ID: 964723553

View in Genome Browser
Species Human (GRCh38)
Location 3:159791484-159791506
Sequence GGTTGCCAGATGCCCCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 170}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964723553_964723555 -3 Left 964723553 3:159791484-159791506 CCTGCTTGGGGCATCTGGCAACC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 964723555 3:159791504-159791526 ACCTCAGTCAAGTCACAGCAGGG 0: 1
1: 0
2: 0
3: 11
4: 162
964723553_964723554 -4 Left 964723553 3:159791484-159791506 CCTGCTTGGGGCATCTGGCAACC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 964723554 3:159791503-159791525 AACCTCAGTCAAGTCACAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 107
964723553_964723557 -2 Left 964723553 3:159791484-159791506 CCTGCTTGGGGCATCTGGCAACC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 964723557 3:159791505-159791527 CCTCAGTCAAGTCACAGCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 174
964723553_964723558 7 Left 964723553 3:159791484-159791506 CCTGCTTGGGGCATCTGGCAACC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 964723558 3:159791514-159791536 AGTCACAGCAGGGGTGCCCAAGG 0: 1
1: 0
2: 4
3: 36
4: 255
964723553_964723562 29 Left 964723553 3:159791484-159791506 CCTGCTTGGGGCATCTGGCAACC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 964723562 3:159791536-159791558 GGCCAGCTTTCTGCAGCTGCTGG 0: 1
1: 0
2: 0
3: 38
4: 353
964723553_964723559 8 Left 964723553 3:159791484-159791506 CCTGCTTGGGGCATCTGGCAACC 0: 1
1: 0
2: 0
3: 11
4: 170
Right 964723559 3:159791515-159791537 GTCACAGCAGGGGTGCCCAAGGG 0: 1
1: 0
2: 1
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964723553 Original CRISPR GGTTGCCAGATGCCCCAAGC AGG (reversed) Intronic
900398875 1:2464736-2464758 GCTGGACAGAGGCCCCAAGCAGG - Intronic
901864588 1:12096148-12096170 GATTGCCACATGACCCAAGCAGG - Intronic
903032831 1:20476102-20476124 GGTTCCCAGAGGACCCAAGCAGG + Intergenic
903117238 1:21188370-21188392 GATTTCCAGATGCCCACAGCTGG + Intergenic
905441278 1:37997782-37997804 GGATGCCAGACGCCCCTGGCAGG - Exonic
906556944 1:46721683-46721705 GGTCACCAGAAGCCCCAGGCAGG + Intergenic
908408889 1:63843154-63843176 GGCTGCCAGATGCTCCAGGCAGG + Intronic
912411979 1:109485929-109485951 CCTTTCCAGAAGCCCCAAGCAGG - Intronic
919669993 1:200329699-200329721 GGCTGCCAGGTGCTCCAGGCAGG - Intergenic
920853497 1:209645394-209645416 GTTTCCCAGAAGCCCTAAGCAGG - Intronic
921079415 1:211726653-211726675 GATTGGCACATGACCCAAGCTGG - Intergenic
922100093 1:222472488-222472510 GGCTGCCAGGAGGCCCAAGCTGG + Intergenic
924235073 1:241993698-241993720 GGCTGCCAGATGCTCCAGGCAGG - Intergenic
1063806212 10:9644986-9645008 GATTACCAGATATCCCAAGCTGG - Intergenic
1065678096 10:28199477-28199499 TGTAGCCAGATACCCCAAGGTGG + Intronic
1068295624 10:55069099-55069121 GGTTGCCATATTGGCCAAGCTGG + Intronic
1068998467 10:63236572-63236594 GGTTGGCAGATGCTGTAAGCAGG - Intronic
