTTCATGTGGCTGGGAGG + Intronic
1190022692 X:46893702-46893724 CCTCCTTTCAGCTGCTTGGGAGG - Intronic
1191760031 X:64636635-64636657 CTTCTCCTCAGGTGGCAGGGTGG + Intergenic
1192147286 X:68690081-68690103 CCCCCTTTCATGAGGCTGGGCGG + Intronic
1192283315 X:69706940-69706962 AGTCCATTCAGGTGGTTGGGGGG + Intronic
1196257639 X:113540253-113540275 AGTCCATTCAGTTGGCTGGGGGG + Intergenic
1197708993 X:129653177-129653199 CCTGCCTCCAGGTAGCTGGCCGG - Intronic
1198127415 X:133659617-133659639 CCTCCCTCAAGGAGGCTGTGAGG + Intronic
1201891599 Y:18948786-18948808 AGTCCATTCAGGTGGCTGGGGGG - Intergenic