1070649248 10:78222948-78222970 GGTCCCCTGATGCCCCACGCTGG + Intergenic
1070799888 10:79239159-79239181 GGTTGGCAGAAGCCCCAGGAAGG + Intronic
1072927549 10:99629726-99629748 GGTTACCAGATGCAGCAGGCAGG + Intergenic
1077391397 11:2302173-2302195 GGTTGCCAAATGCCAGATGCTGG + Exonic
1078509272 11:11973552-11973574 GTTTGTCAGATTCCCCCAGCAGG - Intronic
1078806864 11:14714625-14714647 GGATGACTGATGCCCCAAGATGG + Intronic
1081653627 11:44842138-44842160 GGCTGGCAGAAGCCCCAAGGTGG + Intronic
1083254245 11:61486544-61486566 GTTGGCCAGAGGCTCCAAGCGGG + Exonic
1083326591 11:61876182-61876204 GGCTGCCAGCTGCCGGAAGCCGG + Exonic
1083598349 11:63931021-63931043 GGTTGCCAGATTCCATAAGTGGG - Intergenic
1083932843 11:65855299-65855321 GGCTGCCAGATGCTCCAGGCAGG + Exonic
1087994688 11:104789614-104789636 GGTTGCCATATGCCCTATGTGGG + Intergenic
1088127535 11:106446998-106447020 GGGTGTCAGATGCCTCAGGCAGG + Intergenic
1089072046 11:115708166-115708188 GGTTTCTAGATGCCCCTGGCAGG + Intergenic
1089214965 11:116829769-116829791 GGTGTCCAGATGCAGCAAGCGGG - Intronic
1089221158 11:116873172-116873194 GGCTGCTACCTGCCCCAAGCTGG + Intronic
1089429853 11:118413874-118413896 GGTAGCCACATTGCCCAAGCTGG + Intronic
1090403833 11:126465721-126465743 CGTGGCCAGATGCAGCAAGCCGG + Intronic
1091049269 11:132352756-132352778 GACAGCCACATGCCCCAAGCAGG + Intergenic
1091317961 11:134628911-134628933 GGGTGCCAGATGCCTGAAGAGGG + Intergenic
1091820420 12:3471603-3471625 GGTGAGCAGATGCCCCATGCTGG - Intronic
1092890116 12:12961785-12961807 GGTTGCCATGTTGCCCAAGCTGG + Intergenic
1092920883 12:13230694-13230716 GGCTCCCAGATGCACCAAGGGGG - Intergenic
1094730040 12:33164006-33164028 GGTTGACAGACACCTCAAGCAGG + Intergenic
1095508558 12:42924705-42924727 GGTGGCCAGAGGTCACAAGCTGG + Intergenic
1097688838 12:62715273-62715295 CGGTGCCAGAATCCCCAAGCTGG - Intronic
1099747315 12:86721780-86721802 GTTTGCCAGAGGGTCCAAGCTGG + Intronic
1101329864 12:103749003-103749025 GGTGGCCAGATGCTCCCAGAAGG + Exonic
1101731984 12:107434252-107434274 GGTTGGGAGCTGCCCCTAGCAGG + Intronic
1102682963 12:114702948-114702970 GGTTTCCAGGGGCCCCCAGCAGG + Intergenic
1106536268 13:30646540-30646562 TGTTGCCAAATGTCCCAAGGGGG - Intronic
1110567065 13:76967712-76967734 GGTTGCCAGATACCCTATACAGG - Intergenic
1114062552 14:19032232-19032254 GGTAGCCACATGACCCAAGGAGG + Intergenic
1114099709 14:19367765-19367787 GGTAGCCACATGACCCAAGGAGG - Intergenic
1114740954 14:25096492-25096514 GCTTGCCAGATGCCCAGAGCTGG - Intergenic
1115508875 14:34120291-34120313 GCGTGCCAGATGCCCCAGGAAGG - Intronic
1116808039 14:49512281-49512303 GGAGGCCAGAAGTCCCAAGCGGG - Intergenic
1117019299 14:51552942-51552964 GGATGCAAGAAGTCCCAAGCTGG + Intronic
1117646382 14:57857749-57857771 GCTTCCCAAATGCCCCAGGCTGG - Intronic
1119890627 14:78179515-78179537 GGTTGAGAGGGGCCCCAAGCTGG + Intergenic
1120603489 14:86542145-86542167 AATTGCCAGATGCCCCATGAGGG - Intergenic
1122347008 14:101067007-101067029 GGTTGGCACATCCCCCAGGCTGG + Intergenic
1123494250 15:20809234-20809256 GGTAGCCACATGACCCAAGGGGG - Intergenic
1123550747 15:21378317-21378339 GGTAGCCACATGACCCAAGGGGG - Intergenic
1125485620 15:40108883-40108905 GTTTGCGGGATGCCCCGAGCAGG - Intronic
1126393198 15:48181313-48181335 GGTTGCCCTATGACCCAAGATGG + Intergenic
1127392524 15:58518234-58518256 TGTTTCCAAATGCCCCAAGGTGG + Intronic
1127455172 15:59150411-59150433 GGCTGACAGATGCTCCCAGCTGG + Intronic
1129149623 15:73679932-73679954 GCTTGCCAGATGCTTCCAGCTGG + Intergenic
1132861311 16:2073121-2073143 GGCTGCCAGATGCCCAGAGTGGG + Intronic
1134234403 16:12454210-12454232 GGTTACCACATGGCCCAAGGCGG - Intronic
1136346440 16:29679128-29679150 GGCTCCCAGAGGCCCCAGGCTGG - Exonic
1137784974 16:51131119-51131141 GATTGCCAAATGCCCAAAGTTGG + Intergenic
1137922112 16:52500475-52500497 GGTGGCCATATTTCCCAAGCTGG + Intronic
1138678742 16:58670314-58670336 AGATGCCAGATGACCCCAGCAGG - Intronic
1139948540 16:70658010-70658032 GGTGGCGAGATGACCCATGCAGG + Intronic
1141432149 16:83975828-83975850 TTTTGCCAGAGACCCCAAGCGGG - Intronic
1141627924 16:85271216-85271238 GGGTCCCAGAGCCCCCAAGCAGG + Intergenic
1144888115 17:18477694-18477716 AGTTGCCAAATGCCCCCAGATGG + Intronic
1145144090 17:20466609-20466631 AGTTGCCAAATGCCCCCAGATGG - Intronic
1145979997 17:29005717-29005739 GGCAGCCAGATGCCCGAAGCTGG + Intronic
1146211506 17:30947011-30947033 GGTTGTCAGATGCACCATACTGG - Intronic
1149763423 17:59253775-59253797 GATGGCCACATGACCCAAGCTGG - Intronic
1150579489 17:66459175-66459197 ATTTGCCAGATGGCCCAGGCTGG - Intronic
1151586373 17:75011125-75011147 GGCCACCAGATGGCCCAAGCAGG + Intergenic
1151625559 17:75273336-75273358 GCAGGCCAGCTGCCCCAAGCGGG - Exonic
1152613326 17:81326421-81326443 GGTTGCCAGATGACGCAGGTGGG + Intronic
1152742928 17:82026282-82026304 GGTGGCCAGATGCCCCAGGATGG + Intronic
1152887890 17:82863241-82863263 GGGTGGCAGATGCCCCCAGGAGG + Intronic
1154451774 18:14483689-14483711 GGTAGCCACATGACCCAAGGGGG - Intergenic
1155416628 18:25605823-25605845 GGTTCCCAGATTCCCAGAGCTGG + Intergenic
1166919720 19:46221047-46221069 TGATCCCAGATGCCCCAGGCTGG - Intergenic
1167203734 19:48086021-48086043 GGTTGAAAGAAGCCCCCAGCTGG + Intronic
926666036 2:15524329-15524351 GGGTGCAAGATGCCCCACACAGG + Intronic
927193320 2:20531791-20531813 GGTTCCCAGATCCCCCAGGTTGG - Intergenic
927448735 2:23188248-23188270 GGTTGACAGGAGCCACAAGCAGG + Intergenic
929667247 2:43842519-43842541 AGTTGCCAAAGCCCCCAAGCAGG - Intronic
935957261 2:108389727-108389749 TTTTGCCAGTTGCCCCAGGCTGG + Intergenic
936344221 2:111662969-111662991 GGGTGCCAGGAGCCCCCAGCAGG + Intergenic
936983282 2:118284333-118284355 GGATGCCAGTTGCCCCCAGTGGG - Intergenic
938136746 2:128765534-128765556 GGTTGCCAGACACCCTATGCAGG - Intergenic
938339534 2:130526488-130526510 GGGTGCCAGAATCCCCAAACAGG - Intronic
938350305 2:130594264-130594286 GGGTGCCAGAATCCCCAAACAGG + Intronic
938479917 2:131652439-131652461 GGTAGCCACATGACCCAAGGAGG + Intergenic
939137011 2:138308821-138308843 TGTTGCCAGATGCCCCTGGGGGG + Intergenic
940882098 2:158956958-158956980 TGTTGCTAGATTGCCCAAGCTGG - Intergenic
946107762 2:217386976-217386998 GGTGGCCACAGGACCCAAGCTGG + Intronic
1169081160 20:2798472-2798494 GGCTGCTGGATGCCTCAAGCCGG + Exonic
1169494030 20:6096328-6096350 GTTTGCCATATTCCCCAGGCTGG - Intronic
1174322347 20:49751756-49751778 GGTTGCCAGGTTGCCCAGGCTGG - Intergenic
1174847293 20:53954997-53955019 GTTTGCCAGTTGCCACAATCAGG - Intronic
1176082961 20:63283146-63283168 GCTTGGCAGATGGCCCACGCTGG + Intronic
1176444370 21:6806531-6806553 GGTAGCCACATGACCCAAGGGGG + Intergenic
1176822535 21:13671569-13671591 GGTAGCCACATGACCCAAGGGGG + Intergenic
1178247937 21:30972238-30972260 GGTTCCCAGCTCCCCCAAGATGG + Intergenic
1179033071 21:37736788-37736810 GCTTGCCAGATGTTCCAACCTGG - Intronic
1179304354 21:40141316-40141338 GGTTGAAAGAAGCCCCAGGCTGG + Intronic
1180009350 21:45039817-45039839 GCTTGCCAGGTGCCCCTAGATGG - Intergenic
1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG + Intronic
1180481044 22:15754859-15754881 GGTAGCCACATGACCCAAGGAGG + Intergenic
950145679 3:10648129-10648151 GGTTGCCGGCTGTCCCCAGCTGG + Intronic
953223822 3:40998580-40998602 GGTTCCCAGAGGGCCCCAGCGGG + Intergenic
957845557 3:85729605-85729627 GGTTGACAAATGCCACAAGAAGG + Intronic
960267153 3:115633289-115633311 AGTTGCTAGGTGACCCAAGCAGG - Intronic
962753713 3:138452596-138452618 TGCTGCCAGATGTCCCAAGGAGG + Intronic
964240326 3:154585405-154585427 GGTTGCCAGGGGAACCAAGCAGG + Intergenic
964723553 3:159791484-159791506 GGTTGCCAGATGCCCCAAGCAGG - Intronic
966421539 3:179739203-179739225 GGCAGCCAAATGCCCCATGCAGG - Intronic
970993466 4:22238734-22238756 TGTTGCTAGATGCCCCAGGAAGG - Intergenic
990487422 5:56272934-56272956 GGGTGCCAGCTGGCCCAATCTGG + Intergenic
991700651 5:69313334-69313356 GGCTGCCAGATGCTCTAGGCAGG + Intronic
995848399 5:116519166-116519188 TCTTGCAAGATTCCCCAAGCTGG + Intronic
996493919 5:124131111-124131133 TGTTGCCAGATGGCACAATCGGG - Intergenic
997653724 5:135540144-135540166 GGTAGCCAGATGTTCCAAGGTGG + Intergenic
999751089 5:154628679-154628701 GGTTCCCTGATGCCCCAAGGGGG + Intergenic
1000509682 5:162165472-162165494 GGTTGCCAGAGGCCCCAGCTAGG - Intergenic
1011843777 6:91535614-91535636 TGTAGGCAGATGGCCCAAGCAGG - Intergenic
1015480764 6:133706014-133706036 GCTTGCCAGGTGACCCTAGCTGG + Intergenic
1017375055 6:153759653-153759675 GGTTGAAAGAGGCCCCCAGCTGG + Intergenic
1017527977 6:155259390-155259412 GGATGCCAGATGGCAGAAGCTGG - Intronic
1018902066 6:168056648-168056670 GGCTGCCAGAGCTCCCAAGCCGG - Exonic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1020694116 7:11393111-11393133 GGTTGACAGATGCCTCATACAGG + Intronic
1022384289 7:29887405-29887427 GGTTGCCAGATGAACCATACAGG + Intronic
1022723898 7:32963876-32963898 GGTAGACACCTGCCCCAAGCAGG - Intronic
1025049728 7:55724039-55724061 GGTGGACACCTGCCCCAAGCAGG + Intergenic
1025052613 7:55742750-55742772 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025129897 7:56369757-56369779 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130195 7:56370986-56371008 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130515 7:56372284-56372306 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1025130833 7:56373578-56373600 GGTCGCCAGGAGGCCCAAGCTGG + Intergenic
1026521702 7:71123515-71123537 CGTTCCCAGATGCCCCACTCAGG + Intergenic
1028630194 7:92926100-92926122 GGTCGACAGATGCCTCATGCAGG - Intergenic
1032437253 7:131910208-131910230 GTGTGCAAGAGGCCCCAAGCAGG - Intergenic
1032591952 7:133199930-133199952 GCTTGCCAGTTGCCCACAGCAGG + Intergenic
1033683274 7:143617290-143617312 AATTGCCAGATGGCCCCAGCTGG - Intergenic
1033701339 7:143840348-143840370 AATTGCCAGATGGCCCCAGCTGG + Intergenic
1034220239 7:149438783-149438805 GGGTGCTAGATGACCTAAGCTGG + Intronic
1036384973 8:8270909-8270931 GGGTGCAAGAAGCCCCAAGCTGG + Intergenic
1040587443 8:48756951-48756973 AGGTGCCAGATGGCCCAAGATGG + Intergenic
1043499228 8:80836579-80836601 GGTTGCCAGGTTTCCCAGGCTGG - Intronic
1050184956 9:2963486-2963508 GATTGCCAGATGGCCCACCCAGG + Intergenic
1050616398 9:7405744-7405766 GGTTGCTAGATACCTCAAGTTGG + Intergenic
1053666613 9:40322062-40322084 GGTGACCAGATGCCCCGACCAGG - Intronic
1054377765 9:64462090-64462112 GGTGACCAGATGCCCCGACCAGG - Intergenic
1054517996 9:66054221-66054243 GGTGACCAGATGCCCCGACCAGG + Intergenic
1056551756 9:87658556-87658578 GGCTGCCAGGTGCCGTAAGCAGG + Intronic
1056706259 9:88954832-88954854 GGTTGCCATGTGCCCCCAGAGGG - Intergenic
1057199115 9:93131036-93131058 GGATGCCGGAAGCCCCAGGCAGG - Intronic
1057222092 9:93262916-93262938 GGTAGCCAGAGGCCCCTGGCTGG + Intronic
1058451896 9:105104880-105104902 GACTACCAGATCCCCCAAGCTGG - Intergenic
1059746138 9:117203787-117203809 GGTTGTCAGATACCCTATGCAGG - Intronic
1062204305 9:135327380-135327402 GGCTGCCCGATGCCTCAGGCGGG - Intergenic
1062376956 9:136266212-136266234 GGTGGCCAGATGGCCCAACCCGG + Intergenic
1203524828 Un_GL000213v1:77996-78018 GGTAGCCACATGACCCAAGGGGG - Intergenic
1185626858 X:1488540-1488562 GGTGGGCTGATGCCCCAAGAAGG - Intronic
1185887320 X:3794364-3794386 GGTTGCCAGGTGCTCCGAGGAGG - Intergenic
1186477747 X:9871441-9871463 GGTTTCGACATGCCCCAAGAGGG - Intronic
1186854287 X:13610999-13611021 GGCTCCCAGATGTCCCCAGCAGG + Intronic
1186858328 X:13646980-13647002 GGCAGCCAGATGACCCCAGCTGG - Intergenic
1188228969 X:27637478-27637500 GGTTGGCACATGCCCAAAGGTGG - Intronic
1189301467 X:39955545-39955567 GGTGGGCAGATGCCAGAAGCAGG + Intergenic
1193071963 X:77315401-77315423 GGTTGACAGATGCCTCATACAGG + Intergenic
1197350050 X:125372168-125372190 GGTTGACAGATGCCTCATACAGG - Intergenic
1199076963 X:143535704-143535726 GGTGGAAAGAAGCCCCAAGCTGG + Intergenic